ID: 996391851

View in Genome Browser
Species Human (GRCh38)
Location 5:122970858-122970880
Sequence ACAGAGATGAGAAAAGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1357
Summary {0: 1, 1: 1, 2: 11, 3: 134, 4: 1210}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996391851_996391861 26 Left 996391851 5:122970858-122970880 CCCTCCTCTTTTCTCATCTCTGT 0: 1
1: 1
2: 11
3: 134
4: 1210
Right 996391861 5:122970907-122970929 TCCAGTACACCCTTGTGTTAGGG 0: 1
1: 0
2: 0
3: 5
4: 73
996391851_996391855 -3 Left 996391851 5:122970858-122970880 CCCTCCTCTTTTCTCATCTCTGT 0: 1
1: 1
2: 11
3: 134
4: 1210
Right 996391855 5:122970878-122970900 TGTTTGCCAAGGCACCCCACAGG 0: 1
1: 0
2: 2
3: 6
4: 100
996391851_996391860 25 Left 996391851 5:122970858-122970880 CCCTCCTCTTTTCTCATCTCTGT 0: 1
1: 1
2: 11
3: 134
4: 1210
Right 996391860 5:122970906-122970928 TTCCAGTACACCCTTGTGTTAGG 0: 1
1: 0
2: 0
3: 12
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996391851 Original CRISPR ACAGAGATGAGAAAAGAGGA GGG (reversed) Intronic
900552853 1:3265183-3265205 ACAGGGATGAGACAGGAGCAGGG + Intronic
900775513 1:4581760-4581782 CCAGGGATGAGAAAACGGGAAGG - Intergenic
902149419 1:14430906-14430928 ACAGAGCTGAGATGTGAGGATGG - Intergenic
902679475 1:18032916-18032938 AGAGAGATGAGGAAAGTGGTTGG - Intergenic
902713756 1:18258292-18258314 ACAGAGAAGAGAACAGAAGTAGG - Intronic
902725446 1:18332864-18332886 ACAGTGATGGAAAAAGAGGCTGG + Intronic
902994564 1:20213532-20213554 ACAGAGATGAGGAAAGGTGATGG - Intergenic
903068798 1:20716486-20716508 ACAAAGAAGCGAAAACAGGATGG + Intronic
903097220 1:20989040-20989062 AAAGAGAGGAGAGGAGAGGAGGG + Intronic
903189612 1:21649360-21649382 ATAGAGAAGAAAAAAAAGGAAGG + Intronic
903273612 1:22207519-22207541 ACAGAGATGGGAAAGGGGAAGGG - Intergenic
903440033 1:23380769-23380791 GAAGAGATGAGGAAAGAGTAGGG + Intergenic
903964326 1:27077028-27077050 AGGGAGGGGAGAAAAGAGGAGGG - Intergenic
903990997 1:27269454-27269476 AGAGGGATGAGAAATGAGGTTGG + Intronic
904073081 1:27816944-27816966 AGAGAGAGGAGAAAGAAGGAAGG + Intronic
904225267 1:29012195-29012217 ACAAAGATGAGAAAAGAAAAAGG + Intronic
904390811 1:30184578-30184600 CTAGAGAAGAGAAAAGAGGGTGG - Intergenic
904447812 1:30588816-30588838 ACAGAGCAGGGGAAAGAGGAGGG + Intergenic
904505860 1:30953230-30953252 ACAGAAATGGGAAAGAAGGATGG + Intronic
904595359 1:31641176-31641198 ACTGAGATGAGAACACAGGGAGG - Intronic
904765685 1:32844716-32844738 ATAGAAATCAGAAAACAGGAAGG - Intronic
904974861 1:34448083-34448105 ACATAGATGAGTGAAGAGAAGGG - Intergenic
905746400 1:40422176-40422198 AGAGAGGTAGGAAAAGAGGATGG - Exonic
905970282 1:42136710-42136732 AAGGAGGGGAGAAAAGAGGAAGG - Intergenic
906418166 1:45639244-45639266 AGAGACATGAGAAAATAGAAAGG + Intronic
906531231 1:46525261-46525283 ACAGATGTGAGGAAAGAGGCTGG + Intergenic
906616872 1:47239519-47239541 ACAGAGACCAAAAAAGAGGAAGG - Intergenic
906747636 1:48232814-48232836 GAAGAGAAGAGAAAAGAGGGAGG + Intronic
906787925 1:48632115-48632137 AGAGAGTGGGGAAAAGAGGAAGG + Intronic
906891734 1:49723680-49723702 AAAGTGATAAGAAAAGATGATGG - Intronic
907049992 1:51323514-51323536 ACAGAGAAGAGAGAAGAAGGTGG - Intronic
907180091 1:52561883-52561905 ACACAGAAGAGAAAAGGGGCAGG + Intergenic
907626810 1:56038630-56038652 AAACAGAGGATAAAAGAGGAGGG - Intergenic
907747331 1:57226348-57226370 ACTGAAATGAGAAACGTGGAAGG - Intronic
907964412 1:59315386-59315408 AAGGAGAGGAGAAAAGAGAAGGG - Intronic
908014379 1:59815484-59815506 GCAGCGGGGAGAAAAGAGGATGG - Intronic
908322553 1:62992203-62992225 GGAGAAATGAGAAGAGAGGAAGG - Intergenic
908648000 1:66300528-66300550 ACATAGCTGATAATAGAGGATGG + Intronic
908940957 1:69433169-69433191 ACAGTGAGGAGAATATAGGATGG + Intergenic
908999013 1:70196035-70196057 ACAGTGGTGAGATAAGATGATGG - Intronic
909236522 1:73159615-73159637 ACAGAGATTTGGAAGGAGGAAGG - Intergenic
909336405 1:74480110-74480132 CAAGAGAAGAGAAAAGAGGAGGG + Intronic
909418692 1:75437667-75437689 ACAGCGATGATAAAGCAGGATGG + Intronic
910027371 1:82671911-82671933 ACATATATGAGAGAAGATGATGG - Intergenic
910062788 1:83113801-83113823 ACAGAGCTCAGACAAGAGGGTGG - Intergenic
910211573 1:84798904-84798926 AAAGAGAAGAGAAGAGAGGGAGG + Intergenic
910300711 1:85704430-85704452 AAAGAAATGAGAAAAGATCAGGG + Intronic
911205733 1:95090180-95090202 AGAGAGAAGAGAAAAGGAGAAGG - Intergenic
911420770 1:97637622-97637644 AAAGAAGTGAGAAAAGAGAAAGG + Intronic
911448578 1:98034125-98034147 AAAGAGAAGAGAAGAAAGGAAGG + Intergenic
911664064 1:100534424-100534446 ACAGAGATGGAGAAAGATGAAGG - Intergenic
911690950 1:100834063-100834085 ACATAGTTGAGAAGAGAGGCAGG - Intergenic
912213061 1:107576241-107576263 ACAGAGAAGAGTAAAGTGCATGG + Intronic
912487503 1:110040741-110040763 TCAGAGATGAGATCAGAGCAGGG + Intronic
912583973 1:110745097-110745119 GCAGAGAGGAGCAAAGAGTAAGG + Intergenic
912723793 1:112041734-112041756 ACAGAGATGAGAAAGGAAGAAGG - Intergenic
912903301 1:113676021-113676043 AGAGAGAAGAGAAGATAGGAGGG - Intronic
912991889 1:114495686-114495708 ACAGAGAAGAGAAAATTGGATGG + Intronic
913148455 1:116016194-116016216 AGAGAGGTGAGAAGAGGGGAGGG - Intronic
913189792 1:116403909-116403931 ACGAAGATGAGAAGAGAGTAGGG - Exonic
913203491 1:116515216-116515238 ACAGAGGTGACTAAACAGGAAGG - Intronic
913363804 1:118013061-118013083 ACATATATGTGAAAGGAGGAGGG - Intronic
913940315 1:125097714-125097736 AAAGAGAAGAGAAAGGAAGATGG - Intergenic
913999064 1:143677152-143677174 ACAGAATGGAGTAAAGAGGATGG + Intergenic
914504570 1:148277769-148277791 ACAGAATGGAGTAAAGAGGATGG - Intergenic
914509727 1:148320508-148320530 ACAGAATGGAGTAAAGAGGATGG + Intergenic
914677921 1:149917931-149917953 GGGGAGAGGAGAAAAGAGGATGG + Intergenic
914994527 1:152530937-152530959 ACAAAGATGAAAAAAGACAAGGG - Intronic
915015986 1:152734317-152734339 AGAGAGAAAAGAAAAGAGGAAGG - Intergenic
915123753 1:153649169-153649191 ACAGAGAAGAGAAAGGAGGTGGG + Intergenic
915424580 1:155814076-155814098 ACAGATATGAAAGAAGAGAAGGG + Intronic
915745422 1:158152992-158153014 ACAGAGCTGTGAAAAAATGACGG - Intergenic
915885423 1:159716475-159716497 AAAGAAAAGAGAAAAAAGGAAGG + Intergenic
915923178 1:159994058-159994080 ACAGCTATCAGAAAAGAGGAAGG + Intergenic
916055687 1:161067843-161067865 ACAGAGAGGTGGAAAGTGGAAGG - Intronic
916796228 1:168170200-168170222 AAAGAAAAAAGAAAAGAGGAAGG - Intergenic
917045583 1:170856322-170856344 AGAGAGGTGAGAAGAGAAGAAGG + Intergenic
917090005 1:171343337-171343359 ACAGAGCAGAGCAAAGATGATGG + Intergenic
917108052 1:171514967-171514989 ACATAGATGAAAAATGAGTATGG - Intronic
917594982 1:176520069-176520091 ACAGAGAGGGGACAAGAAGAAGG + Intronic
918132264 1:181639869-181639891 CAAGAGATGAGTAAAGAGAAGGG + Intronic
918149953 1:181789817-181789839 ATGGTGGTGAGAAAAGAGGATGG - Intronic
918194359 1:182207631-182207653 AGACAGAGGAGAAAACAGGAGGG - Intergenic
918319879 1:183354257-183354279 AAAGAGATGAGAGAGGAGGAAGG + Intronic
918657976 1:187053028-187053050 AGAGCAATAAGAAAAGAGGAAGG + Intergenic
918707330 1:187682170-187682192 AGAGAGATAATAAAAGAGGATGG + Intergenic
918989119 1:191674998-191675020 ACAGAGACTAGAAGACAGGAGGG - Intergenic
919017470 1:192057830-192057852 ACAGAGAGGAGAAAATATGAAGG - Intergenic
919111340 1:193222793-193222815 AAAGAGGTGAGAAAAAAGGGGGG - Intronic
919574528 1:199291467-199291489 ACAGATATGAGAAAAGACACCGG - Intergenic
919775825 1:201193355-201193377 ACAGAGAGGAGAGAAGTGGTAGG + Intronic
919925543 1:202190034-202190056 GCAGAGACCAGAAAAGAGGGCGG + Intergenic
919969286 1:202562906-202562928 ACAGAGATTATAAAAAAGTAGGG + Exonic
920131201 1:203733153-203733175 AGAGAGGTGAAGAAAGAGGAAGG - Intronic
920174903 1:204094603-204094625 ACAGAGATGAACAAAGATGCCGG + Intronic
920189222 1:204181775-204181797 AAGGAGAAGAGAAAAGAGGAAGG - Intergenic
920205226 1:204286425-204286447 ACAGAGAGGAGGAAAGGGAAAGG + Intronic
920417109 1:205806213-205806235 ACAGAGATGGGAAAAGCAGAAGG + Intronic
920560617 1:206935831-206935853 ACAGAGATGGGATGGGAGGATGG + Intronic
920672919 1:208018250-208018272 ACAGAGGGGAGCAAAGAGGCTGG - Intergenic
920734848 1:208523975-208523997 AGAGAGAAGAGAAAAGAAGAAGG - Intergenic
920791553 1:209097642-209097664 AGGCAGAAGAGAAAAGAGGAAGG - Intergenic
920945444 1:210524391-210524413 ACAGAGATGAGTGAGGAGGAAGG + Intronic
921114464 1:212074985-212075007 ACAAACCAGAGAAAAGAGGATGG - Intronic
921372072 1:214434264-214434286 TCAGAGATGAGATAAGGTGAAGG + Intronic
921453287 1:215335910-215335932 ACAAAAATGAGTAAAGAAGAAGG - Intergenic
921540035 1:216402956-216402978 ACTTATATGAGAAAAGAGGAAGG + Intronic
921622722 1:217343934-217343956 AAGGAGATGAGAAAAGAGCAAGG + Intergenic
921642195 1:217568664-217568686 ACAGAAATGAGCAAAGAGAAAGG + Intronic
922067172 1:222155632-222155654 ACAGAGATGTGAAAGGAGAGGGG - Intergenic
922559141 1:226555431-226555453 GCTGAGATGGGGAAAGAGGAGGG - Intronic
922789272 1:228301564-228301586 ACAGAGATGGGACAAAATGAAGG - Intronic
923791179 1:237112414-237112436 AGAGAGATAAAAAGAGAGGAGGG - Intronic
923914658 1:238488467-238488489 ACAAATAGAAGAAAAGAGGAAGG + Intergenic
924027313 1:239847929-239847951 AAAGAGAAGAGAAGAGAGGAGGG + Intronic
924155789 1:241175222-241175244 AGATATATGAGAAAAGAGAAGGG + Intronic
924247653 1:242100518-242100540 ATGGAGATGAGGAAACAGGACGG - Intronic
924628755 1:245717119-245717141 AGGGAGGAGAGAAAAGAGGAGGG + Intergenic
924730475 1:246706850-246706872 ACAGAGATGAAAAAAATTGAAGG + Intergenic
924843302 1:247737613-247737635 ACACAGAACAGAAAACAGGATGG - Intergenic
924920586 1:248625228-248625250 TCAGAGATGAGAAACAAGGATGG - Intergenic
1063027089 10:2190717-2190739 AGAGAGATGAGATAAACGGATGG - Intergenic
1063223936 10:3996894-3996916 ACAGAGATGAGAATCAAGAAAGG - Intergenic
1063273600 10:4539252-4539274 ACAAAGAAAAGAAAAGAGAAAGG + Intergenic
1063568208 10:7191169-7191191 AAAGAGCTGAGAAATGAGGTGGG - Intronic
1063824020 10:9873710-9873732 AAAGAGAAGAGAAAACAGGTAGG + Intergenic
1063844945 10:10117151-10117173 ACAGAGAGCACAAAAGAAGAAGG - Intergenic
1063980446 10:11447692-11447714 ACAGGCATGAGAAATGAGGGGGG + Intergenic
1064173528 10:13054659-13054681 AAAGAGAGGAGCAGAGAGGAGGG - Intronic
1064235530 10:13570624-13570646 ACAGACATGCTAAAAAAGGAAGG + Intergenic
1064401254 10:15023153-15023175 AGATATATTAGAAAAGAGGACGG - Intergenic
1064580753 10:16790596-16790618 ACAGAGATGAAAAACAGGGAAGG + Intronic
1064700973 10:18021441-18021463 ACAGAAAACAGAAAAGAGCAGGG - Intronic
1064785249 10:18887849-18887871 AGAGAGGAGAGAAGAGAGGAAGG + Intergenic
1064836427 10:19536510-19536532 AAAGAGATGAGAAATCAGCAAGG - Intronic
1064934782 10:20667529-20667551 AGAAAGAGGAGAAAAGAGAATGG - Intergenic
1065180513 10:23120022-23120044 ACAGAGATGAGAACAGAGGTAGG + Intronic
1065361594 10:24894350-24894372 AGAGAGAAAAGAAAATAGGAGGG + Intronic
1065670069 10:28106732-28106754 ACAGAGTTGACAGCAGAGGAAGG - Intronic
1065695045 10:28371972-28371994 AGAGAGAGGAGAAATGAGGAGGG + Intergenic
1065836032 10:29659339-29659361 ACAGAGAGGAGATGAGAAGATGG - Intronic
1065866561 10:29919860-29919882 AAAGAGAAGAGGAAAGAGAAGGG - Intergenic
1065874387 10:29984168-29984190 ACAAAGCTGAGAAAAAAGGCAGG + Intergenic
1066034255 10:31465907-31465929 ACAGATAAGATGAAAGAGGAAGG + Intronic
1066064275 10:31750738-31750760 CCAGAGAAGAGAAAAGCAGATGG - Intergenic
1066187840 10:33027896-33027918 AGTGAAATGAGAAAAGGGGAAGG - Intergenic
1066260163 10:33721946-33721968 ACAGAAATGAGAAAAAAGATAGG + Intergenic
1066472290 10:35710999-35711021 GCAGAGATGGGATATGAGGATGG - Intergenic
1067390735 10:45860813-45860835 ATAAAGAGGAGAAAAGAGAAAGG + Intergenic
1067431615 10:46249393-46249415 CCAGGGAAGAGAGAAGAGGAAGG + Intergenic
1067441805 10:46312781-46312803 CCAGGGAAGAGAGAAGAGGAAGG - Intronic
1067500736 10:46803036-46803058 ATAAAGAGGAGAAAAGAGAAAGG - Intergenic
1067593847 10:47536864-47536886 ATAAAGAGGAGAAAAGAGAAAGG + Intronic
1067640958 10:48044977-48044999 ATAAAGAGGAGAAAAGAGAAAGG + Intergenic
1067872544 10:49975290-49975312 ATAAAGAGGAGAAAAGAGAAAGG - Intergenic
1067914677 10:50384501-50384523 TCAGAGAAAAGAAAAGAGAAAGG - Intronic
1068026580 10:51652892-51652914 ACAGAGAGTAGAATAGAGGCTGG - Intronic
1068147026 10:53084869-53084891 ACAGAAAAGTAAAAAGAGGAAGG - Intergenic
1068269477 10:54701623-54701645 ACAGAAAAGAGAAAAAAGCATGG + Intronic
1068631323 10:59301111-59301133 ACAGAGATCATCAAAGAGGGTGG - Intronic
1068692642 10:59932699-59932721 GTAGAGAAGAGAAGAGAGGAAGG + Intergenic
1068694951 10:59957668-59957690 TCAGAGACTTGAAAAGAGGAGGG - Exonic
1068814555 10:61295018-61295040 ACAAACATCAGAAATGAGGAGGG + Intergenic
1069007815 10:63337488-63337510 AGAAAGAAGAGAAAAGAGAAGGG + Intronic
1070137922 10:73711031-73711053 ATAAAGAGGAGAAAAGAGAAAGG + Intergenic
1070388715 10:75950154-75950176 ACAGATGTGAGCAATGAGGAAGG - Intronic
1071163755 10:82781153-82781175 TCTGAGATGTGGAAAGAGGAAGG - Intronic
1071204699 10:83260557-83260579 ACAGAGATAAGAAAAAAAGGAGG - Intergenic
1071580147 10:86761828-86761850 ACAGATATGAAAAATGAGGTGGG + Intronic
1071809573 10:89164761-89164783 AAAGAAATGAAGAAAGAGGATGG + Intergenic
1072606778 10:96990720-96990742 ACAGAGAGGAGGTAAGTGGAAGG - Intergenic
1072929965 10:99653645-99653667 AAAGAGATGAAAAAAGCGGAAGG - Intergenic
1073087713 10:100904941-100904963 ACTGAGATGAGAATAATGGAGGG + Intergenic
1073698385 10:105895816-105895838 ACAAAGATGAAAAAAGACAAGGG + Intergenic
1073954946 10:108859546-108859568 AAAGAGAAGAGAAGAGAAGATGG + Intergenic
1073991400 10:109266196-109266218 ACAGAGATGCCAAAGGAGAAGGG - Intergenic
1074089303 10:110232367-110232389 ACAGAGATAACAAAGGGGGAGGG - Intronic
1074232067 10:111547468-111547490 AGAGAGATGAGCACAGAGGCAGG - Intergenic
1074724073 10:116289652-116289674 ACAGAGAGAAGGAAGGAGGAAGG - Intergenic
1075149098 10:119910643-119910665 ATGGAGAGGAGAAATGAGGAAGG - Intronic
1076076258 10:127536053-127536075 GCAAAGATGAGCAAACAGGAAGG - Intergenic
1076192562 10:128492968-128492990 AAAGAGATGAAAAAGGTGGAGGG + Intergenic
1076605504 10:131686899-131686921 ACACAGGTGAGAGAACAGGAGGG - Intergenic
1077371290 11:2182754-2182776 TCAGAGATGAGAAGAGAGGGTGG + Intergenic
1077373916 11:2196275-2196297 ACAGAGATGGGGAGAGAGGCAGG - Intergenic
1077795217 11:5484441-5484463 AAAGAAAGGAGAAAAGAAGATGG + Intronic
1077815001 11:5678437-5678459 TCAGAGATAAGAGAAGAGAAAGG + Intronic
1077873488 11:6283169-6283191 AAAGAGATGACAAAACAGTAAGG + Intergenic
1078248394 11:9597083-9597105 GCAGAATTGAGAAATGAGGAGGG + Intergenic
1078745987 11:14114714-14114736 CCACAGAGCAGAAAAGAGGAGGG - Intronic
1078915854 11:15778343-15778365 AAAGAAATAAGAAAAGAGGATGG - Intergenic
1079279748 11:19076563-19076585 ATAGGGATGAGGAAAGTGGATGG + Intergenic
1079284076 11:19113653-19113675 ATAGGGATGAGAACAGAGGCTGG - Intergenic
1079288930 11:19168304-19168326 AGAGAGAAGAGAAGAGAGGCAGG - Intronic
1079315472 11:19404308-19404330 ACTCAGATGAGAGAGGAGGAAGG + Intronic
1079589962 11:22170365-22170387 ACAGAGATGATAAGAAAGAAAGG - Intergenic
1079747744 11:24154999-24155021 ACAGAGAACAGAAAAGAGAAAGG + Intergenic
1079824137 11:25169179-25169201 TCAGAGATGACAAAAATGGATGG - Intergenic
1080087420 11:28301255-28301277 AGGGAGATGAGAGAAGAGGAAGG - Intronic
1080226315 11:29965151-29965173 ACAGAGATGAGAGGAGGGTAGGG + Intergenic
1080517150 11:33034934-33034956 ACAGAGAGGGGAAAGGTGGAAGG - Intergenic
1080614453 11:33933948-33933970 AAAGAGAAGAGAACAGATGAGGG - Intergenic
1080848210 11:36044859-36044881 GCAGAGCTGAGAACAGCGGATGG - Intronic
1081154214 11:39668975-39668997 ACAGAAATGAGAACAGAGCGTGG - Intergenic
1081246823 11:40777559-40777581 ACAGAAAACAAAAAAGAGGAAGG - Intronic
1081483927 11:43513390-43513412 ACAGAGAGGAGAAAAGAACTGGG + Intergenic
1081684009 11:45028663-45028685 ATAGAGATGGGAAAAGAGAAGGG - Intergenic
1081684142 11:45029665-45029687 ACAGAGATGGGAAAAGAGAAGGG + Intergenic
1081862996 11:46344947-46344969 AGAGAAATGAGCAATGAGGATGG - Intronic
1082088164 11:48067137-48067159 CCAGAGGAGAGAAAAAAGGAAGG - Intronic
1082765517 11:57164468-57164490 TCACAGATGAGAAAACAGGCAGG - Intergenic
1082892876 11:58158893-58158915 GCAGAAATGAGATATGAGGAAGG + Intronic
1083701989 11:64485598-64485620 ACAGAGAGGTAAAAAGCGGAAGG + Intergenic
1083996574 11:66276015-66276037 AGGGAGAGGAGAGAAGAGGAGGG - Intronic
1084159324 11:67336977-67336999 ACCTACATGAGAAAAGAGAAAGG + Intronic
1084563597 11:69917576-69917598 AGAGAGAAGAGAAGAGAGAAGGG - Intergenic
1084591480 11:70093117-70093139 ACAGAGAGAGGAAAAGAGAAAGG - Intronic
1085224846 11:74910567-74910589 AAAGTGAAGAGAAAGGAGGATGG + Intronic
1085449098 11:76621419-76621441 ACAGAGAGGAGAGAAGAGGCTGG + Intergenic
1085694932 11:78696124-78696146 ACACAGCTGAGGAAAGAAGATGG - Intronic
1085783611 11:79432236-79432258 ACAGAGATGAGGGAGGAAGAAGG - Intronic
1085818379 11:79765946-79765968 CCAGAGAAGAGAAGAGAGGAGGG - Intergenic
1085837194 11:79969731-79969753 GGAGAGAAGAGAAAAGAAGATGG + Intergenic
1086307127 11:85493668-85493690 TCAGAGAGGAGAGAAGGGGAGGG + Intronic
1086536455 11:87852812-87852834 AAAGAGGTGAGAAAAGATGAGGG - Intergenic
1087082031 11:94180212-94180234 GCAGAGATGAGAGAGGAGCAGGG + Exonic
1087355380 11:97086906-97086928 ACAGAGGTAAGGAAAGAGGGAGG - Intergenic
1087374536 11:97325474-97325496 ACAGAGATGAGAAAGAATCAAGG - Intergenic
1087717499 11:101625421-101625443 AGGGAGAGGTGAAAAGAGGAAGG - Intronic
1087872459 11:103313448-103313470 ACCAAGTTGAAAAAAGAGGATGG - Intronic
1088517604 11:110655754-110655776 ACAGAGATGACCAAAAAAGAGGG + Intronic
1088557516 11:111077760-111077782 AAAGAGATTTGAAAAAAGGAAGG + Intergenic
1088680008 11:112231886-112231908 ACAGAGACAGGAGAAGAGGAGGG + Intronic
1088771646 11:113041919-113041941 AGAGAGAAGAGAAAAGCTGAGGG - Intronic
1088793482 11:113247537-113247559 TCAGAGATGGGAAATGTGGAGGG - Intronic
1088977558 11:114829405-114829427 GCAGAAAGGAGAAAAGAGCATGG + Intergenic
1089039324 11:115431617-115431639 GCAGAGAGGAGAGAAGAGGTAGG - Intronic
1089116873 11:116102575-116102597 GCAGAGAGGTGAAAAGAAGAGGG - Intergenic
1089200543 11:116722336-116722358 ACAGAAATGGGACAAGAGAATGG + Intergenic
1089637902 11:119828095-119828117 GCAGAGAGGAGAAGTGAGGACGG + Intergenic
1089716042 11:120360203-120360225 AAAGTGGTGAGAAAAGAGGCTGG + Intronic
1089957916 11:122589547-122589569 ACAGGGATGAGAAAAAAGCAGGG + Intergenic
1090216472 11:124970094-124970116 AGAGAAATGAGAAAATAAGAGGG - Intronic
1090234918 11:125140075-125140097 AGAGAAATGAGAGAAGAGAAAGG - Intergenic
1091917573 12:4280832-4280854 TCAGAGATCAGAGAGGAGGAAGG - Intronic
1092244194 12:6854102-6854124 ACACAGCTGAGAAGGGAGGATGG - Intronic
1092277670 12:7074460-7074482 ACAGAAAAAATAAAAGAGGATGG + Intergenic
1092609990 12:10162343-10162365 TCAGAGAGGAGAAAATAGGAGGG + Intronic
1093265232 12:16995744-16995766 AGAGAGATGAGAATAAAGGAAGG + Intergenic
1093820363 12:23609602-23609624 ACACAAATGAGAATAGATGATGG - Intronic
1093921304 12:24862700-24862722 AGAGAGAGGGGAAAAGAGAACGG - Intronic
1094053709 12:26247227-26247249 ACAGAAGAGAGAAAAGAGGTAGG + Intronic
1094059655 12:26300260-26300282 AGAGAGAAGAGGAAGGAGGAGGG - Intergenic
1094260935 12:28498575-28498597 ACAGAGGTGAGGAAAAAGAATGG + Intronic
1094581682 12:31739344-31739366 AAACACATGAGAAAAGAGGCAGG - Intergenic
1095193965 12:39290625-39290647 AGATTAATGAGAAAAGAGGATGG + Intergenic
1095518764 12:43037230-43037252 ACAGACATGAGGGAAGAAGAAGG + Intergenic
1095551887 12:43451862-43451884 ACAGAGAGCTGGAAAGAGGAAGG + Intronic
1095594027 12:43938682-43938704 ACAGACATGAGAAAAAAAGATGG + Intronic
1095787450 12:46125422-46125444 AGAGAGAGGAGAGGAGAGGAGGG + Intergenic
1095811664 12:46378536-46378558 AAAGAGAAAAGAAAAGAGAAAGG - Intergenic
1095817886 12:46444321-46444343 ACAGAGATAAGAGAAGATCAAGG + Intergenic
1096241861 12:49963893-49963915 TCAGAGCAGAGAAGAGAGGAGGG + Intronic
1096242277 12:49965852-49965874 AGAGAGATGGGAACAGAGCAGGG + Intergenic
1096373562 12:51088766-51088788 ACAAAGACGTGAAAAGAAGAAGG + Intergenic
1096553474 12:52389442-52389464 ACAGAGAAGAAAAGGGAGGAAGG - Intergenic
1096824310 12:54263062-54263084 ATTGAGATGAGAAAAGAGGCTGG + Intronic
1096828934 12:54299931-54299953 ACAGAGATGAGACAGAATGAAGG + Intronic
1096885338 12:54713452-54713474 ACTGAGATGAGAAAAGCTGTGGG + Intergenic
1097296242 12:57965959-57965981 ACAGAAAAAGGAAAAGAGGAGGG + Intergenic
1097350598 12:58544448-58544470 ACAGAGAGGAGAAAGGAAGAAGG - Intronic
1098245087 12:68508677-68508699 TCTTAGATTAGAAAAGAGGAAGG - Intergenic
1098652853 12:72995610-72995632 AAAGAGAAGAGAAGAGAGGAAGG + Intergenic
1099405171 12:82250879-82250901 ACAGAGATGGGTCAAGAGAAAGG + Intronic
1099646500 12:85364143-85364165 AAAGAGATAAGGAAACAGGATGG + Intergenic
1100022790 12:90090201-90090223 AAAGAGAAGAGAAAAGAGGCCGG - Intergenic
1100415277 12:94366048-94366070 GGATAGATGAGAAAAGATGAGGG + Intronic
1100492588 12:95095557-95095579 AGAAAGAGCAGAAAAGAGGAAGG + Intronic
1100556146 12:95695919-95695941 AAAGAGAAAAGAAAAGAGGGAGG - Intronic
1100797238 12:98195690-98195712 ACAGAGGGGAGAAGAGAGAATGG - Intergenic
1100890600 12:99121525-99121547 ATACAGGTGAAAAAAGAGGAAGG + Intronic
1100950704 12:99846274-99846296 ACAGAGAAGAGAGAAGAGGAGGG - Intronic
1101250789 12:102932509-102932531 ACAGAGATGACAAGAGGAGAAGG + Intronic
1101275106 12:103190808-103190830 AAAGAGAAGAGAAAAGAAAATGG + Intergenic
1101324844 12:103706509-103706531 AGAAAAATGAGAAAGGAGGAGGG - Intronic
1101830954 12:108256102-108256124 AGAGAGAAGAGAAAGAAGGAAGG - Intergenic
1102859089 12:116319955-116319977 ACAGGGAGGAGAAAGGAGCAGGG + Intergenic
1102874105 12:116436533-116436555 TCAGAGTTGAGAGAGGAGGAGGG - Intergenic
1103084515 12:118052240-118052262 ACAGAGATGGCAAAAGAACAAGG + Intronic
1103123446 12:118400062-118400084 ACAGAGAGGAGTGAAGAAGAAGG + Intronic
1103258149 12:119561141-119561163 AGGGAGGTGAGAAGAGAGGATGG - Intergenic
1103487856 12:121295528-121295550 CCAGAGGAGAGAGAAGAGGATGG - Intronic
1103688567 12:122752357-122752379 AGAGAGAAAAGAAGAGAGGAAGG + Intergenic
1104157496 12:126147891-126147913 AAACGGATGAGAAAAGAAGAAGG + Intergenic
1104349649 12:128033881-128033903 ACAGAGCTGGGAACAGAAGATGG + Intergenic
1104365106 12:128169716-128169738 AAATGGATGAGAAAAGAAGAAGG + Intergenic
1104481864 12:129114443-129114465 GAAGAGATGAGAAAAGAAAAGGG - Intronic
1104606124 12:130189696-130189718 AAAGAGAAGAGTAATGAGGAGGG - Intergenic
1105002679 12:132701459-132701481 GAAGAGAAGAGAAAAGAAGAGGG - Intronic
1105657172 13:22454170-22454192 ACACAGGTGAGAAGGGAGGAAGG + Intergenic
1105746280 13:23379583-23379605 ACAGGGTGGAGAAAAGAGTAGGG - Intronic
1106216484 13:27706452-27706474 AAAGAAATGAAAAAAGAGGGAGG - Intergenic
1106382264 13:29251605-29251627 ATAGAGATGAGAAAGTAGAATGG - Intronic
1106387787 13:29304521-29304543 ACAAAGATAAAAAAAGATGAAGG + Intronic
1106527764 13:30557965-30557987 CCAGACATGTGAAAAAAGGAGGG - Intronic
1106712514 13:32353257-32353279 AGAGATAAGTGAAAAGAGGAGGG - Intronic
1106716744 13:32397567-32397589 ACAGTGATGAGAAAAAAAAATGG - Intronic
1106834197 13:33616153-33616175 AGAGAGAGAAGCAAAGAGGAGGG + Intergenic
1106945691 13:34824986-34825008 ACAGAGAGTAGAAAGGAGAATGG - Intergenic
1107229486 13:38091026-38091048 AGAGACATCTGAAAAGAGGAGGG + Intergenic
1107922779 13:45227818-45227840 AGAGAGATGAGTAAAGTGCATGG + Intronic
1107923057 13:45229801-45229823 GGGGAGAGGAGAAAAGAGGAGGG - Intronic
1108936939 13:55892940-55892962 ACAGACCTGAGAAAAGGGAATGG - Intergenic
1109063756 13:57656635-57656657 ACAGAGATGGAAAAAGAGCACGG + Intronic
1109105127 13:58240410-58240432 ACACAGATGAGAAAAGACCAGGG + Intergenic
1109245856 13:59954101-59954123 ACAGACATTAGAGAACAGGAGGG - Intronic
1109481882 13:62965486-62965508 ACAGAGGTGGAAAAAGAGAAAGG + Intergenic
1109554433 13:63953742-63953764 AAAGAGAAAAGAAAAGAGAAAGG - Intergenic
1109994929 13:70110600-70110622 ACAGAGACAGGAAAGGAGGAAGG + Intergenic
1110328565 13:74245170-74245192 ACAGATACAAGAAAAGAAGAAGG + Intergenic
1110411932 13:75214294-75214316 AGAGGGATGAGGAATGAGGAGGG - Intergenic
1110441033 13:75525324-75525346 ACAGGGAAGGGGAAAGAGGAAGG + Intronic
1110592060 13:77274874-77274896 ACAGACAAGTGAAGAGAGGAAGG - Intronic
1110788696 13:79562913-79562935 ACAAAGATGAAAAAAGACAAGGG + Intergenic
1111043251 13:82779555-82779577 ACAGAGAGAAGAAGAAAGGAAGG + Intergenic
1111198277 13:84901357-84901379 ACACAGCAGAGTAAAGAGGAAGG + Intergenic
1111497039 13:89064372-89064394 TCATAGATGAGAAAAGGGGCTGG + Intergenic
1111504866 13:89174238-89174260 ACAAAGAAGAGAAAAGGGAAGGG - Intergenic
1111592404 13:90367184-90367206 TCAGAGAAAAGAAAAGAAGAGGG + Intergenic
1111632092 13:90854605-90854627 GTAGAGATGGGAAAAGAGAAGGG - Intergenic
1112330543 13:98474144-98474166 ACAGAGTTCACAAAAGTGGAGGG + Intronic
1112359364 13:98703229-98703251 AAAGAGAAGAGAGAAAAGGAAGG + Intronic
1112436134 13:99392537-99392559 ACAGAGATGAATGAAGAGAAAGG + Intergenic
1112541017 13:100313146-100313168 ACAGAGAAGAGAATGGAGGGAGG - Intronic
1112559798 13:100502862-100502884 ACAAAGTTGAGAAAAGAAGAGGG + Intronic
1112597370 13:100820411-100820433 ACAGAAATGTTGAAAGAGGATGG + Intergenic
1112803940 13:103141361-103141383 GCAAAAAAGAGAAAAGAGGAAGG - Intergenic
1112849520 13:103687537-103687559 ACAGGGTTGAGAAAAGAGAATGG + Intergenic
1112910833 13:104481361-104481383 GGAGAGATGAGAAAAGAAGAAGG + Intergenic
1113140950 13:107148507-107148529 AAAAGGAGGAGAAAAGAGGAAGG + Intergenic
1113154295 13:107300260-107300282 GTAGAGATGAGAGAACAGGACGG - Intronic
1113214330 13:108020428-108020450 ACAGAAAACAGAAAAGAGCAAGG + Intergenic
1113258040 13:108528778-108528800 AGAGAGAAGAGAGAAGAGGGAGG - Intergenic
1113474432 13:110570280-110570302 ACCGAGGAGAGAAAAGAAGATGG - Intergenic
1113677713 13:112218812-112218834 AGAGAGAGGAGAGGAGAGGAAGG + Intergenic
1114040408 14:18673121-18673143 GAAGAGAAGAGAAGAGAGGAGGG + Intergenic
1114257296 14:21014297-21014319 AAAGAGAAGGAAAAAGAGGAAGG + Intergenic
1114308216 14:21442617-21442639 TCAGAAAGGAGAAAAGAGAAAGG + Intronic
1114366462 14:22032459-22032481 AAAGAGATGAGAGAGGGGGAAGG - Intergenic
1114372774 14:22108888-22108910 AAAGAGTTGAGAATAGAGGCAGG - Intergenic
1114378857 14:22178856-22178878 ACAGAATTAAGAGAAGAGGAAGG - Intergenic
1114709681 14:24765909-24765931 AGAGGGATGAGAAAAGAGGATGG - Intergenic
1114739945 14:25085992-25086014 AAAGAGATGGGTAAAAAGGAAGG + Intergenic
1114958415 14:27851309-27851331 ACAAAGATAAAAAAAGAGAAGGG + Intergenic
1115015304 14:28604287-28604309 GAAGAGATGAGGAAAGAGAAAGG - Intergenic
1115033743 14:28831405-28831427 ACTGTGATTAGAATAGAGGATGG + Intergenic
1115999106 14:39224116-39224138 GAAGAGAAGAGAGAAGAGGAAGG - Intergenic
1116368143 14:44095069-44095091 CAAAAGAAGAGAAAAGAGGAAGG + Intergenic
1117010794 14:51468291-51468313 ACAGAGATGGGAGAGGGGGAGGG + Intergenic
1117045599 14:51810253-51810275 ACAGAGGGGAGAGAAGAGCAGGG + Intergenic
1117579793 14:57140836-57140858 ACAGAGATTAATAATGAGGAGGG - Intergenic
1117591654 14:57275455-57275477 AGAGAGAAGAGAAAAGAGAGAGG + Intronic
1117604277 14:57410335-57410357 AAAGAGATAAGAAAAGTTGATGG + Exonic
1117606029 14:57430280-57430302 CCACAGATGAGGAAAGGGGAGGG + Intergenic
1118055508 14:62075446-62075468 AGAGAGATGAGAAAGGAGAGTGG - Intronic
1118112063 14:62732912-62732934 AGAGAGAATAGAAGAGAGGAGGG - Intronic
1118416797 14:65547463-65547485 AAAGAAATTAGAAATGAGGAGGG + Intronic
1118461803 14:65994047-65994069 ACAGAGATAAGAAAATAGAAGGG - Intronic
1118827743 14:69399069-69399091 ACAGAGATGGGAAAAGTCAATGG - Exonic
1118852271 14:69593142-69593164 ACAAAGAAGAGAAGAAAGGAGGG - Intergenic
1118993149 14:70813746-70813768 ACAGAAAGGAGAGGAGAGGAAGG + Intergenic
1119038040 14:71247071-71247093 ACAGAGATAAGAAACAAGGTTGG + Intergenic
1119159114 14:72438498-72438520 ACTGAGATGAGAAAACAGGATGG - Intronic
1119696938 14:76720614-76720636 GAAGAGGTCAGAAAAGAGGATGG + Intergenic
1119942646 14:78657381-78657403 AGATTGAGGAGAAAAGAGGATGG - Intronic
1119977071 14:79037085-79037107 TCTGAGAAGAGGAAAGAGGAAGG + Intronic
1120048829 14:79841338-79841360 ATAGAGAGGAGAAAACAGGTTGG + Intronic
1120091527 14:80337700-80337722 AGAGAGAGGAAAAAGGAGGAAGG + Intronic
1120224294 14:81773361-81773383 ACAGTGATGATAAAAGCGCATGG - Intergenic
1120471543 14:84932223-84932245 AGAGAGATGAGTAGAGAGTATGG + Intergenic
1120734688 14:88039898-88039920 AAAGATAGGAGAAGAGAGGATGG - Intergenic
1120999991 14:90444662-90444684 ACAGAAAGGAGAAAGGAGGAGGG - Intergenic
1121149663 14:91620508-91620530 ACTGAGATAGGAAGAGAGGAAGG - Intronic
1122047590 14:99034835-99034857 ACATAGATGTGAAGACAGGAAGG - Intergenic
1122826152 14:104371680-104371702 ACAGAGAACAGAAGAGAGAAGGG + Intergenic
1123434989 15:20248040-20248062 ACAGAGGGGAGGGAAGAGGAGGG + Intergenic
1123894376 15:24813802-24813824 AAAGACATGAGAAGAGAGCAGGG + Intergenic
1124109948 15:26775773-26775795 AGGGAGCTGAGAAAGGAGGAAGG - Intronic
1124133425 15:27010649-27010671 ACAGAGATGAGAAAGGGGAGAGG - Intronic
1124170676 15:27369891-27369913 CCCAAGGTGAGAAAAGAGGACGG - Intronic
1124810841 15:32936626-32936648 GGAGAAAGGAGAAAAGAGGAGGG + Intronic
1125010428 15:34866554-34866576 ACAGAGTTAAGAAAAAAGGTAGG + Intronic
1125067267 15:35503318-35503340 TCAGAAATGTGAAAAGGGGATGG - Intronic
1125130274 15:36276539-36276561 ACAGACAAGAAAAAAGAGCAGGG - Intergenic
1125320893 15:38487014-38487036 AAAGAGAAGAAAAAAGGGGAAGG - Exonic
1125736414 15:41929408-41929430 ACAGACATGGGAACAGAGGAAGG + Intronic
1126309305 15:47297872-47297894 ACACAAATGAGAAAAGAAGGAGG + Intronic
1126384759 15:48082829-48082851 ACAGAGAGGAGAACAAAGGTCGG + Intergenic
1126444663 15:48728740-48728762 ACAATGAAGAGAAACGAGGATGG + Intronic
1126650155 15:50911835-50911857 ACTGAGTAAAGAAAAGAGGAAGG + Intronic
1126754374 15:51910971-51910993 AAAGAGAGGAGAAGAGAGGGAGG - Exonic
1126820260 15:52496257-52496279 GCAGAGATGAGAAACCAAGAGGG - Intronic
1126945961 15:53820474-53820496 ACAGAGATGAAAAAAGGGAGAGG - Intergenic
1126963922 15:54029877-54029899 GCAGAGATCTGAAAAGATGAAGG - Intronic
1127240174 15:57104821-57104843 AGATAGATGAGAAAAGGAGAGGG - Intronic
1127346902 15:58110088-58110110 ACAGAAATTAGAAAAGGTGAAGG + Intronic
1127558794 15:60115254-60115276 ACAGAGATCACAAAAGAATAGGG + Intergenic
1127663898 15:61125707-61125729 ACTGGGAGGAGAAAAGAGGAAGG - Intronic
1127687450 15:61362876-61362898 ACAGAGATTAAAAAAGACAAGGG - Intergenic
1127762327 15:62151505-62151527 ACAGGCAAGTGAAAAGAGGAGGG - Intergenic
1127896784 15:63307382-63307404 ATAGAGATAAAAGAAGAGGAGGG + Exonic
1128050111 15:64656713-64656735 AAAAAGAAAAGAAAAGAGGAAGG - Intronic
1128539957 15:68519990-68520012 ACAGAAATGAGAAAATAGTTTGG - Intergenic
1128726889 15:69994602-69994624 GCAGAAAAGAGGAAAGAGGAAGG - Intergenic
1128835211 15:70803999-70804021 TCAGAGGTGAGAAAAGAGATAGG + Intergenic
1128889119 15:71315188-71315210 CCAGAGATGAGGAGAGATGAAGG - Intronic
1128936308 15:71749310-71749332 ACAGGGAGAAGAAAAGAGGAAGG + Intronic
1129240716 15:74250492-74250514 GCTGAGATGGGAAAAGGGGAAGG - Intronic
1129318722 15:74762062-74762084 AAAGAGATGAGACCAGAGGCTGG + Intergenic
1129821659 15:78606494-78606516 ACAGAAATCAGAAAAGATAAGGG + Intronic
1129906995 15:79195477-79195499 ACAGAGAAGTGAAGACAGGAAGG + Intergenic
1130119814 15:81038184-81038206 ACATGGAGGAGGAAAGAGGAGGG + Intronic
1130663481 15:85850119-85850141 ACAGGGATGGGGGAAGAGGAGGG - Intergenic
1130703012 15:86204526-86204548 GAAGAGAAGAGAAAAAAGGAAGG - Intronic
1130937572 15:88483186-88483208 ACAGAGTAGGGAAAAGAAGATGG + Intergenic
1131263003 15:90898794-90898816 ACAGAGAGGAAAAAAGAGAATGG + Intergenic
1131651925 15:94409700-94409722 AGAGAGAGGAGGAAAGAGGGAGG - Intronic
1131979781 15:97983568-97983590 ACAGAGAGGACTGAAGAGGAAGG - Intergenic
1131985758 15:98041730-98041752 ACATAGAGCAGTAAAGAGGATGG - Intergenic
1131988976 15:98074343-98074365 ACACAAATGAAAAAAGAGCAGGG - Intergenic
1132374898 15:101322620-101322642 AGCGAGATAAGAAAAGAGAAGGG + Intronic
1132620327 16:863436-863458 TCAAAGATGAAAAAAGAGGTTGG - Intronic
1133380417 16:5325212-5325234 ACAGGGAGGAGACAAGAAGAGGG - Intergenic
1133400066 16:5479279-5479301 ACAGAGATGAGCAATGAACAGGG - Intergenic
1133523667 16:6582938-6582960 AAGGAAAGGAGAAAAGAGGAGGG - Intronic
1133605170 16:7379839-7379861 AAAAGGAAGAGAAAAGAGGAAGG - Intronic
1133821236 16:9238367-9238389 ACAGAGATGGGAAAAGAAAATGG - Intergenic
1133906195 16:10025002-10025024 AGAGAGGAGAGAAAAGAAGAGGG + Intronic
1133915305 16:10104273-10104295 AGAGAAAAGAGAAAAGTGGATGG + Intronic
1134272411 16:12744600-12744622 ACAGAGAGGGGAACACAGGAAGG + Intronic
1134316977 16:13127563-13127585 ACAGAGAGAAGAGAAGGGGAGGG + Intronic
1134379463 16:13710609-13710631 CGAGAGGTAAGAAAAGAGGATGG - Intergenic
1134403984 16:13939173-13939195 ACAGAGAGGAGCAAAGAGCCTGG - Intronic
1135278204 16:21131491-21131513 AGAGAGATGAGAGAGAAGGAAGG + Intronic
1135500822 16:22994490-22994512 ACAGAGGGGTGAAAAGAGGCAGG - Intergenic
1135552630 16:23409754-23409776 GCAGGTATGAGAAGAGAGGAAGG + Intronic
1135967511 16:27048298-27048320 AGAGAGATGTGAGAAGAGAATGG - Intergenic
1136180041 16:28545146-28545168 CCAGAGGTGAGTAAAGAGGCAGG + Intergenic
1136278707 16:29194497-29194519 AAAGAGTTGAGAAAAGCGAAAGG - Intergenic
1136849630 16:33602944-33602966 ACAGAGGGGAGGGAAGAGGAGGG - Intergenic
1136849647 16:33602994-33603016 ACAGAGGGGAGGGAAGAGGAGGG - Intergenic
1137367489 16:47873402-47873424 ACAGAGAGAAAGAAAGAGGAAGG - Intergenic
1137386941 16:48050611-48050633 ACAGAGATGAGAAAGCACAATGG + Intergenic
1137392040 16:48089529-48089551 ACAGAGGTGACTTAAGAGGAGGG - Intronic
1137518631 16:49172722-49172744 AGAGATATGAGAAAATAGGATGG - Intergenic
1138108714 16:54306256-54306278 GCAGAGCTGAGACATGAGGAGGG + Intergenic
1138271265 16:55697727-55697749 ACAGAAATGTGACGAGAGGATGG + Intronic
1138286920 16:55817288-55817310 ACAGAGATGTGCAAAGCTGAAGG + Intronic
1138313467 16:56048092-56048114 ACAGAGAGGGGAAGAGAGGGAGG - Intergenic
1138470673 16:57233344-57233366 ACAGAGATGAGAGAAGACTGAGG - Intronic
1139257670 16:65558571-65558593 GAAGTGGTGAGAAAAGAGGAAGG - Intergenic
1139388146 16:66587714-66587736 ACAGAGATGAGATGGCAGGACGG + Intronic
1139675611 16:68521007-68521029 GCAGAGGTGAGAAAACACGAAGG - Intergenic
1139897739 16:70301111-70301133 AAAGACAAGAGAAAGGAGGAAGG - Intronic
1140054781 16:71516301-71516323 ACAAAGAGGAGTAAAGAAGAGGG + Intronic
1140235912 16:73158455-73158477 AGAAAGAAGAGAAAAGAGAAGGG - Intergenic
1140922904 16:79555189-79555211 AGAGAGATGAGAGAGGAGGATGG - Intergenic
1141330609 16:83107784-83107806 AAAAAGAAAAGAAAAGAGGAGGG - Intronic
1141417539 16:83887984-83888006 TCAGAGATGAGAAGAAGGGAAGG - Intergenic
1141449419 16:84087686-84087708 ACAGGGAGGAGAAGAAAGGAGGG - Intronic
1142083099 16:88160578-88160600 AAAGAGTTGAGAAAAGCGAAAGG - Intergenic
1142225694 16:88876628-88876650 ACAGAGAGGAAAAGAGAGGTGGG + Exonic
1142932119 17:3294431-3294453 ACAGATATGAGAAAAGACAAAGG + Intergenic
1143266651 17:5642990-5643012 AAAGAGAAGAGAAGAGGGGAAGG - Intergenic
1143280875 17:5753230-5753252 AGAGAAAAGAGGAAAGAGGAAGG - Intergenic
1143312430 17:6003059-6003081 ACAGAGAGGAGCACAGAGGAGGG + Intronic
1143496780 17:7317097-7317119 GACGAGATGAGAAAAGGGGAGGG + Intronic
1143512991 17:7406017-7406039 ACAGAGATGAGGAGAGAAAATGG + Intronic
1143685090 17:8507421-8507443 AAAGCAATAAGAAAAGAGGATGG - Intronic
1143818817 17:9542896-9542918 ACAGAGATGATCAGAGAAGAGGG + Intronic
1144283576 17:13750736-13750758 ACAGGGTCTAGAAAAGAGGAGGG + Intergenic
1144724610 17:17495696-17495718 ACAGAGAGCAGAAAAGGAGAAGG + Intronic
1144930304 17:18853772-18853794 AGAAAAAGGAGAAAAGAGGACGG + Intronic
1145838131 17:27970272-27970294 AGAGTGGTGAGAAAAGAGGCTGG - Intergenic
1145863454 17:28226156-28226178 AAAGAGTTGGGAAAAGAGGCAGG - Intergenic
1145918075 17:28588421-28588443 ACAAAGATAAGAAAACAGGAGGG + Intronic
1146138102 17:30340872-30340894 TCAGAGAAGAGAAAAGAGAATGG + Intergenic
1146248202 17:31310285-31310307 GCAGCGAACAGAAAAGAGGAAGG + Intronic
1146336938 17:31980751-31980773 GCAGAGGTAAGAAAAGAAGAAGG - Intronic
1146380270 17:32322725-32322747 ACACAGGTGAGAAAACAAGATGG + Exonic
1146505215 17:33399091-33399113 ATAGAGATGAGCAAAGAGGAAGG + Intronic
1147184004 17:38704104-38704126 ACAGAGAGGAGAAGGGAAGACGG - Intergenic
1147337973 17:39738487-39738509 ACAGAAAAGAGAAAAGTGGGAGG - Intronic
1148481769 17:47964410-47964432 GGAGAGGAGAGAAAAGAGGAAGG - Intergenic
1148579491 17:48733955-48733977 AGAGAGAGGAAAAAAAAGGAAGG - Intergenic
1149017678 17:51927307-51927329 TAAAAGATGAGAAAAGATGACGG + Intronic
1149540891 17:57467361-57467383 AAAGGGAAGAGAAAAGAGGAAGG + Intronic
1150480647 17:65506584-65506606 ACACAGATAAGTAAAAAGGATGG + Intergenic
1150517199 17:65826217-65826239 ATAGAGATGAGAGAAGAGAATGG - Intronic
1150644933 17:66972025-66972047 GCAGAGATGGGAGAAGTGGAGGG + Intronic
1150821192 17:68435780-68435802 GGAGAAAGGAGAAAAGAGGAAGG - Intronic
1151074165 17:71251960-71251982 AAAGAGAGGAAAAGAGAGGAGGG - Intergenic
1151161511 17:72169678-72169700 AAAGACATGAAAAAAGGGGAAGG + Intergenic
1151274797 17:73026179-73026201 AAAGAGAAGAGAGAAGAGAAGGG + Intronic
1151361085 17:73589411-73589433 GCAGAGCTGGGAAAAGAGGCCGG + Intronic
1151498895 17:74476215-74476237 TAAGAGATGAGACAATAGGATGG - Intronic
1151542748 17:74773076-74773098 CCAGAGGAGAGAAGAGAGGATGG + Intronic
1151776268 17:76205116-76205138 AAAAAGAAAAGAAAAGAGGAAGG - Intronic
1151931774 17:77236852-77236874 AAACAGAAGAGAAAAGAGGCTGG + Intergenic
1152005551 17:77678056-77678078 ACAGAGGGGTGAAAAGAGAACGG - Intergenic
1152030545 17:77839612-77839634 ACTGAGCTGAGGAGAGAGGAGGG - Intergenic
1152479292 17:80539207-80539229 ACAGTGAAGTGAGAAGAGGAAGG - Intergenic
1152913032 17:83016451-83016473 AGAGAGAAGAGAATAAAGGAGGG + Intronic
1153302960 18:3607871-3607893 AAAGAGATGAGAAGGGAGGTTGG + Intronic
1153612459 18:6899944-6899966 ACTGACACCAGAAAAGAGGAGGG - Intronic
1153901347 18:9619858-9619880 ACAGAGAAGTGAAATGAGAATGG - Intergenic
1154048981 18:10935302-10935324 ACAGTAATGAACAAAGAGGAAGG + Intronic
1154359810 18:13650096-13650118 ACAGAGATGTGAACAGACAATGG + Exonic
1155299189 18:24413162-24413184 ACAGAGAGCAGAATAGAGAAGGG - Intergenic
1155341986 18:24822411-24822433 CCAGAGATGAGAAATGGAGAAGG + Intergenic
1155370454 18:25094758-25094780 ACAAAGGTGAGAGAAAAGGAGGG - Intronic
1155382496 18:25239554-25239576 TAAGAAGTGAGAAAAGAGGAAGG + Intronic
1155433458 18:25786444-25786466 ACAGAAATCAGAAAAGAATATGG + Intergenic
1155627725 18:27854024-27854046 AGAGAGAAGAAGAAAGAGGAGGG + Intergenic
1155708479 18:28846479-28846501 CCAGAGACGAGAAGAGAGAATGG - Intergenic
1156063064 18:33104400-33104422 ACATAGATGAGATAAAAAGAAGG - Intronic
1156259635 18:35433016-35433038 ACAGAGATTAGAAGAGTGGGAGG + Intergenic
1156312459 18:35937303-35937325 AGAGAGATGAAAAAGGAGGAGGG + Intergenic
1156446636 18:37241895-37241917 AGAGAGATGGGAGGAGAGGATGG + Intergenic
1156723819 18:40103350-40103372 AAAGAAATGAAAAAAGAAGAAGG - Intergenic
1156753862 18:40496097-40496119 AGAAAGATAAGAAAAGAGAAGGG - Intergenic
1156984976 18:43340399-43340421 AAAGAGAGGAGAAAAAAGGCAGG - Intergenic
1157045884 18:44100784-44100806 ACAGAGAGCAGACAAGAGCAAGG - Intergenic
1157953721 18:52070434-52070456 ACAGAGAGCACAACAGAGGATGG - Intergenic
1158138838 18:54235023-54235045 ACAAAGAAGAAAAGAGAGGAAGG + Intergenic
1158397949 18:57094560-57094582 GCAGAGAGGAGCAAAGAGCAGGG - Intergenic
1158490926 18:57909145-57909167 ACAGGGATGAGAAGAGAAGATGG + Intergenic
1158744360 18:60181483-60181505 ACAGAGATGAAAAATGGTGAAGG - Intergenic
1158894950 18:61904040-61904062 ACAGAGATTAGAGAAGGGGATGG + Intergenic
1159010553 18:63055378-63055400 AGAGAGAGAAGAAAAGAGGGAGG - Intergenic
1159025910 18:63182064-63182086 AGAGAAAGGAGGAAAGAGGAAGG - Intronic
1159075270 18:63674179-63674201 ACAGAGCTGGGAAAGAAGGAAGG - Intronic
1159440082 18:68467024-68467046 ACAGAAATGAGAACAGTGGGAGG - Intergenic
1159541485 18:69782885-69782907 ACAGAGAGGGAAAAAGAGGATGG - Intronic
1159969174 18:74627858-74627880 AAAGAGAAGAGAAAAGGGGCGGG - Intronic
1160035477 18:75297746-75297768 ACAGAGAAGATAGAAGAGGAAGG + Intergenic
1160403651 18:78629536-78629558 CTAGAGATGAGGACAGAGGACGG + Intergenic
1160478506 18:79216688-79216710 ACAGGGAAAAGAAAAGAAGAGGG - Intronic
1163071581 19:14846868-14846890 ACAGAGATGTGAAAAGAAGTTGG + Intergenic
1163640342 19:18458448-18458470 ACAGAGGAGAGGAAAGAGGATGG + Intronic
1163927273 19:20357676-20357698 ACGCAGAGGAGAACAGAGGAAGG + Intergenic
1164421400 19:28096424-28096446 TCAGAGATGAGGGAAGAGAAAGG - Intergenic
1164439978 19:28269287-28269309 AAAGAGAAGAGAAAGAAGGAAGG - Intergenic
1164471600 19:28541011-28541033 ATAGATAACAGAAAAGAGGAGGG + Intergenic
1164546283 19:29166392-29166414 ACAGAGCAGAGGAAAGAGCATGG + Intergenic
1165054744 19:33167732-33167754 GGAGAGAAGAGAAAAGAGGAGGG - Intronic
1165636927 19:37348084-37348106 ACGGAGAAGACAAATGAGGAAGG - Intronic
1165667271 19:37643272-37643294 TGAGGGATGAGAAAAGAAGATGG - Exonic
1165934729 19:39382504-39382526 ACAGTGATGAGAGATGAGGGTGG + Intronic
1166076788 19:40418287-40418309 AGAGAGAGAAGAAAAAAGGAAGG - Intergenic
1166170780 19:41026384-41026406 ACAGAGATGGGAGAAGATGATGG + Intergenic
1166347625 19:42176396-42176418 GCAGAGCTGAGGAAAGAGGCAGG - Intronic
1166500146 19:43334312-43334334 ACATACATGAAAAAATAGGATGG - Intergenic
1166599688 19:44083077-44083099 ACAGAGACCAGAATAAAGGAAGG - Intronic
1166836011 19:45668414-45668436 ACAGAGATGAGCAGAGATGGTGG - Intronic
1166903434 19:46085456-46085478 ACAGAGAACAAAAAAGAGCAGGG - Intergenic
1167110582 19:47458287-47458309 AGAGAGATGGGGAAAGAAGAGGG - Intronic
1167574113 19:50309594-50309616 ACAGAGATGAAATGAGGGGAGGG - Intronic
1167607380 19:50488632-50488654 CCAGAGAAGAGGAAAGAGAAAGG + Exonic
1167627441 19:50601753-50601775 ACAGAGATGAATAGAGAGAAAGG - Intergenic
1167645738 19:50703936-50703958 ACAGAGATGAGAAAGGGAGGGGG + Intronic
1168100236 19:54137718-54137740 CCAGAGACGAGAAGAGAGGAGGG + Intronic
1168359981 19:55731389-55731411 AAAGAGAGAAAAAAAGAGGAAGG + Intronic
925744272 2:7031369-7031391 ACAGAGATGATAAAGCAGCAAGG + Intronic
925902994 2:8521841-8521863 CCAAGCATGAGAAAAGAGGAAGG - Intergenic
926069787 2:9877832-9877854 AGAGAGAGGAGAAAAGAGGGAGG - Intronic
926142326 2:10375090-10375112 TCACAGAAGAGAAAAGAGGCGGG + Intronic
926354877 2:12032470-12032492 ACAGAGATGAAAGAAAAGGGAGG + Intergenic
926421196 2:12701582-12701604 ACAGAGAAGAGCAAAGAAGAAGG - Intergenic
926554834 2:14344732-14344754 AGTGAGATGTGAAAAGAGAAGGG - Intergenic
926608511 2:14922152-14922174 ACAGAGATGTCAGAAAAGGAAGG + Intergenic
926623215 2:15067367-15067389 AAAGAGAGGAGAGGAGAGGAGGG + Intergenic
926631240 2:15138145-15138167 CCAGAGCTGAGAGCAGAGGATGG + Intergenic
926631545 2:15141144-15141166 AAAGAGAAGGGAAAAGGGGATGG - Intergenic
926794237 2:16605912-16605934 AGAGAGGTGAGAGATGAGGAAGG - Intronic
926880894 2:17542349-17542371 AGAAAGATGAGAAAAAAGCATGG + Intronic
927242535 2:20931318-20931340 TATGAGATGAGGAAAGAGGAGGG - Intergenic
927253719 2:21021222-21021244 AAAGAAAGAAGAAAAGAGGAAGG - Intronic
927541057 2:23911580-23911602 AGAAAGAAGAGAACAGAGGAAGG + Intronic
927668312 2:25047449-25047471 AGAGAGTTAAGAAAAGGGGAAGG - Intronic
927961746 2:27244666-27244688 CTAGAGATGAGAAAAGGAGAAGG + Intergenic
928106970 2:28476790-28476812 ACCCATATGAGAAAGGAGGAGGG + Intronic
928189751 2:29153023-29153045 ACAGTAAAGAGAAAAAAGGAAGG - Intronic
928484617 2:31717738-31717760 ACAGAGAACAGAAAAAAGCAAGG + Intergenic
929880269 2:45830313-45830335 AGAGAAATGAGAAAACAGGAAGG + Intronic
930270572 2:49251571-49251593 AGAGAGAAGGGAAAAGAGAAGGG - Intergenic
930288652 2:49466516-49466538 ACAGAGAAGACAAAACAGAAAGG - Intergenic
931046723 2:58362359-58362381 AAAGAGAGGAGGAAAGAGCAGGG - Intergenic
931105647 2:59052354-59052376 ACAGAGATGAGACTAAATGAAGG - Intergenic
931408999 2:62010624-62010646 ACTGAGATGAGAAAAAATGCAGG - Intronic
931501844 2:62877175-62877197 ACAGAAAACAAAAAAGAGGAGGG + Intronic
931649618 2:64455448-64455470 AAAGCAATGAGAAAGGAGGAAGG - Intronic
931827908 2:66020283-66020305 ACAGAGATGACAAGAGTGAATGG + Intergenic
931913817 2:66931284-66931306 AAAGAGATAATAAAAGAGTAGGG - Intergenic
931947371 2:67325068-67325090 GCAGAGGTGAGCTAAGAGGAGGG - Intergenic
931980694 2:67691085-67691107 ACAGACATGAGAAAAAGGCAAGG + Intergenic
932300445 2:70663359-70663381 ACAGAGATGGGAGAAGGGAAGGG + Exonic
932683154 2:73844646-73844668 ATAGAGATGGGAAAGGAGCATGG + Intronic
932731347 2:74224338-74224360 ACAAAGATGGGGAAAGAGGCAGG - Intronic
932753053 2:74384501-74384523 AGAAAAATGAGAAGAGAGGAGGG + Intronic
932794848 2:74685471-74685493 ACAGAGCTGAGAGAAGGTGAAGG - Intergenic
932950780 2:76290325-76290347 ACAGAGATGTTTAAAGAAGATGG + Intergenic
932992720 2:76808020-76808042 AGAAAGAAAAGAAAAGAGGAAGG - Intronic
932997119 2:76868859-76868881 ACAGATACTTGAAAAGAGGAAGG - Intronic
933011153 2:77065260-77065282 ATAGAGATGAGAAAAGTGCATGG - Intronic
933194472 2:79372606-79372628 ACAAAGAAGAGAAAAGAAAAGGG + Intronic
933211764 2:79579043-79579065 AAAGAAAAGAGAAAAAAGGAAGG - Intronic
933338319 2:80988227-80988249 ACAGAGGAGACAAAAGAGAAAGG + Intergenic
933488658 2:82955951-82955973 AGAGAGAAGAAGAAAGAGGAAGG + Intergenic
933740846 2:85532778-85532800 GGAGGGAGGAGAAAAGAGGAGGG - Intergenic
933837999 2:86261256-86261278 ACAAAGATGAGAGTAGAGGCCGG - Intronic
933877895 2:86637255-86637277 GAAGAGAAGAGAAGAGAGGAGGG + Intronic
935283471 2:101540688-101540710 ACAGAGTTGAGAAACCAGGAGGG - Intergenic
935384347 2:102485485-102485507 AGACAGATGAGAAGAGAAGACGG - Intronic
935485841 2:103652406-103652428 AGAGAAATGAGTAAAGAGGAAGG - Intergenic
935635177 2:105244324-105244346 ACAGAAATGAGAAACGATCAAGG - Intergenic
935859449 2:107312232-107312254 AGAAAGATGAAAGAAGAGGAGGG + Intergenic
935917699 2:107973879-107973901 GCAGATAAGAGAAATGAGGAAGG + Intergenic
936064396 2:109319610-109319632 ACAGGGATGATAAGAGAAGATGG - Intronic
936392308 2:112086722-112086744 ACAGAGCTGAGGAATGAGGGAGG - Intronic
936445981 2:112595579-112595601 GCAAAGATGAGAAAGGGGGAAGG + Intergenic
936998548 2:118440228-118440250 AGAGGGATGAGAGAAGAGCAGGG - Intergenic
937487592 2:122331917-122331939 GCAAAGAGGAGCAAAGAGGAGGG + Intergenic
937509790 2:122582919-122582941 AAAGAGAGGAGAGGAGAGGAGGG + Intergenic
937515477 2:122650149-122650171 ACAGAGATGAGAAGAAATGAAGG - Intergenic
937539412 2:122929812-122929834 TCATACATTAGAAAAGAGGAAGG - Intergenic
937677621 2:124609194-124609216 ATAGAGATAAGCAAAGAGGAGGG + Intronic
937688279 2:124722896-124722918 ACAGAGAGAAGACAATAGGAAGG - Intronic
937769064 2:125697264-125697286 CCAGAGATGAGACAGGAAGATGG - Intergenic
937897662 2:126990852-126990874 TCAGAGAAGTGACAAGAGGAAGG + Intergenic
937986181 2:127639125-127639147 GCAGAGATGAGGGAACAGGAAGG + Exonic
938264637 2:129918503-129918525 AGAAAAAAGAGAAAAGAGGAAGG + Intergenic
938269778 2:129959382-129959404 GAAGAGAAGAGAAGAGAGGAGGG - Intergenic
938575097 2:132596277-132596299 ACTGAGAGGAGAGAAAAGGAAGG - Intronic
938889094 2:135684563-135684585 ACAGAGATGTGTAAAGGGAAAGG + Intronic
939165750 2:138639630-138639652 ATAGAGATAAGAAATGAGGTAGG + Intergenic
939203692 2:139072619-139072641 ACAGTGAGGTGAAAAGATGAAGG + Intergenic
939244421 2:139605000-139605022 ACATTGATGAGAAAAATGGAAGG - Intergenic
939416203 2:141900919-141900941 ATTGAGGTGAGAAAAGAGAAGGG + Intronic
939741638 2:145915330-145915352 ACAGAGTTGATAGGAGAGGAGGG - Intergenic
940047297 2:149423196-149423218 ACAGTGCTGATGAAAGAGGAAGG - Intronic
940206086 2:151203216-151203238 CCAGAGTTCAGAGAAGAGGATGG + Intergenic
940410991 2:153362621-153362643 ACAAAGATCAAAAAAGACGAAGG + Intergenic
940443063 2:153742995-153743017 AGAGAGGGGAGAAGAGAGGAGGG + Intergenic
940607958 2:155951862-155951884 AGATAGATAAGAAAATAGGAGGG + Intergenic
940677418 2:156741766-156741788 GCAGAGATGAGAAAATTGAAAGG + Intergenic
940822568 2:158373148-158373170 GCAGAGGTGAGAAAGCAGGAAGG + Intronic
940917673 2:159274803-159274825 ACAAAGATCAGAAAACAGAAGGG + Intronic
941060156 2:160837663-160837685 ATAGAGACCAGAGAAGAGGATGG - Intergenic
941160558 2:162029826-162029848 GCAGAGAGGAGATAAAAGGAGGG + Intronic
942358642 2:175148123-175148145 ACAGAGGTGAGAAATCATGAAGG + Intronic
942985853 2:182140808-182140830 ACAGAGAGGAAAACAAAGGAAGG + Exonic
943352721 2:186814233-186814255 ACAAAGATCAAAAAAGAGAAAGG + Intergenic
943536618 2:189160072-189160094 ACAGAGAGGAGAAAAAAGGGAGG - Intronic
943536716 2:189161154-189161176 GCAGAAATGACACAAGAGGAAGG - Intronic
943785243 2:191870339-191870361 AGAGAGAAGAGAAAAGAGTTAGG + Intergenic
944256208 2:197625751-197625773 AGAGAGGAGAGAAAAGAGAAGGG - Intronic
944411506 2:199447565-199447587 ACAGAGACAAAAAAAAAGGAGGG + Intronic
945135444 2:206622744-206622766 ACAAAGAAGAGAACGGAGGAGGG - Intergenic
945389236 2:209243803-209243825 ACAGAGATCAAAAAAGACAAAGG + Intergenic
945544040 2:211126773-211126795 AGAGAGAGGAGAAAGGAGGAAGG - Intergenic
945766054 2:213978999-213979021 AAAGAGAGGAGAAATAAGGACGG + Intronic
946363413 2:219233468-219233490 ACAGAGATGCAAAAAAAGTATGG - Intronic
946472600 2:219976139-219976161 ACAGAGATGAGAGAAAAGGGTGG - Intergenic
946475625 2:220004068-220004090 ATAGAGTTAAGAAAAGAAGATGG + Intergenic
946766661 2:223046879-223046901 CCAGAGCTGAAAAAAGAGAAGGG - Intergenic
946866220 2:224043366-224043388 AGAGTGTGGAGAAAAGAGGAGGG - Intergenic
947139728 2:227009745-227009767 AGAGAGAAGAGAAGAGGGGAGGG + Intronic
947173115 2:227332374-227332396 ACAAAGAAGAGAAAAGCGGGAGG - Intronic
947182919 2:227428068-227428090 AAAGAGAAGAGAAAAGAAGAAGG - Intergenic
947647456 2:231754098-231754120 ACAAAGATGATAAAGGAGGGAGG + Intronic
948187831 2:236035188-236035210 ACAGAGATAAGTAAAGTGGTTGG + Intronic
1169001627 20:2171994-2172016 AGAGAGAAGAGAAAGAAGGAAGG + Intronic
1169024156 20:2353370-2353392 ACAGAGAAGAGAAAGGGGGAGGG - Intergenic
1169052141 20:2588843-2588865 ATATAGATCAGAAAAGAGAATGG - Intronic
1169276229 20:4235405-4235427 AGAGAGAAGGGAGAAGAGGAGGG - Intronic
1169321135 20:4634279-4634301 AGAGAGATGACAGCAGAGGAGGG - Intergenic
1169386101 20:5150725-5150747 ACAGAGATGAGGAAATGGGGTGG - Intronic
1169618945 20:7482725-7482747 ACAGTGATGAGTAGAAAGGATGG - Intergenic
1169733491 20:8812030-8812052 ACAGGGATTACAAGAGAGGAAGG + Intronic
1170032272 20:11955891-11955913 AGTGGGAAGAGAAAAGAGGATGG + Intergenic
1170206349 20:13802778-13802800 AGAGTGATGGGGAAAGAGGAAGG - Intronic
1170214321 20:13875692-13875714 AAAGAGATGAGGACAGAGGAAGG - Intronic
1170379338 20:15739761-15739783 ACAGAGATGATAGAAGGGTAAGG + Intronic
1171115294 20:22520232-22520254 ACTGAGATGGGAAAACAGGAGGG + Intergenic
1171236592 20:23531295-23531317 TCAGAGATGAGCAAAGAAAATGG - Intergenic
1171239952 20:23558493-23558515 ACAGAAATCAGAAGAAAGGAGGG - Intergenic
1171959948 20:31486054-31486076 GAAGAGCTGAGAAAAGAAGAGGG + Intergenic
1172324900 20:34026735-34026757 AGGGAGCAGAGAAAAGAGGATGG - Intronic
1173001843 20:39110532-39110554 AAAGAGACAAGAAAAGAGGAGGG - Intergenic
1173120661 20:40286398-40286420 ACAGAGATGAGCAAAAACCAAGG + Intergenic
1173296100 20:41759524-41759546 ACAGAGATGAGAGAAGGAGCTGG - Intergenic
1173332935 20:42090423-42090445 ACCCAGAAGATAAAAGAGGAAGG + Intronic
1173396854 20:42688243-42688265 ACAAAGACCAGAAAAGATGAAGG - Intronic
1173428238 20:42961554-42961576 ACAGAAATGAGCAAAGATGTGGG + Intronic
1173922244 20:46755071-46755093 ACAAAGATGGGAAAAGTGGCTGG - Intergenic
1174022871 20:47545572-47545594 ACAGAGACAAAAAAAGAAGAGGG - Intronic
1174034445 20:47659626-47659648 ACAGAGATGAGACTGAAGGATGG + Intronic
1174062690 20:47843892-47843914 ACAGAGAGGAAAAAAAAGGAAGG + Intergenic
1174206328 20:48842394-48842416 ACAGAAATGAGATCAGAAGAGGG - Intergenic
1174613145 20:51815538-51815560 ATAGGGAAGAGAAAAGAGCAAGG + Intergenic
1175355134 20:58359579-58359601 ACCAAGATGAGAAAAGGGAAGGG - Intronic
1175471306 20:59231068-59231090 AAAGAAAGAAGAAAAGAGGAAGG + Intronic
1175630936 20:60535790-60535812 ACATAGATCAGAAAAGAAAAAGG + Intergenic
1175921106 20:62450990-62451012 ACAGAGGTGAGAGGAGGGGAGGG - Intergenic
1176448802 21:6844119-6844141 GCAGAGATGAGAACAGGGAAAGG - Intergenic
1176826972 21:13709142-13709164 GCAGAGATGAGAACAGGGAAAGG - Intergenic
1176891653 21:14326797-14326819 CGAGAGAAGAGAGAAGAGGAGGG + Intergenic
1176915214 21:14617438-14617460 ACAATCATGAGGAAAGAGGATGG + Intronic
1177796565 21:25784827-25784849 ACAGAAATGAAAAAACAGGGCGG - Intergenic
1177906264 21:26974472-26974494 ACAGAGATGAGAAAGGGAGAAGG + Intergenic
1178038761 21:28615359-28615381 ACAGAGAGAGGAAAAGAAGAAGG - Intergenic
1178043689 21:28670424-28670446 ACAGCAATGAGAAAAGAAAATGG - Intergenic
1178129319 21:29553140-29553162 ACAGGGAGAAGAAAAGAGGAGGG + Intronic
1178481124 21:32979851-32979873 AAAGAGAGAAGGAAAGAGGAAGG + Intergenic
1178691697 21:34755265-34755287 AAAAAGAGGAGAAAACAGGAGGG + Intergenic
1178715983 21:34964671-34964693 TCAGAGAGGAGCAAAGAGTAAGG + Intronic
1178852702 21:36226593-36226615 TCAAAAAAGAGAAAAGAGGATGG - Intronic
1178921507 21:36741890-36741912 ACAGGGAAGAGAAAAGAGCAAGG - Intronic
1178931674 21:36824437-36824459 TCAGAGAAGGGAAAAGGGGAGGG + Intronic
1179084849 21:38207579-38207601 GAGGAGAGGAGAAAAGAGGAGGG - Intronic
1179202405 21:39236867-39236889 AGAGAGAGGAGAAAAAGGGAAGG + Intronic
1179349591 21:40595382-40595404 AAAAAGAAAAGAAAAGAGGAAGG + Intronic
1179391509 21:40996472-40996494 TCAGAGATGACAAGAGATGAAGG + Intergenic
1179453794 21:41484230-41484252 ACAGAAAAGAGAAAAGAAAATGG - Intronic
1179529182 21:42006843-42006865 ACAGAGACATGAACAGAGGAAGG + Intronic
1179815210 21:43901337-43901359 AAAGAGAAGAGAAAAGAGAAGGG + Intronic
1180237714 21:46474077-46474099 ACAGAGCTGAGCCAATAGGATGG + Intronic
1180689409 22:17698928-17698950 AAAGAGAGGAAAAAAGAGGGAGG - Intronic
1181120106 22:20661593-20661615 AGAGAGAGGAGAGAAGAGAAAGG - Intergenic
1181963790 22:26642539-26642561 AGAGAGAAGAGAAAAATGGAGGG + Intergenic
1181997422 22:26893713-26893735 ACAGAGAAGAGGAGAGGGGAAGG + Intergenic
1182013516 22:27020338-27020360 ACAGAGAAGAGAGGATAGGAGGG + Intergenic
1182062372 22:27407425-27407447 AGAGAGAGAAGCAAAGAGGAAGG + Intergenic
1182073098 22:27477111-27477133 ACAGAGATGAGCAAAGACAACGG + Intergenic
1182320513 22:29475925-29475947 AGGGAGAGGAGAAAAAAGGAGGG + Intergenic
1182362567 22:29755481-29755503 GCAGAGAGGAGAAAAGAGGCTGG + Intronic
1182400936 22:30077253-30077275 ACACAGGTGAAAATAGAGGAGGG - Intergenic
1182410490 22:30181025-30181047 AAAGAGAAGAGAAGAGAGGGAGG - Intergenic
1183029080 22:35088643-35088665 ACAGACTTGAGAGAAGATGAAGG + Intergenic
1183129425 22:35819801-35819823 ACAGAGAAAAAATAAGAGGAGGG + Intronic
1183942373 22:41302639-41302661 ACAGAGTTGAGGAGAAAGGAGGG - Intronic
1184075136 22:42172163-42172185 ACATGTATGAGAACAGAGGAGGG - Intronic
1184788241 22:46682264-46682286 AGAGAGTTGAGCAGAGAGGATGG - Intergenic
1184855475 22:47144197-47144219 ACAGCGATGAGAAGTGAGCACGG - Intronic
1185194147 22:49458021-49458043 ACAGAGATGGGCAGAGAGGCTGG + Intronic
1185378934 22:50497801-50497823 ACAGAGACCAGAAATGAGGCTGG - Intergenic
1185401705 22:50622128-50622150 AGAGAGAGGAGAACAAAGGAAGG + Intergenic
949550462 3:5108481-5108503 ACTGAAATGAGATAAGAGGAAGG - Intergenic
949654659 3:6203832-6203854 ACAGAGAGGGGAAAAAAGGTAGG + Intergenic
949727876 3:7071482-7071504 ACAGTGAGGAGAAAACATGAAGG - Intronic
949794432 3:7832318-7832340 ATAGAGATGTGGAAAAAGGATGG + Intergenic
949877643 3:8636736-8636758 CCTGTGAAGAGAAAAGAGGAGGG - Intronic
949934938 3:9109325-9109347 AGAGAGATGAGATGAGAGGAAGG + Intronic
950048032 3:9962677-9962699 GCAAAGAAGAGAAAACAGGACGG + Exonic
950325797 3:12108709-12108731 ACAGATTTTAGAAAAGAAGATGG - Intronic
950934630 3:16825927-16825949 AAAAAGCTGAGGAAAGAGGATGG + Intronic
951048708 3:18070083-18070105 TCAGAGATTAGCCAAGAGGAGGG - Intronic
951416301 3:22426253-22426275 ACTCAAAGGAGAAAAGAGGAAGG + Intergenic
951554818 3:23910658-23910680 TAAGAGGTAAGAAAAGAGGAGGG - Intronic
951604623 3:24419367-24419389 ATAGGAATGAGAATAGAGGAGGG - Intronic
951787757 3:26441875-26441897 ACAGAGATCAGGTAAGATGAGGG - Intergenic
951820226 3:26800397-26800419 AAAGACATGAAAAAAAAGGAGGG + Intergenic
951911652 3:27756214-27756236 ACGGAGATGAAAGAGGAGGAAGG + Intergenic
951927764 3:27927313-27927335 ACAGATTGGAGAAAGGAGGATGG - Intergenic
952216603 3:31284340-31284362 ACATGGAAGAGACAAGAGGAGGG + Intergenic
952218680 3:31302805-31302827 ACAGAGAAGAGGAAAGGGCAGGG - Intergenic
952259285 3:31724137-31724159 ACGGAAAAGAGAAAAGGGGAAGG + Intronic
952786191 3:37157553-37157575 AGAGAGAGGGGAAAAGAGGAAGG + Intronic
953315704 3:41924799-41924821 CCAGGGATGAGGGAAGAGGATGG - Intronic
953483755 3:43275099-43275121 ATAGAAAGGAGAAAAGAGGAGGG - Intergenic
953943953 3:47129148-47129170 ACAGAAATGACAAGACAGGAGGG + Intronic
954436770 3:50500430-50500452 GCAGAGAGGACAAAAGAGGCGGG + Intronic
954547306 3:51448202-51448224 AGAGAGATGAGAAAGGACAAAGG - Intronic
954793860 3:53151575-53151597 ATAGAGAGTAGACAAGAGGAGGG - Intergenic
955002173 3:54937716-54937738 ACAGAGAGGGGAAGAGACGAGGG + Intronic
955187182 3:56725746-56725768 GCAGCAGTGAGAAAAGAGGACGG + Intergenic
955718530 3:61857053-61857075 ACAGAAATAGGAAAATAGGATGG - Intronic
955732666 3:62003656-62003678 ACAAAGGTGAGAAACAAGGATGG - Intronic
955757064 3:62235852-62235874 ACAGATATGAGGAGAGAGAAAGG - Intronic
956761967 3:72451642-72451664 CCAGAGAGGAGAAATGAGGCTGG + Intergenic
956765599 3:72481943-72481965 ACAGAGATGGGGAGAGAGAATGG - Intergenic
956822818 3:72969124-72969146 AAAGAGAGGAGAAAATAGGGTGG + Intronic
957365811 3:79222132-79222154 AAAGAGATAAGAAGAGAAGATGG - Intronic
957389648 3:79547642-79547664 GCAGACATGAGCAGAGAGGATGG + Intronic
957544938 3:81624981-81625003 ACAGGGAAGACAAAAGAGTAGGG + Intronic
957609139 3:82444769-82444791 ACAGAGATAAGAAAAAATCAAGG - Intergenic
957683413 3:83469638-83469660 AAGGAGAGGAGAGAAGAGGAGGG + Intergenic
958022824 3:88016907-88016929 ACAGTAATGAGAAAAGAAGAAGG - Intergenic
958190741 3:90180878-90180900 AGAGAAAGGAGATAAGAGGAAGG + Intergenic
958412929 3:93840056-93840078 AGAGAAAGGAGATAAGAGGAAGG + Intergenic
958477005 3:94597305-94597327 TCAGAGGAGAGAAATGAGGAAGG - Intergenic
958528909 3:95298814-95298836 CCAGAGATGAGAATTTAGGAAGG + Intergenic
958541435 3:95480013-95480035 TAAAAGATGAGAAAAGAGAAAGG + Intergenic
959017851 3:101156044-101156066 ACAGAGATGGGAGAACAGGCTGG - Intergenic
959369061 3:105500275-105500297 AAGGAGATGAGAAAAGAGGAAGG - Intronic
959596041 3:108129388-108129410 ACAGGGTTGAGAGAAGAGAAGGG + Intergenic
959725852 3:109540560-109540582 ACAAAGATCAGAAGAGACGAAGG + Intergenic
960150009 3:114239728-114239750 AGAGAGTTCAGGAAAGAGGATGG + Intergenic
960170466 3:114454782-114454804 ACAGACAGGAGAGAGGAGGAGGG - Intronic
960270323 3:115666838-115666860 ACACAGATGAGGAACCAGGAAGG - Intronic
960284295 3:115809918-115809940 CCACAGATGAAAAAAGATGAAGG + Exonic
960443898 3:117723606-117723628 ACAGAGGAGAGAAAAGATCAAGG + Intergenic
960538757 3:118842376-118842398 ACAGAAAAAAGAAAAGGGGAGGG + Intergenic
961082283 3:124036585-124036607 ACAGAGATGGGAAATCAGAAGGG - Intergenic
961115933 3:124329987-124330009 ACAGAGGTGAGAATGGAGCAGGG + Exonic
961314778 3:126026955-126026977 ACAGAGATGGGAACAGAGCCTGG - Intronic
961572203 3:127807611-127807633 TCAGTGATGAGAAGAGAGAAGGG + Intronic
961707462 3:128798861-128798883 AAAGAGATGAAAATACAGGAGGG - Intronic
961932852 3:130552457-130552479 ACAGAAATGAGAAAAAAAGGAGG - Intergenic
962128105 3:132643811-132643833 GCAGAGTTGAGAAAACAGAAGGG + Intronic
962216049 3:133522801-133522823 AAAGAAATGAGAAAGGAGGCTGG + Intergenic
962334793 3:134517831-134517853 GCATATATTAGAAAAGAGGAAGG + Intronic
962344053 3:134606902-134606924 ACTGAGATGAGCAGAAAGGAAGG - Intronic
962385986 3:134933173-134933195 AGAGAGAGGAGAAAAAAGGATGG - Intronic
962786559 3:138773705-138773727 ATTTAGATTAGAAAAGAGGAAGG - Intronic
962891943 3:139679550-139679572 ACAGAGAGCAGAGAAGAGGCTGG + Intergenic
963179204 3:142336418-142336440 AAAGAGAAGAGGAAAAAGGAAGG + Intronic
963380849 3:144528450-144528472 AGAGAGAGAAGAAAAGAAGAAGG - Intergenic
963489179 3:145977645-145977667 ACTGAGAAGAGAACAGAGAATGG - Intergenic
963563940 3:146903815-146903837 AGAAAAATGAAAAAAGAGGAAGG + Intergenic
963786183 3:149536653-149536675 ACAGGGACGAGAAAAGAGGGAGG - Intronic
963938886 3:151081482-151081504 AAAGAAAAGAGAAAAGAGAAGGG - Intergenic
965246223 3:166273425-166273447 ACGAAAATGAGAAAACAGGAAGG - Intergenic
965309401 3:167110884-167110906 TCAGTGATGAAAAAAGAGAAAGG + Intergenic
965503171 3:169480493-169480515 AAAGAGATGAGAAAAAAAGTGGG - Intronic
965550953 3:169964606-169964628 AAATAGAAGAGACAAGAGGAAGG + Intergenic
965594869 3:170400591-170400613 AGAGAGAAAAGAAAAAAGGAAGG - Intergenic
965782166 3:172297432-172297454 ACAGAAAGAGGAAAAGAGGAAGG - Intronic
965846117 3:172963963-172963985 ATAGTGATGAAAAAAGAAGAAGG - Intronic
965924673 3:173963180-173963202 GCTGAGGTGAGAAAATAGGATGG + Intronic
966027594 3:175304149-175304171 CCAGACAAGAGAAAAGAGAAAGG + Intronic
966663644 3:182445800-182445822 ACATAGATAAGAGAAGAGGCAGG + Intergenic
966748147 3:183297663-183297685 ACAGAGAGAAAGAAAGAGGAAGG - Intronic
967134690 3:186503520-186503542 TCACAGATGAGACAAGAGGTTGG - Intergenic
967318282 3:188170998-188171020 ACAGATATGAAAAACAAGGAAGG - Intronic
967344046 3:188433668-188433690 AGAAAGAGGAGAAAATAGGAAGG + Intronic
967355146 3:188560912-188560934 TTAGAGATGAGGAAACAGGATGG + Intronic
967433051 3:189410833-189410855 GAAGAGAAGAGAAAAGAGGGAGG - Intergenic
967530458 3:190543664-190543686 GAAGAGATGAGTAAAGGGGAAGG + Intronic
967723506 3:192840004-192840026 GCAGAGATAAGAAAAGAGATTGG + Intronic
967881012 3:194301676-194301698 ACAGAGAGCAAAAAGGAGGAAGG + Intergenic
967997556 3:195178333-195178355 ACAGGGAAGAGAAAGGAGAAAGG - Intronic
968197555 3:196721247-196721269 ACAGAGAGGAAAAAAGACCAGGG - Intronic
968437463 4:601420-601442 ATAGAGCTGAGAAAAGAGACTGG - Intergenic
969132829 4:5004278-5004300 GGAGAGGGGAGAAAAGAGGAAGG + Intergenic
969322404 4:6420560-6420582 TCAGAGATGAGCATAGAGAAAGG - Intronic
969495274 4:7522906-7522928 ACAGGGAGGAGAGAAGAGGGAGG - Intronic
969525291 4:7701168-7701190 ACAGGAAGGAGAAAGGAGGAAGG + Intronic
969551257 4:7869175-7869197 AAAGAGAAAAGAAAAGAGGAAGG + Intronic
969684589 4:8664081-8664103 GCAGGGATGAGAACAGAGGTGGG + Intergenic
969943091 4:10754412-10754434 ACAAAGAGGAGTAAAGAGAATGG - Intergenic
970197736 4:13569206-13569228 ACAGAGAAGAGGAATGAAGAGGG + Exonic
970213145 4:13731662-13731684 GCAGAGATAAGAGAAGAGGCAGG + Intergenic
970224560 4:13844131-13844153 AGAGAGATGGGAATGGAGGAAGG - Intergenic
970652892 4:18197960-18197982 ACAGAACTGGGAAAAGAGAATGG - Intergenic
970728508 4:19075489-19075511 AGAGAGATGGGAAGAGAGCAGGG + Intergenic
971051562 4:22868183-22868205 CCAGACAGCAGAAAAGAGGAGGG + Intergenic
971124567 4:23739283-23739305 ACAGAGAAGAATAAAAAGGAAGG + Intergenic
971319594 4:25594817-25594839 ATAGAGAAGTGAAAAGACGAAGG + Intergenic
971341331 4:25772031-25772053 ACAAAAATGAAAAAAGGGGAGGG + Intronic
971612442 4:28743165-28743187 ACAGGGAAGAGAGAATAGGATGG - Intergenic
971749535 4:30629690-30629712 ACAGAGTTTAGAAAAGATGAGGG - Intergenic
972555133 4:40173857-40173879 AAAGAAATGAGAAAAGAAAAGGG - Intergenic
972795650 4:42416084-42416106 ACAGATATGAGAAATGAGAAAGG + Intronic
972868112 4:43259506-43259528 AAAGAGGAGAGAAATGAGGATGG - Intergenic
972897476 4:43641317-43641339 GAAGAGAAGAAAAAAGAGGAGGG - Intergenic
973147048 4:46840182-46840204 CCAGGAATGAGAAAGGAGGAAGG + Intronic
973713224 4:53649967-53649989 ACAGAGAAGAAAAAGGAGCAGGG + Intronic
974899497 4:67980107-67980129 ACAAAGATCAGAAAAGACAAAGG - Intergenic
975328574 4:73087948-73087970 AAAGAGAGGAAAAAAAAGGAGGG + Intronic
975454294 4:74572058-74572080 AGAGAGATGACAAAAGAAGAAGG + Intergenic
975481750 4:74888778-74888800 ACAGAGACTTGAAAAGATGAGGG + Intergenic
975523018 4:75320423-75320445 ACTGAGATGGGAAAGAAGGATGG - Intergenic
975899628 4:79136854-79136876 ACAGAAAACAGAAAAGAGAAGGG - Intergenic
975959201 4:79880227-79880249 GCAGAGATGAAAAAAGAGAGAGG + Intergenic
976090656 4:81453833-81453855 ATAGAGATGAGAAAGGAGCAAGG + Intronic
976221741 4:82761829-82761851 AGAGAGATTAGAAACGAGGCTGG - Intronic
976261400 4:83148467-83148489 CCAGAAATGATAAGAGAGGATGG - Intergenic
976519373 4:86008381-86008403 ACAGACCTCAGAAAACAGGAGGG - Intergenic
976604072 4:86966278-86966300 TCAGAAATCAGAGAAGAGGAAGG - Intronic
976615273 4:87069631-87069653 AAGGAGAAGAGAAAAAAGGAAGG - Intronic
976900064 4:90162380-90162402 ACAGAAATGATACAGGAGGAAGG - Intronic
977325639 4:95572034-95572056 AAAGAGGAGAGAAAACAGGAAGG - Intergenic
977327689 4:95597065-95597087 ACAGAGAAAAGAAAGAAGGAAGG - Intergenic
977597788 4:98902446-98902468 AGAGATATGAGAATAGAGAATGG - Intronic
977836188 4:101648376-101648398 CCAGAAGTGAGAAAAGAGGGTGG + Intronic
978192217 4:105927319-105927341 ACACAGCTGTGAAAAGAAGATGG - Exonic
978444256 4:108765428-108765450 AGAGTGAAGAGAAAAGAAGAGGG - Intergenic
978541138 4:109817196-109817218 ACAGTGAGGAAAAAAAAGGAAGG + Intronic
978769022 4:112434223-112434245 ATTGAGAGAAGAAAAGAGGAAGG - Intronic
978856040 4:113395969-113395991 ACAAAGATGAAAACAGAGAAAGG - Intergenic
979348546 4:119619004-119619026 ATTGAAAAGAGAAAAGAGGATGG - Intronic
979618239 4:122768941-122768963 CAAGAGATGAGTAAGGAGGACGG + Intergenic
979859025 4:125670445-125670467 AAAGTTTTGAGAAAAGAGGATGG + Intergenic
980258820 4:130420877-130420899 AGAAGGATGAGAAAAGAGGTTGG - Intergenic
980493451 4:133560467-133560489 ACAAGAATGAGAAAAGAGAAGGG - Intergenic
980607686 4:135113487-135113509 ACAGAGGTGGGAGAACAGGATGG - Intergenic
981367364 4:143918679-143918701 AAAGAGAAGAGAATAGTGGAAGG + Intergenic
981429452 4:144643512-144643534 ACAGAGTGGTGAAAAGAAGAAGG - Intergenic
981498445 4:145419712-145419734 GCAGATATGAACAAAGAGGAGGG + Intergenic
981637967 4:146902159-146902181 TCAGAGGAGGGAAAAGAGGAAGG - Intronic
981710546 4:147705263-147705285 AGAAAAATGAGAAATGAGGATGG - Intergenic
981850249 4:149220784-149220806 ACAGAGATTAAAAAAGACAAGGG + Intergenic
982339012 4:154274010-154274032 TCAGAGATGAGTACAGAGCAGGG + Intronic
982710249 4:158750748-158750770 AAAGAGAAAAGAAAAAAGGAAGG + Intergenic
982841459 4:160193064-160193086 ACAAAGATGAAAAAAGATAAAGG - Intergenic
983197776 4:164826574-164826596 GCAGAGAAGAGAAGAGAAGAAGG + Intergenic
983241397 4:165237269-165237291 ACAGAAAGGAGGAAAAAGGAAGG - Intronic
984030365 4:174596744-174596766 ACAGGGATGAGAAGAGAGTTAGG - Intergenic
984046201 4:174802153-174802175 ACAAGGATGAGAAATGAGAAAGG - Intronic
984103103 4:175511015-175511037 ACAGAGATGACAGAAAAGCAGGG + Intergenic
984156193 4:176198545-176198567 ACAGAACTGAGAACAGAGAAGGG - Intergenic
984349434 4:178571301-178571323 ACAGAAATGACAAAGGAAGAAGG + Intergenic
984579031 4:181488387-181488409 ACAGAGATGAGAAATCAGGAGGG - Intergenic
984694446 4:182765617-182765639 ACGGAGGTGAGTAAGGAGGAAGG - Intronic
984759175 4:183348935-183348957 TCACAGATGAGATAAGAGGTTGG + Intergenic
985608948 5:875857-875879 ACAGAGATGAAAGATGAAGATGG + Intronic
985890660 5:2713039-2713061 AAAAAGATGAGCAAAGAGGAAGG - Intergenic
986507020 5:8462565-8462587 GCAGAGATATGAAAATAGGACGG + Intergenic
986873233 5:12075497-12075519 AAAGAGCAGAGAGAAGAGGAAGG + Intergenic
986981865 5:13457402-13457424 ATACAGAAGAGAAAAGATGAGGG + Intergenic
987042771 5:14078312-14078334 AAAGAGAAGAAAAAAGAGCAAGG - Intergenic
987057978 5:14213222-14213244 AGAGTGAAAAGAAAAGAGGAGGG - Intronic
987224218 5:15822705-15822727 ACAGTGATGAGAACAGTGCATGG - Intronic
987269955 5:16296975-16296997 ACAAAGATGAGAAAAAAACAAGG - Intergenic
987294957 5:16541714-16541736 AAAGAGAAGAGAAGAGAGGGAGG + Intronic
987511452 5:18845665-18845687 ACAAAGATGAGAAAAGAAGTGGG + Intergenic
987575789 5:19726193-19726215 AAAGAGATGAAAAAGGAAGAAGG + Intronic
987577530 5:19750564-19750586 AAAGAGATTGGAAAAGAGCATGG + Intronic
987743918 5:21946277-21946299 AAAGAAATGATAAAAGAAGAAGG + Intronic
987884619 5:23797983-23798005 AGAAAAATGAGGAAAGAGGAAGG + Intergenic
988023926 5:25658735-25658757 AGAGAGGTGAGAAAAGAATAAGG - Intergenic
988106075 5:26750156-26750178 AAGGAGAAGAAAAAAGAGGAGGG - Intergenic
988320040 5:29683222-29683244 TCAGAGCTGAGAGAAGGGGATGG + Intergenic
988334493 5:29888408-29888430 ACAGAAAAGAGAGAAAAGGAAGG + Intergenic
989033965 5:37150308-37150330 ACATGGAGGAGAAAAGAAGAGGG - Intronic
989192804 5:38687875-38687897 AAAGACAAAAGAAAAGAGGAAGG - Intergenic
989195265 5:38710029-38710051 AAGGAAATGAGAAAAGAGAAAGG + Intergenic
989238978 5:39181789-39181811 ATGGAGATGAGAAAAGAGGTTGG - Intronic
989289939 5:39751996-39752018 ACATAGATTAGAAAATTGGAGGG - Intergenic
989535702 5:42561488-42561510 AAACACATGAGAAAAGATGAAGG - Intronic
989673651 5:43948857-43948879 ACATACATGTGAATAGAGGAGGG + Intergenic
989954296 5:50338587-50338609 AAAGAGAAAAGGAAAGAGGATGG + Intergenic
990405994 5:55491408-55491430 ATAAAGCTGAGAAAACAGGAAGG + Intronic
990746045 5:58960237-58960259 ACAGAGAGGTCAAAAGAGGCTGG - Intergenic
990791572 5:59486287-59486309 ACAGAGAAAAGACAACAGGATGG - Intronic
990871644 5:60438270-60438292 ACACAGATGAGAAAGAAGCAGGG + Intronic
991200219 5:63983285-63983307 ATAGAAATGAGAAAACATGATGG + Intergenic
991229025 5:64308987-64309009 GCAAGGATGAGAAAAGAAGAGGG - Intronic
991538510 5:67700397-67700419 AAAGAGATGAAAAAAAAGGGAGG - Intergenic
991544636 5:67767810-67767832 ATAGAGATGATAAATGGGGATGG + Intergenic
991764118 5:69956416-69956438 AAAGAAATGATAAAAGAAGAAGG + Intergenic
991783207 5:70161731-70161753 AAAGAAATGATAAAAGAAGAAGG - Intergenic
991843350 5:70831488-70831510 AAAGAAATGATAAAAGAAGAAGG + Intergenic
991985722 5:72284481-72284503 AGAGAGATGGAAAAAGAGAAGGG + Intronic
992068985 5:73132358-73132380 AAGAAGAGGAGAAAAGAGGAGGG - Intergenic
992970351 5:82050315-82050337 CCAAAGATGAGAAATCAGGAAGG - Intronic
993121231 5:83776704-83776726 ACAGAGAGAAAAAGAGAGGAAGG - Intergenic
993291212 5:86073822-86073844 GTAGAGATTAGAAGAGAGGAGGG + Intergenic
993399868 5:87435609-87435631 ACCAAGATCAGAAAAGAGAATGG - Intergenic
993429555 5:87814663-87814685 ACACAGATGAGAAAAAACCAGGG + Intergenic
993475423 5:88358341-88358363 ACAGAGATGAGTTGAGGGGAAGG - Intergenic
993771361 5:91931880-91931902 AGAAAGATGAGAAAAGTGAAAGG - Intergenic
993913972 5:93718828-93718850 AGAGAGATGAGAAAAAAGCTAGG - Intronic
994278777 5:97874374-97874396 ACAGAGAGAAGAAAAAAGAAGGG + Intergenic
994329187 5:98486352-98486374 AGGGAGATAAGAAAGGAGGATGG - Intergenic
994466427 5:100138882-100138904 AGAGAGATGAGAAAAGAACTTGG + Intergenic
994939550 5:106304178-106304200 ACAGAGCTGAGCAAAGGGTAGGG + Intergenic
995031489 5:107486993-107487015 ACAGAGATGTGAACAGATGTAGG - Intronic
995105629 5:108374704-108374726 AGGGAGGTGAGGAAAGAGGAGGG + Intronic
995141794 5:108743471-108743493 ACAGACATGAGAACAGAGAAAGG - Intergenic
995649891 5:114358680-114358702 ACAGAGAGAAGGAGAGAGGAAGG - Intergenic
995843661 5:116469348-116469370 ACAGATAAGAGAACAGGGGAAGG + Intronic
995936078 5:117516383-117516405 AGAAAGATGTAAAAAGAGGAAGG + Intergenic
996354677 5:122582387-122582409 ACTGAAATAAGAAATGAGGAAGG - Intergenic
996391851 5:122970858-122970880 ACAGAGATGAGAAAAGAGGAGGG - Intronic
997055815 5:130442832-130442854 ACAGGAATAAGAAAGGAGGAAGG - Intergenic
997691086 5:135827986-135828008 ACACACATGGGAAGAGAGGAGGG - Intergenic
997779917 5:136646368-136646390 ACTGAGAGGAGAAAAAGGGAGGG + Intergenic
998265875 5:140667402-140667424 GCAGAGATAAGGAATGAGGAGGG - Intronic
998388464 5:141772108-141772130 ACAGAAATAGGAAAAGAGAAAGG - Intergenic
998495823 5:142588470-142588492 AGAGAGAAGAGAGAAGAGGGAGG - Intergenic
999276177 5:150331577-150331599 CCAGAGATGAGAGCAGAGGTAGG - Intronic
999385629 5:151152075-151152097 ACAGAGATGTGGATAGGGGAAGG + Intronic
999586043 5:153090681-153090703 TCAAAGGTGAGAGAAGAGGAGGG + Intergenic
999618173 5:153447544-153447566 ACAGAGATGATAAAGAAGAATGG + Intergenic
999685562 5:154099824-154099846 GCATAGATGAGAACGGAGGAAGG + Intronic
999739005 5:154535029-154535051 AAAATGATGTGAAAAGAGGAGGG + Intergenic
999860494 5:155640510-155640532 AAGGGGAAGAGAAAAGAGGAAGG - Intergenic
999945479 5:156590868-156590890 AGAGAGACGAGAAGAGAGAAGGG - Intronic
1000239575 5:159397066-159397088 AGAGAGAAAAGAAAAGAGAAGGG - Intergenic
1000265422 5:159631760-159631782 ACAGAGAGGAGAAGAGAGAAAGG + Intergenic
1000373997 5:160562475-160562497 ATGGAGATGAAAAGAGAGGAAGG - Intergenic
1000694506 5:164363332-164363354 CCAGAGATGTCAAAAGATGAAGG + Intergenic
1000720127 5:164695301-164695323 ACAAAGATCAAAAAAGATGAAGG + Intergenic
1000912442 5:167038347-167038369 ACAGAGCTGGGAACAGAGGAAGG + Intergenic
1001053215 5:168428978-168429000 ACAGATAGGAGAAATGAGGTTGG + Intronic
1001685303 5:173590238-173590260 AAGGAAAAGAGAAAAGAGGAAGG + Intergenic
1001961566 5:175883075-175883097 CCCCAGATGAGAAAATAGGAAGG + Exonic
1001976388 5:176003214-176003236 ACAGAAACCAGAACAGAGGATGG + Intronic
1002241037 5:177840554-177840576 ACAGAAACCAGAACAGAGGATGG - Intergenic
1002606418 5:180385418-180385440 ACAGAGTTGGGAGAAGGGGAAGG + Intergenic
1002940537 6:1711665-1711687 ACAGAGATAAGCAAGGTGGATGG - Intronic
1003015992 6:2468013-2468035 TCAGAGTTGAGAAGAGGGGAGGG + Intergenic
1003394716 6:5743208-5743230 TTAGAGATGAGAAAAGTGAAAGG - Intronic
1003443491 6:6164725-6164747 AAAGAGGAAAGAAAAGAGGAAGG - Intronic
1003517252 6:6827405-6827427 ACAGAGGAGAGAGAAGAGAAAGG + Intergenic
1003679915 6:8242846-8242868 ACATATATGAGAGAGGAGGACGG - Intergenic
1003737770 6:8896814-8896836 AGAGAGAGGAAAAAAGAGGAAGG - Intergenic
1003800985 6:9667033-9667055 TCAGAGATAAGAAAAGATCAAGG + Intronic
1004042957 6:11999714-11999736 TTAGAGTTGAGAAAATAGGAAGG + Intergenic
1004065445 6:12239517-12239539 GTAGGGATGAGAAAAGAGGCAGG - Intergenic
1004115258 6:12760539-12760561 ACAGGGAGAAGAAAAGAGGGAGG + Intronic
1004151097 6:13120702-13120724 GCAGGGAAGAGAAGAGAGGAAGG - Intronic
1004691632 6:17997234-17997256 ACAGAGCTGAAAAAAAAAGAAGG - Intergenic
1005146015 6:22690935-22690957 ACAGAAATGAGAATGGAGAAAGG + Intergenic
1005394125 6:25363920-25363942 AGAGAGAAGAGAAGAGAGAAAGG - Intronic
1005830595 6:29668024-29668046 AAAGAAAAGAGAAGAGAGGAAGG - Intronic
1005956111 6:30664638-30664660 ACAGAAATGTGAAAAGGGTATGG + Intronic
1006340157 6:33442518-33442540 ACAGACAGGAGAGGAGAGGAGGG - Intronic
1006420623 6:33931599-33931621 AAACAGATGAGAAAAGAGAGGGG - Intergenic
1006678041 6:35777655-35777677 ACAGAGGTGAAAAAACAGGTGGG - Intronic
1006932906 6:37698294-37698316 AAAGAGAGGAGAGGAGAGGAAGG - Intronic
1007105941 6:39282951-39282973 ACAGAGCTGAGAGACGAGGAGGG - Intergenic
1007364007 6:41377396-41377418 AGAAAGAAGAGAAAAGAAGAAGG + Intergenic
1007364107 6:41378422-41378444 TCAGAGTTCAGACAAGAGGATGG + Intergenic
1007566968 6:42858947-42858969 GAAGGGATTAGAAAAGAGGAGGG - Intronic
1007679076 6:43621953-43621975 CCAGAGGTCAGAAAAGAGGGAGG - Intronic
1007950050 6:45863817-45863839 AGAGAGAAGAGAAAAGAGAGAGG - Intergenic
1008154231 6:47994203-47994225 GCAAAGATGAGAAAAGAGAAAGG + Intronic
1008228674 6:48956013-48956035 ACAGAGAAGACCAAACAGGAAGG - Intergenic
1008733585 6:54514171-54514193 AGAAAGAAAAGAAAAGAGGAAGG - Intergenic
1008764916 6:54900265-54900287 GGAGTGATGAGAAAAGAGGGAGG + Intronic
1008800473 6:55362894-55362916 AGAGGGAAGAGAAAACAGGAAGG + Intronic
1008819019 6:55608921-55608943 ACGGAGAGGAGAGAAGAGCAAGG + Intergenic
1008838690 6:55870036-55870058 ACTGGGATGAGAAGGGAGGAGGG + Intronic
1009274449 6:61657317-61657339 ACACAGATGGGAAAATAGTACGG - Intergenic
1009395112 6:63190626-63190648 ACAGAGATGGAACAAGATGAAGG - Intergenic
1009655167 6:66534955-66534977 ACAGCGAGGAGACAAGAAGAAGG + Intergenic
1010031948 6:71280415-71280437 ACAAAAAGGAGAAAAGAGAAAGG - Intergenic
1010179794 6:73073035-73073057 TCAGAGAAGAGAAAAGTGCAGGG - Intronic
1010413471 6:75587266-75587288 AAAGAGAAGAGAAAAGAAAAAGG - Intergenic
1010476278 6:76292730-76292752 AGAGAAGTGAGAATAGAGGAGGG - Intergenic
1010496713 6:76541690-76541712 ACAAAGATGAAAAAAGAAGATGG + Intergenic
1010943379 6:81946570-81946592 AGAGAGAGGAGGACAGAGGAAGG + Intergenic
1011324564 6:86135657-86135679 AGAAAGAAAAGAAAAGAGGAAGG - Intergenic
1011546097 6:88483067-88483089 AGGGGGATGAGAAGAGAGGAGGG + Intergenic
1011770422 6:90669747-90669769 ACAGAGAAGAGAAAGAATGAAGG - Intergenic
1011960863 6:93088358-93088380 ACAGAGAAGAGATAAGAATAAGG + Intergenic
1012560481 6:100574355-100574377 ACAGAAATGGGAAAAGAGACAGG + Intronic
1012872769 6:104691924-104691946 GAAGAGAAGAGAAGAGAGGAAGG + Intergenic
1012884670 6:104831965-104831987 GAAGAGAAGAGAAGAGAGGAAGG + Intronic
1013279025 6:108617262-108617284 CCAGAAATGAGACAAGATGATGG - Intronic
1013646904 6:112152825-112152847 ATTGAAATTAGAAAAGAGGAAGG - Intronic
1014182161 6:118396996-118397018 ACATCTGTGAGAAAAGAGGAAGG - Intergenic
1014245655 6:119065527-119065549 ACTGAGATAAGAATAAAGGAAGG - Intronic
1014333939 6:120107457-120107479 ACAGAGAGGAGAGAAATGGAGGG + Intergenic
1014398541 6:120957407-120957429 ACAGATATGACAAAAGATGAAGG + Intergenic
1014507475 6:122277663-122277685 ACAGAGATGAAAAAGCAGGCAGG + Intergenic
1014724003 6:124954260-124954282 AGAGAGAGGAGAAGGGAGGAAGG - Intergenic
1014814229 6:125917747-125917769 AGAGGAAGGAGAAAAGAGGAGGG + Intronic
1014849187 6:126320108-126320130 AGAGAGAGGAGAAAGGCGGACGG - Intergenic
1015048834 6:128814026-128814048 ACACAGAGGAGAATAGAGAAGGG - Intergenic
1015057961 6:128927178-128927200 AGAGGAATGAGAAGAGAGGAGGG - Intronic
1015395520 6:132729918-132729940 ACAAATATGTGAAAAAAGGAAGG - Intronic
1015780101 6:136856496-136856518 ACAGAAACCAGAAAAGAGGTAGG - Intronic
1015809855 6:137151123-137151145 AAAAAGATGAATAAAGAGGAGGG + Intronic
1015906438 6:138122137-138122159 GCAGAGATAAGCCAAGAGGAGGG + Intergenic
1015906637 6:138123658-138123680 ACAGAGTTGAGCAGAGAAGATGG - Intergenic
1015984078 6:138868587-138868609 ACCCAGATGTGAAAAGATGACGG + Intronic
1016001425 6:139045275-139045297 ACAGAGGTGGGAAAATTGGATGG + Intergenic
1016077577 6:139815714-139815736 ACAGTCATGAAAGAAGAGGAGGG - Intergenic
1016086844 6:139925063-139925085 ACACAGATAAGAAAAAAGGTAGG - Intergenic
1016287530 6:142489817-142489839 ACAGAGAAAAGAAGAAAGGAAGG - Intergenic
1016604535 6:145905224-145905246 AGAAAGAAGAGAAAAAAGGAAGG + Intronic
1016640152 6:146338877-146338899 ACAGAGTAGAGAAGAGAAGAAGG - Intronic
1016689651 6:146922294-146922316 AATGAGATGAGAGATGAGGAGGG + Intergenic
1016701157 6:147055825-147055847 ACAGAGAAGAGAAAGGAGGTAGG - Intergenic
1016764116 6:147773387-147773409 GTACAGAGGAGAAAAGAGGATGG + Intergenic
1016769622 6:147834930-147834952 ACAGAAATGAAAAATGAGGCTGG + Intergenic
1016840316 6:148518701-148518723 ACAGATGTGAGAAAAGAAGTAGG - Intronic
1017421390 6:154276288-154276310 AAAAAGAAAAGAAAAGAGGAAGG + Intronic
1017428499 6:154346924-154346946 ACAGAGATTAAAAAATAGGAAGG - Intronic
1017447191 6:154517738-154517760 AAAGAGAAAAGAAAAGAAGAGGG + Intergenic
1017546107 6:155451922-155451944 AAAGACATCAGAAAAGAGGCCGG - Intronic
1017687318 6:156926607-156926629 ACAGAGGTGAAACAAGATGAAGG - Intronic
1017814311 6:158005734-158005756 GCAGAGCTGAGGAAAGGGGAGGG - Intronic
1017988975 6:159469919-159469941 AAAGAGATGAGGGAAGAGGAAGG + Intergenic
1018346558 6:162905031-162905053 ACAGAGATGAGAAGAGAGACAGG + Intronic
1019273955 7:166219-166241 ACAGAGAATAGGAAGGAGGAAGG - Intergenic
1019558511 7:1644537-1644559 ACAGAGATGGAAAGCGAGGATGG - Intergenic
1019897479 7:3994002-3994024 ATAGAGAGGAGAAAATAAGAAGG - Intronic
1020083177 7:5297213-5297235 ACAGAGAAGGGAACAGAGGTGGG - Intronic
1020677974 7:11202868-11202890 TCAGAGAAGAGAAAAGGGGTGGG - Intergenic
1020858228 7:13455257-13455279 AAAGAGATGAGAACAGATCATGG + Intergenic
1020979229 7:15046839-15046861 ACACTGATGAGAAAAGGGGAAGG + Intergenic
1021254312 7:18371670-18371692 AAAGGTATGAGAAAAGAGAATGG - Intronic
1021351569 7:19600630-19600652 ACGGAGAACAGAAAAGAGCAGGG - Intergenic
1021695239 7:23269909-23269931 ACAGAGAAGGGGAGAGAGGAAGG - Intronic
1021928506 7:25556130-25556152 ACAGCTATGAGAAAGAAGGAAGG - Intergenic
1021986280 7:26101248-26101270 ACAGACAGCAGAAAAGAGAACGG - Intergenic
1022115967 7:27260801-27260823 AGAGAGAAGAGAAAAAAGAAAGG + Intergenic
1022533708 7:31082932-31082954 ACACAGATTGGAAAAGTGGAAGG + Intronic
1022585954 7:31611941-31611963 AAAGAGAAGAGAAAAGAAAAAGG - Intronic
1022594203 7:31696506-31696528 ATAGAGGTGAGAAAGCAGGAGGG + Intronic
1022622113 7:31995241-31995263 ACAGTGAGAAGAGAAGAGGAAGG + Intronic
1023075475 7:36478019-36478041 ATAGAGAAGAGAAAGAAGGAAGG - Intergenic
1023427795 7:40057415-40057437 CCAGAGGTGAGAAAAGAGGAGGG + Intronic
1023462306 7:40412015-40412037 ACAGGGGTGGGAAAAGTGGATGG - Intronic
1023719287 7:43076652-43076674 ACAGAAAAAGGAAAAGAGGAGGG + Intergenic
1023895524 7:44429797-44429819 AATGACATGAGAAAAGAGGGTGG + Intronic
1023910079 7:44547691-44547713 AAAGAGAAAAGAAAGGAGGAAGG + Intergenic
1024084415 7:45881586-45881608 CCAGAGGTGAGAAATTAGGAGGG + Intergenic
1024686023 7:51746217-51746239 TAAGAGATGAGAACAGAGGAAGG - Intergenic
1025246746 7:57323303-57323325 CCAGTGAGGAGGAAAGAGGAGGG - Intergenic
1025886708 7:65601561-65601583 AAAAAGCAGAGAAAAGAGGAGGG - Intergenic
1025954040 7:66169096-66169118 ACAAAGATTAAAAAAGGGGAGGG - Intergenic
1026455676 7:70570627-70570649 ACAGAGAAGGGTAAAGGGGAAGG - Intronic
1026838348 7:73653124-73653146 ACAGAAAAGAAAAAAGAGAAAGG - Intergenic
1026997272 7:74626003-74626025 AAAAAGAAGAGAAAGGAGGAAGG - Intergenic
1027456542 7:78398949-78398971 ACAAAGATGAGAAAAAAGATTGG - Intronic
1027510960 7:79079130-79079152 AAACAGCTGAGAAATGAGGAGGG - Intronic
1027513316 7:79110285-79110307 ACAGAGTTGTGAGAAGAGGGTGG + Intronic
1027745868 7:82073158-82073180 ACATAGATGAGAGGACAGGATGG + Intronic
1028114724 7:86984073-86984095 ACAAAGATCAAAAGAGAGGAAGG + Intronic
1028302119 7:89213192-89213214 ACAGAGATGCAGAAAGATGATGG + Intronic
1028380626 7:90194937-90194959 ACAGAGATGCCAAAAGCTGAGGG - Intronic
1028580901 7:92408814-92408836 CCAGAAATGAGAGAAAAGGAAGG - Intergenic
1028941539 7:96527172-96527194 AGTGAAATGAGAAAGGAGGATGG + Intronic
1028975896 7:96913648-96913670 AAAGAGAGGAGAAGACAGGATGG - Intergenic
1029025545 7:97413343-97413365 TGAGAGATGGGAAGAGAGGAAGG + Intergenic
1029176066 7:98665264-98665286 GGTGAGATAAGAAAAGAGGATGG - Intergenic
1029204901 7:98863736-98863758 AGAGAGAAAAGAAAAGAGAAAGG - Intronic
1030230200 7:107200020-107200042 ACAGAGATGGGAAAAGGTCAAGG - Intronic
1031533487 7:122905598-122905620 AAAGAGAAGGGAAAAGAGAAAGG - Intergenic
1031538760 7:122967119-122967141 ATAGAGAGGAGAAAAGGAGAGGG - Intergenic
1031757872 7:125668658-125668680 ACAGAGATGAGACAAAATAAGGG + Intergenic
1031811192 7:126371253-126371275 AGAGAGATAGGAAGAGAGGAAGG + Intergenic
1031840627 7:126734858-126734880 GCAGTGGTGAGAAAAGAGAAAGG + Intronic
1032074363 7:128829591-128829613 ACTGAGATGATAAGAGGGGAAGG - Intergenic
1032285494 7:130535980-130536002 TCAGTGATATGAAAAGAGGAGGG + Intronic
1032457258 7:132082790-132082812 ACAAAGAAGAAAAAGGAGGAAGG + Intergenic
1032567346 7:132960266-132960288 GGAGAGAGGAGAAGAGAGGACGG + Intronic
1032846940 7:135759133-135759155 ACAGAAAAAAGAAAAGGGGATGG - Intergenic
1033105551 7:138518639-138518661 AAAGAGATGGAAAAAGAGGGAGG - Intronic
1033274077 7:139957907-139957929 ACAGTGGAGAGAACAGAGGAAGG + Intronic
1033738338 7:144247229-144247251 ACAGAGATGTGAAAAAAGTGGGG - Intergenic
1033744715 7:144303724-144303746 ACAGAGATGTGAAAAAAGTGGGG + Intergenic
1033912738 7:146285669-146285691 AGGGAGATGAGGGAAGAGGAGGG - Intronic
1033943076 7:146679678-146679700 ACAGAGAAAGGAAAGGAGGAAGG - Intronic
1034532418 7:151704657-151704679 AGAGAGATGAGGAAAGGGGAGGG + Intronic
1034851829 7:154500991-154501013 ACAGAGATGAGAAACTAGTTGGG + Intronic
1035142092 7:156772839-156772861 AAAGAGAAGAGAGGAGAGGAGGG + Intronic
1035153873 7:156896572-156896594 AGGGAGGTGGGAAAAGAGGAGGG + Intergenic
1035274280 7:157737989-157738011 AGATGGATGAGAAGAGAGGAGGG - Intronic
1035731650 8:1857712-1857734 ACAGAGAAGAAACAAGAGGCTGG - Intronic
1036188840 8:6650855-6650877 ACAGAGAAGAGACAGAAGGAAGG - Intergenic
1036537630 8:9665965-9665987 ACAGAGAGAAAAAAAGAGGAGGG - Intronic
1036637848 8:10564053-10564075 CCCGAGGTGGGAAAAGAGGAGGG - Intergenic
1036681367 8:10876872-10876894 ATAGAAATGAGAGAAGAGGCCGG - Intergenic
1036715188 8:11116178-11116200 ACATACATGGGAAAGGAGGACGG - Intronic
1036944055 8:13078198-13078220 AGAGAGAGGAGAGGAGAGGAGGG - Intergenic
1037646893 8:20800390-20800412 GGAGAGATGAGAAGAGACGAGGG + Intergenic
1037891367 8:22625434-22625456 CCAGAGAGGAGGAAAGACGAGGG + Intronic
1038285586 8:26203802-26203824 AGAGAGGGAAGAAAAGAGGAAGG + Intergenic
1038657181 8:29464021-29464043 ACAGAGATGGAAAAGGAGGTAGG - Intergenic
1038825186 8:30991600-30991622 GAAGAGAGGAGGAAAGAGGAGGG - Intergenic
1038889369 8:31701714-31701736 AGAGAGATGGGAAAAAGGGAAGG - Intronic
1039153616 8:34530741-34530763 ACAGAAAAGAGGAAATAGGAAGG + Intergenic
1039227960 8:35410480-35410502 ACTTAAATGAGAAAGGAGGAGGG - Intronic
1039234601 8:35488279-35488301 ACAGAGATGGGACAAAATGAAGG + Intronic
1039458521 8:37724604-37724626 ATAGTGCAGAGAAAAGAGGAAGG + Intergenic
1039623859 8:39027352-39027374 ACAGAGAAGAGGAGAGAGAATGG + Intronic
1040427872 8:47307513-47307535 AACGAAATGAGAAAAGAGGCTGG - Intronic
1040592885 8:48811418-48811440 AAAGAGAAGAGAAAAGAAGAAGG + Intergenic
1040674124 8:49728138-49728160 ACAGAAATGAAAAAAGCGGGGGG + Intergenic
1040729844 8:50430805-50430827 ACAGAGATGGTAAATCAGGATGG + Intronic
1040813102 8:51479187-51479209 AAAGAGATTAGAAAAGACTAAGG + Intronic
1041457887 8:58079921-58079943 ACAAAGATCAGCAGAGAGGAAGG + Intronic
1041669120 8:60475418-60475440 AAAGAGACAAGAAGAGAGGAAGG - Intergenic
1041978342 8:63825631-63825653 ATACAGATGAGCAAAGAGGTGGG - Intergenic
1042076365 8:64999623-64999645 ACAGAGATGAGACAAGAATGAGG - Intergenic
1042161619 8:65902846-65902868 ACAGAGATGGGTAAACAGAAGGG + Intergenic
1042555816 8:70033116-70033138 AGGGAGAGGAGAAAGGAGGAAGG + Intergenic
1042765369 8:72315463-72315485 AAAAAAATGAGAAAAGAGAAGGG - Intergenic
1042809658 8:72810218-72810240 ACAGAGGTGAGAAAACAGGTGGG + Intronic
1042926556 8:73973403-73973425 AAAGAGAAGAGAAAAGAAAAGGG - Intronic
1043041343 8:75265760-75265782 AGAGAGATAAGAAATGAAGATGG - Intergenic
1043238762 8:77903637-77903659 ACATAGAGGAAAAAAGGGGATGG - Intergenic
1043362486 8:79491617-79491639 ACAGAGAGGTGAAAATAGAAGGG + Intergenic
1043467889 8:80530871-80530893 ACAGAAATGAAAACAGAGGCTGG - Intergenic
1043477404 8:80618960-80618982 ACAAAAATGAGAAAAGGGGCTGG - Intergenic
1043574530 8:81642758-81642780 AAAGAGAAGAGAGAAGAAGAGGG + Intergenic
1043833817 8:85021968-85021990 GCAGATATGAGCAAAGAGGAGGG + Intergenic
1044253125 8:90027480-90027502 ACAAAGATCAGAAGAGAGAAAGG - Intronic
1044464461 8:92487442-92487464 TCAAAGATGAAAAATGAGGAGGG + Intergenic
1044787590 8:95810942-95810964 AGAGAGAAGAGAAAAGAGAGAGG + Intergenic
1044794157 8:95879372-95879394 ACAGAGATGGGAGAGGAGGCTGG + Intergenic
1044892665 8:96854115-96854137 ACAGAGAGGAGACAAGAAAACGG + Intronic
1045329901 8:101146657-101146679 ACTGAGATGGGAAGAGAGGTGGG + Intergenic
1045643664 8:104279632-104279654 ACAGGAATTAGAAAAGAGTAAGG + Intergenic
1045760982 8:105607371-105607393 AGAGATCTGAGAAAAGAAGAAGG + Intronic
1045819593 8:106320636-106320658 AAAGAGAAGAGAAAAGAGATGGG - Intronic
1045944290 8:107778061-107778083 ACTGAGATAAGCAAAGAGAAGGG + Intergenic
1046070799 8:109250925-109250947 TAAAAGATGAGAAAACAGGAAGG - Intronic
1046974026 8:120253358-120253380 AGGGAGCAGAGAAAAGAGGATGG - Intronic
1047457283 8:125027171-125027193 ACAGAGATCAGAAAACAAGCTGG - Intronic
1047807767 8:128377543-128377565 ACAGAAAAAGGAAAAGAGGAGGG - Intergenic
1048025078 8:130578574-130578596 ACAAAGAAGAGAAAATAGAACGG - Intergenic
1048137216 8:131758121-131758143 AAAGAGATGAGGAAGGAGCATGG - Intergenic
1048187642 8:132257099-132257121 ACAAAGAAGAGAAGAGAGAATGG + Intronic
1048573636 8:135674493-135674515 CCAGAGATGAGAAAAAAGCGAGG - Intergenic
1048689230 8:136940664-136940686 GCAGACATGGGATAAGAGGATGG - Intergenic
1048908875 8:139115260-139115282 ACAGTAATGAGAACAGGGGACGG + Intergenic
1049955845 9:692044-692066 ACAGAGATCAACAAAGATGACGG + Intronic
1050175789 9:2868219-2868241 ACAGACATGAGGATAGAGGGTGG - Intergenic
1050200968 9:3145662-3145684 ACAAAGATGAAAAAAGACAAAGG - Intergenic
1050236298 9:3584556-3584578 ATAGAGGTGAGAAGAGAGCAAGG - Intergenic
1050501047 9:6297725-6297747 ACAAAGATGAGAAGAGACAAAGG + Intergenic
1050610948 9:7352651-7352673 CCTAAGATGAGAAAAGTGGAGGG - Intergenic
1050681410 9:8116058-8116080 ACAGAGAGGAGAAAAGAAACAGG - Intergenic
1050751099 9:8938279-8938301 GAGGAGATGAGAAGAGAGGAGGG + Intronic
1050968526 9:11839235-11839257 ATAGAGATGAAAAAATGGGAGGG + Intergenic
1051109988 9:13624920-13624942 AAAGTGATGAAGAAAGAGGAGGG + Intergenic
1051257045 9:15224471-15224493 AAAGAGAAGAGAATGGAGGAAGG - Intronic
1051422476 9:16902573-16902595 ACAGAAATAAGAAAATGGGAAGG + Intergenic
1051596134 9:18825998-18826020 ACAGTGATGAGACAGGAAGAGGG - Intronic
1051662117 9:19435409-19435431 ACACAGAAGGAAAAAGAGGAAGG + Intronic
1051905141 9:22086233-22086255 TGAGATATGAGAAGAGAGGAAGG - Intergenic
1052019656 9:23510682-23510704 ACAGAGATGATACAACAGCATGG - Intergenic
1052380763 9:27768287-27768309 GCAGGTAAGAGAAAAGAGGAAGG - Intergenic
1052729701 9:32270966-32270988 CCACAGATGAGAAAGGAGAAGGG - Intergenic
1052977513 9:34422074-34422096 GAAGAGAGGAGAGAAGAGGAGGG + Intronic
1053002774 9:34586349-34586371 GCAGAGAAGAGAAGAGAGGGTGG + Intronic
1053273323 9:36765214-36765236 ACAGGAATGAGACAAGAGGAAGG + Intergenic
1053437327 9:38084777-38084799 AGAGAAAGGAAAAAAGAGGAAGG - Intergenic
1054745944 9:68853888-68853910 AGAGGGAGGAGAAAAGAGGTAGG - Intronic
1054954222 9:70889422-70889444 ACAGAGGTAAGAAAACAGGTGGG - Intronic
1055240292 9:74176524-74176546 ACAGAGAAGAGCAAGGAGGAGGG - Intergenic
1055531193 9:77185674-77185696 CCAGAGAGGGCAAAAGAGGAGGG - Intronic
1055605134 9:77961353-77961375 ACAGAGATCAGAATCGAGAAAGG + Intronic
1056193118 9:84204386-84204408 GAAGAGAAGAGAAGAGAGGAAGG + Intergenic
1056539226 9:87557032-87557054 ATAAAGAACAGAAAAGAGGAAGG + Intronic
1057075711 9:92137166-92137188 ACAGAGCAGAGGACAGAGGAAGG + Intergenic
1057076165 9:92139211-92139233 GCAGAGACCAGAAAAGAGGGTGG + Intergenic
1057394482 9:94667535-94667557 ACAGAGAAACCAAAAGAGGACGG + Intergenic
1057761168 9:97875528-97875550 ACAGAGATCAGCAAGGAGAATGG + Intergenic
1057940858 9:99282277-99282299 AAAGAAAAGAGAAAAGAAGAGGG - Intergenic
1058049239 9:100390048-100390070 ATATAGAGGAGAGAAGAGGAAGG + Intergenic
1058070711 9:100598389-100598411 ACAGAGCACAGAAAACAGGAGGG + Intergenic
1058527308 9:105872900-105872922 AAAGAGAGAAGAAAGGAGGAAGG - Intergenic
1058741102 9:107943366-107943388 ACATGGAAGAGAAGAGAGGATGG + Intergenic
1058945157 9:109849046-109849068 ACATAGAGGAGAGGAGAGGAAGG + Intronic
1058946389 9:109861000-109861022 ACAGAATTTAGACAAGAGGAGGG - Intronic
1059257229 9:112942004-112942026 GCAGAGATGAAAAAACAGGTGGG + Intergenic
1059407867 9:114113091-114113113 GCAGAGGTGAGACAAGTGGAAGG + Intergenic
1059632507 9:116139809-116139831 ACATAGATGAGAATTGAGGAGGG - Intergenic
1059649259 9:116300006-116300028 ACAGAGAACTGAAAAGAGCAAGG - Intronic
1059909294 9:119024660-119024682 AGGGAGAGGAGAAAAGATGAGGG - Intergenic
1060018030 9:120104249-120104271 AATGAGATCAGAAAGGAGGACGG + Intergenic
1060240371 9:121897877-121897899 AAGGAGAGGAGAAAAGAGAAGGG - Intronic
1060345907 9:122815472-122815494 ACAGTGGAGAGAATAGAGGAAGG - Intronic
1060398967 9:123336625-123336647 TCAGAGTTGAGAAGAGAGCAGGG - Intergenic
1060761054 9:126249193-126249215 ACACAGGTGAGAACAGAGAAGGG - Intergenic
1061529621 9:131200277-131200299 ACAGAAATGAGAATAGAGGCTGG + Intronic
1061618309 9:131794359-131794381 ACAGATGTGAGAGACGAGGAAGG + Intergenic
1061649613 9:132036568-132036590 GAAGAGCTGAGAAAAGAGCATGG + Intronic
1061751607 9:132781936-132781958 ACAGAGATGAGAAAGGAGGAAGG + Intronic
1061818679 9:133210499-133210521 CCAGAGATGAGCAAACAGGCTGG + Intergenic
1061954539 9:133955006-133955028 ACTGAGGTGAGGAAAAAGGAAGG + Intronic
1062241780 9:135544859-135544881 CCAGAGATGAGCAAACAGGCTGG - Intergenic
1203520387 Un_GL000213v1:40398-40420 GCAGAGATGAGAACAGGGAAAGG + Intergenic
1203461395 Un_GL000220v1:43272-43294 ACAGTGTTGACAAAGGAGGACGG + Intergenic
1185613730 X:1407793-1407815 ACAGAGAAGATAAAGGAGGAAGG + Intronic
1186077969 X:5901033-5901055 ACCCAGAGGAGAAGAGAGGAGGG - Intronic
1186092189 X:6061923-6061945 ACAGAGAAGAGAAAGGACCAAGG - Intronic
1186172427 X:6891539-6891561 ACAGAGAGGAGAAAGGAGTTGGG - Intergenic
1186181743 X:6980189-6980211 AAAGAGAAGAGAAGAGAAGAAGG - Intergenic
1186462687 X:9760917-9760939 ATAGAGATAGGAAGAGAGGAAGG + Intronic
1186578033 X:10787553-10787575 GAAGAGAAGAGAAGAGAGGAGGG - Intronic
1186646348 X:11511279-11511301 ACAGTGATTAAAATAGAGGAAGG + Intronic
1186669616 X:11756591-11756613 TCAGAGATGAGAACAGTAGATGG - Intergenic
1186758651 X:12700181-12700203 ACAGAAATTAAAAAACAGGAGGG + Intronic
1186864150 X:13702253-13702275 AAAACTATGAGAAAAGAGGAGGG - Intronic
1186902547 X:14073112-14073134 AAAGAGCTGAGAAAAGGGCAAGG - Intergenic
1187163972 X:16787362-16787384 AAAGAGGGGAAAAAAGAGGAGGG - Intronic
1187218027 X:17295970-17295992 ACAGAGAAGAGAAGACAGGCAGG + Intergenic
1187361453 X:18631738-18631760 TCAGAGAGGAAAAACGAGGATGG - Intronic
1187413468 X:19071320-19071342 AGAGAGAGGTTAAAAGAGGAGGG - Intronic
1187899302 X:24012207-24012229 ACACAGATTAGCAAATAGGAAGG - Intronic
1187939792 X:24370563-24370585 ACAGTTATCAGAAAGGAGGAAGG - Intergenic
1187997756 X:24946839-24946861 AAATAGCAGAGAAAAGAGGATGG - Intronic
1188843103 X:35039609-35039631 ACAGAAAACAGAAAAAAGGAGGG + Intergenic
1189000304 X:36937146-36937168 AGAGAGAAAAGAAAAGAGGAAGG + Intergenic
1189000315 X:36937251-36937273 AGAAAGAAAAGAAAAGAGGAAGG + Intergenic
1189011622 X:37050866-37050888 ACAGAGAGGAGAAGAGAGGAAGG + Intergenic
1189289094 X:39872740-39872762 ACAAAGAAGGGAAAAGAGGAGGG - Intergenic
1189413218 X:40791904-40791926 ACAGAGATAAGAAGTGAGGCCGG + Intergenic
1189594733 X:42552040-42552062 ACAGAGAGGACAAAAGAAGGAGG + Intergenic
1189877576 X:45452825-45452847 ACACACATGAGAAAATAAGAGGG + Intergenic
1190448450 X:50554386-50554408 ACAGAAATGGGAAAGGAGGTGGG + Intergenic
1190627610 X:52351986-52352008 AAAGAGAGGAGGAAGGAGGAAGG - Intergenic
1190783272 X:53619811-53619833 ACAGAGAAGAGAGTAAAGGAAGG + Intronic
1190924485 X:54889891-54889913 ACAAAGATAAAAAAAGAGAAGGG + Intergenic
1190930832 X:54948613-54948635 CCAGAGATGAGAAGAGAGCATGG - Intronic
1191682308 X:63853615-63853637 ACACAGATTAGCAAAGAGGTTGG - Intergenic
1192211462 X:69130495-69130517 AAAGAGAGGAGGAAAGAAGAGGG + Intergenic
1192243871 X:69357624-69357646 AAAGAGAGGAGAAAGGGGGAAGG + Intergenic
1192315477 X:70048070-70048092 GCAGAGAAGAGGAAAGAAGAGGG - Intronic
1192330906 X:70174569-70174591 AAAGAAAGGAGAAAAGTGGAAGG - Intergenic
1192406697 X:70892935-70892957 ACAAAGATCAAAAAAGATGAGGG + Intronic
1192474910 X:71432041-71432063 AGAGAGAAGACCAAAGAGGATGG + Intronic
1193107015 X:77687588-77687610 ACATAGATAAGAAAACAGAAAGG + Intronic
1193197646 X:78653454-78653476 ACAGGCAGGAGAGAAGAGGAGGG - Intergenic
1193381905 X:80825939-80825961 ACAAAGATCAAAAAAGACGAAGG - Intergenic
1193535484 X:82710135-82710157 ACATGGATGAGAGAAGAGGGAGG - Intergenic
1193568338 X:83108356-83108378 GGAGAGAAGAGAAGAGAGGAGGG - Intergenic
1193679822 X:84504530-84504552 AGTGAGAGGGGAAAAGAGGAAGG - Intergenic
1193925274 X:87476592-87476614 GCAGAGAAGAGGGAAGAGGAGGG - Intergenic
1193980424 X:88175630-88175652 ACACAGGTGAAAAAAGAAGAGGG + Intergenic
1194334437 X:92628078-92628100 AAAGAAAAGAGAAAAGACGAAGG - Intergenic
1194458411 X:94134129-94134151 ACAGAGATGAGATTAAATGAAGG + Intergenic
1195334633 X:103839448-103839470 ACAGAAGTGAGGAGAGAGGATGG - Intergenic
1195412442 X:104582551-104582573 AGAAAGAGGAGAAAGGAGGAAGG - Intronic
1195646500 X:107236563-107236585 TCAGAGAAGAGACAAGAGAAGGG - Intronic
1195676738 X:107512485-107512507 GGAGAAATGAGACAAGAGGAGGG - Intergenic
1195884212 X:109623438-109623460 TCAGAAATAAGAAAAAAGGAGGG + Intergenic
1195967388 X:110440797-110440819 ACAGAGAAGAGCAAACAGTAGGG + Intronic
1196106281 X:111899419-111899441 AGAGAGACAAGAAAAGATGATGG + Intronic
1196398552 X:115290662-115290684 GCAGAGCTGAGTAGAGAGGATGG + Intronic
1196514509 X:116553812-116553834 ACTGAGAAGAGAAAAGAGCCTGG - Intergenic
1196598144 X:117568975-117568997 ACATAAATGAGCAAAGATGATGG + Intergenic
1196678854 X:118450325-118450347 AGAGAGATGAGGAGAGGGGAGGG - Intergenic
1197180652 X:123532760-123532782 ACAAAGATCAAAAAAGAAGAAGG - Intergenic
1197570290 X:128142157-128142179 CCAAAGATGACAAAGGAGGAAGG + Intergenic
1197688634 X:129473098-129473120 AAAGAGATAAGAAACAAGGAAGG + Intronic
1197698792 X:129580604-129580626 ACGGAGATGAAAAAAGTTGAGGG + Intronic
1197783827 X:130181148-130181170 ACAGAAATCAGAATAGAAGAAGG + Intronic
1197840892 X:130745294-130745316 ACAGAGGAAAGAAAAGAGGAGGG - Intronic
1197869028 X:131048483-131048505 TTATAGATGAGAGAAGAGGAGGG - Intergenic
1198713968 X:139536299-139536321 AGAGAGAGGAGAGGAGAGGAAGG + Intronic
1198826600 X:140704938-140704960 AGAGAGATGGGAAAACAGCAGGG + Intergenic
1199541851 X:148966448-148966470 ATAGAGAGGAGAGAGGAGGAGGG - Intronic
1200243673 X:154511419-154511441 GCAGAGATGAGATAAAGGGAAGG + Intronic
1200529939 Y:4321588-4321610 ACAAAGATCAGAAAAGACAAGGG + Intergenic
1201058045 Y:10015478-10015500 AAAGAGAGAAAAAAAGAGGAAGG + Intergenic