ID: 996392205

View in Genome Browser
Species Human (GRCh38)
Location 5:122973814-122973836
Sequence AGTTATCTGCAGATGATGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 939
Summary {0: 2, 1: 198, 2: 204, 3: 136, 4: 399}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996392201_996392205 16 Left 996392201 5:122973775-122973797 CCAAGTAACAGGCCAAGAGCTGT 0: 174
1: 194
2: 145
3: 123
4: 215
Right 996392205 5:122973814-122973836 AGTTATCTGCAGATGATGGCAGG 0: 2
1: 198
2: 204
3: 136
4: 399
996392203_996392205 4 Left 996392203 5:122973787-122973809 CCAAGAGCTGTCTCTCAAAAGGA 0: 181
1: 197
2: 163
3: 130
4: 293
Right 996392205 5:122973814-122973836 AGTTATCTGCAGATGATGGCAGG 0: 2
1: 198
2: 204
3: 136
4: 399

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996392205 Original CRISPR AGTTATCTGCAGATGATGGC AGG Intronic
900434958 1:2625576-2625598 AGTTAACTGCAGAAGATAGCAGG - Intronic
900790478 1:4676604-4676626 AGTAATCAGGAGATGATGGGGGG + Intronic
900800992 1:4736994-4737016 ATTTTTCTCTAGATGATGGCTGG - Intronic
900939785 1:5791289-5791311 ATTTATCTTCACATGGTGGCAGG - Intergenic
901444625 1:9300522-9300544 AGTTATTTGTGGATGATGGCAGG - Intronic
901904052 1:12392686-12392708 AGTTATCTGCAGAAGATGGCAGG + Intronic
901939002 1:12647802-12647824 AGTTATCTGGGCATGGTGGCAGG - Intronic
903016490 1:20365405-20365427 AGTGAGAGGCAGATGATGGCTGG - Intergenic
903120066 1:21210388-21210410 AGTTATCCACAGAGGATGGTGGG - Intergenic
904179494 1:28655973-28655995 AGTTATCTGCAGAAGATGGCAGG + Intergenic
904335931 1:29797984-29798006 AGTTATCTGCAGAAGATGGCAGG - Intergenic
905153270 1:35950070-35950092 AATTAGCTGCATGTGATGGCGGG + Intronic
905354066 1:37368785-37368807 AGTTATCTGCAGAAGATGGCAGG - Intergenic
905465224 1:38148097-38148119 AGTTATCTGAAGAAGATGGTAGG - Intergenic
906050487 1:42867412-42867434 CATTATCTGCAGAAGATGGCAGG - Intergenic
906054946 1:42908468-42908490 AGTTATCTGCCAATAATGGAGGG + Intergenic
906289438 1:44610342-44610364 TGTTATCGGCAGAGGATGGCGGG - Intronic
906879674 1:49576460-49576482 AGTTATGTGCAGAAAATGGCAGG - Intronic
907545718 1:55258360-55258382 AGTTTGCTGCTGAAGATGGCTGG + Intergenic
907597345 1:55732128-55732150 AGTTATCTGCAGAAGATGACAGG - Intergenic
907602084 1:55782149-55782171 AGTTATCTGTAGATGATGGCAGG + Intergenic
908240798 1:62187553-62187575 AGTTAGCTGGACATGGTGGCAGG - Intergenic
908285891 1:62600602-62600624 ACATATCTGTAGATGTTGGCAGG - Intronic
908389713 1:63673515-63673537 AATTATCTGGACATGATGGCGGG - Intergenic
909172609 1:72315466-72315488 AATTATCTGCAGAAGATGGCAGG + Intergenic
909576919 1:77185856-77185878 AGTTATCTGCAGAAGATGGCAGG - Intronic
910223661 1:84915244-84915266 AGTTAGCTGGGCATGATGGCGGG - Intergenic
910370633 1:86512126-86512148 AGTTATCTGCAGAAGATGGCAGG - Intergenic
910561899 1:88599979-88600001 GGTTATCTGCAGAAGATGGCAGG - Intergenic
910565674 1:88640074-88640096 AGTTATCTGAGAATGATGGCAGG + Intergenic
910588215 1:88901724-88901746 AATTATCTGCAGAAGATGGCAGG - Intergenic
910630219 1:89346250-89346272 AGTTATCTGCAAAAGATGGCAGG - Intergenic
910638992 1:89439976-89439998 CATTATCTGCAGAAGATGGCAGG + Intergenic
910831099 1:91463426-91463448 AGTTGTCTGCAAAAGATGGCAGG + Intergenic
910948213 1:92616686-92616708 AGTTATCTGAAGAAGATGGCAGG - Intronic
911109099 1:94164207-94164229 AGTTATCTTCAGAAGATGGCAGG + Intronic
911257327 1:95647366-95647388 AGTTATCTGCAGAAGATGGCAGG + Intergenic
911706631 1:101021277-101021299 AATTATCAGCAGAAAATGGCAGG + Intronic
911738399 1:101361921-101361943 AGTTATCTGCAGAAGATGGCAGG + Intergenic
911883569 1:103270447-103270469 AGTTATAGGCAGAAGATGGCAGG - Intergenic
911980425 1:104559419-104559441 AGTTATCTGCAGAAGATGGCAGG - Intergenic
911981900 1:104579264-104579286 AGTTATCTGCAAAGTATGGCAGG + Intergenic
912067021 1:105756945-105756967 AGTTATATGCAGAAGAAGGCAGG - Intergenic
912129913 1:106588052-106588074 AGTTATCTGCAGAAGATGGCAGG + Intergenic
912212251 1:107568892-107568914 AGTTATCTGCAGAAGATGGCAGG - Intergenic
912252031 1:108021390-108021412 AGTTATCTGCAGAAGATGGCAGG + Intergenic
912733324 1:112128831-112128853 AGTCATCTGCAGAAGATGGCAGG + Intergenic
913039446 1:115008397-115008419 AGTTATCTACAGAAGATAGCAGG + Intergenic
913297059 1:117332340-117332362 AATTAGCTGCACATGATGGCAGG + Intergenic
913530742 1:119732649-119732671 ATTTATCTGCAGATGACTGCAGG - Intronic
914255526 1:145959157-145959179 ATATATCTGCTGATGATGGAGGG + Intergenic
916017358 1:160761994-160762016 AGTTATCTGCAGCTGACTCCAGG + Intergenic
916106331 1:161435329-161435351 AGTTATTTGCAGAAGATGGCAGG + Intergenic
916285315 1:163099526-163099548 AGTTATTTGCAGAAGATCGGAGG - Intergenic
916365972 1:164028089-164028111 AGTTATCTGTGGAGGAGGGCAGG + Intergenic
916621826 1:166506148-166506170 AGTTAGCTGGGCATGATGGCGGG - Intergenic
916709174 1:167387102-167387124 CGTTCTCTGCATATGGTGGCAGG + Intronic
917217216 1:172690915-172690937 AGTTATCTGCAGAAGATGGCAGG + Intergenic
917610652 1:176685697-176685719 ACTTAAATGCTGATGATGGCAGG + Intronic
917814009 1:178688991-178689013 AATTAGCTGGACATGATGGCGGG + Intergenic
918748061 1:188231763-188231785 TGTTATCTGCAGATGCTGGAAGG - Intergenic
918755717 1:188337811-188337833 AGTTATCTGGAGAAGATGGAAGG + Intergenic
918815077 1:189171226-189171248 AGTTACCTGCAGAAGATGGCTGG - Intergenic
918918233 1:190671881-190671903 AGTTATCTGCAGAAGATGGCAGG + Intergenic
918958242 1:191237947-191237969 AGTTGTCTTCAGAAGATGGCAGG - Intergenic
919124613 1:193379783-193379805 AGTTATCTACAGAAGATGGCAGG + Intergenic
919317970 1:195999360-195999382 AGTTATCTGCAGAAGATGGCAGG - Intergenic
920167024 1:204043334-204043356 AATTAGCTGGGGATGATGGCGGG - Intergenic
920197429 1:204238364-204238386 AGTTAGCTGCAGAAGATGGCAGG - Intronic
920749637 1:208661553-208661575 AGTTTTCTGCTCATGATGGTGGG - Intergenic
921619818 1:217313135-217313157 AATTATCTGCAGACGATGGTAGG - Intergenic
922068843 1:222170803-222170825 AGATATCTGCACAGGATGGGTGG - Intergenic
922781048 1:228252583-228252605 AGTTATCTGCAGAAGATGACAGG + Intronic
923253570 1:232199439-232199461 AGTTATCTGCAGAAGATAGCAGG + Intergenic
923722448 1:236478733-236478755 AGTTATCTGGGCGTGATGGCGGG - Intronic
924182508 1:241453247-241453269 AGTTATTTGCAGAAGATAGCAGG + Intergenic
924840778 1:247707834-247707856 AGTTATCTGCAGAAGATGGCAGG + Intergenic
924847135 1:247785140-247785162 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1063727242 10:8651373-8651395 CTTTGTCTGCAGATGATGGTAGG - Intergenic
1063907743 10:10798366-10798388 AGTAATCTGCGAATGATTGCTGG + Intergenic
1064517644 10:16168258-16168280 AGTTATCTGCAGAAGAGGGCAGG + Intergenic
1064545690 10:16448137-16448159 AGTTATCTGCAGAAGATGGCAGG + Intronic
1065005324 10:21374162-21374184 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1065607016 10:27428505-27428527 AGTTATCCACTGAGGATGGCAGG - Intergenic
1065722395 10:28639665-28639687 AGTTACCAGGAGCTGATGGCAGG - Intergenic
1066167029 10:32799232-32799254 GATTATCTGCAGAAGACGGCAGG + Intronic
1066344978 10:34575745-34575767 AGTTAGCTGGACATGGTGGCGGG + Intronic
1066391151 10:34978266-34978288 CGTGATCAGCAGGTGATGGCTGG + Intergenic
1066551958 10:36568512-36568534 AGTTAGCTGGACATGCTGGCGGG - Intergenic
1066688231 10:38001466-38001488 AGTTAGCTGCGCATGTTGGCAGG + Intergenic
1066957621 10:42188051-42188073 AGTTAACTGGAGAAGATGACCGG - Intergenic
1067026695 10:42848356-42848378 AGTTATCTGCTGAGGATGGCAGG + Intergenic
1067125555 10:43512546-43512568 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1067333138 10:45340215-45340237 AGTTATATGCAGAAAATGGCAGG - Intergenic
1068007719 10:51409878-51409900 AGTTATCTGCAGAAGATGTCAGG + Intronic
1068447208 10:57138591-57138613 AGTTATCTGAAGAAGATGGCAGG - Intergenic
1068837218 10:61568380-61568402 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1069516888 10:69084902-69084924 AATTATCTGGACATGATGGCGGG - Intergenic
1069790833 10:71019585-71019607 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1069851869 10:71410650-71410672 AGTTAACTTCAGAGGATGACGGG - Intronic
1071168002 10:82829349-82829371 CTTTATCTGCAGATGAGGTCTGG + Intronic
1071267088 10:83974004-83974026 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1071364470 10:84884523-84884545 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1071673929 10:87637431-87637453 AGTTATCTTCAGAAGATGGTAGG + Intergenic
1071867072 10:89746471-89746493 AGATACCAGCAGATGCTGGCAGG - Intronic
1071937687 10:90549274-90549296 AGTTATCTGCAGAAGATGGAAGG - Intergenic
1071942787 10:90607780-90607802 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1071950802 10:90700939-90700961 AGTTATCTGTGGATGATGGCAGG + Intergenic
1072360467 10:94654141-94654163 AATTGTCTACAGAAGATGGCAGG - Intergenic
1073320667 10:102614407-102614429 AATTAGCTGGACATGATGGCAGG + Intronic
1073656681 10:105424485-105424507 AGTTATCTGCAGAAGATGTCAGG + Intergenic
1073830506 10:107378011-107378033 AGTTATCTGTAGATGATGGCAGG + Intergenic
1073918478 10:108432317-108432339 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1073957686 10:108891655-108891677 AGTTATCTGCAGAAGATGGTAGG + Intergenic
1075606787 10:123817397-123817419 CATTATTTGCAGAAGATGGCAGG - Intronic
1076772631 10:132674841-132674863 AGTTACCTGCAGAAGATGGCAGG + Intronic
1076927417 10:133499228-133499250 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1077381072 11:2237901-2237923 GGTTATCTGTGGATGGTGGCAGG - Intergenic
1077396475 11:2325982-2326004 GGTTATCTGTGGATGATGACAGG - Intergenic
1078776982 11:14402875-14402897 AGTTGTCAGCAGAGGATAGCCGG + Intergenic
1080076590 11:28157493-28157515 AGTTATCTGCAGAAGATGTCAGG - Intronic
1080976678 11:37350570-37350592 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1081065464 11:38534904-38534926 AGTTGTCTGCAGGAGATGGCAGG + Intergenic
1081072774 11:38631093-38631115 AGATGTCTGCAGAAGATGGCAGG - Intergenic
1081110475 11:39128391-39128413 AGTTATCTGCATAAGATGGCAGG - Intergenic
1081609059 11:44547850-44547872 AGTTATCTGTAGAAGATGGCAGG - Intergenic
1081640731 11:44751776-44751798 AATTATTTGGACATGATGGCAGG + Intronic
1082180774 11:49116601-49116623 AGTTTTATCCAGATGAAGGCAGG + Intergenic
1082671698 11:56043014-56043036 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1082999658 11:59279854-59279876 TAGTATCTGCAGAAGATGGCAGG - Intergenic
1083093143 11:60221099-60221121 AGTTATCTGCAGAAGATGGCAGG - Intronic
1083112258 11:60422849-60422871 AGTTATCTGAAGAGGATGGAAGG + Intergenic
1083672440 11:64306791-64306813 AGTTTTCTCCAGATGTTGGGGGG - Intronic
1084231583 11:67757423-67757445 AGACATCAGCAGATGCTGGCAGG + Intergenic
1084657064 11:70525810-70525832 AGTTTTGTGGAGGTGATGGCGGG + Intronic
1085685960 11:78622162-78622184 ACTTATCTGCAGAAGATGGCAGG - Intergenic
1085747569 11:79128212-79128234 AGTTATCTGCAGAAGATGCCAGG - Intronic
1087153256 11:94877520-94877542 AGTAATGTGCAAAAGATGGCAGG + Intergenic
1088101364 11:106159634-106159656 AATTAGCTGGACATGATGGCAGG + Intergenic
1088191662 11:107234518-107234540 AGTTATCTGCAGAATATGGCAGG + Intergenic
1088449352 11:109965340-109965362 AGTTATCTGTGGAAGATGGCAGG - Intergenic
1088836653 11:113583361-113583383 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1089762342 11:120737138-120737160 GGTTATCTCCTGAGGATGGCCGG + Intronic
1089903604 11:122013580-122013602 GTTAATCTGCAGAAGATGGCAGG - Intergenic
1090209495 11:124908075-124908097 AGTCATCTGCAGAAGATGGCAGG + Intergenic
1090221617 11:125031613-125031635 AGTTATCTGCAGAAGATGGCAGG + Intronic
1090873210 11:130766326-130766348 AGTGATCTGCAGGGGAAGGCAGG - Intergenic
1090891794 11:130930141-130930163 ACTCATGTGCATATGATGGCAGG + Intergenic
1091051736 11:132378728-132378750 AATTATTTGTAGAAGATGGCAGG - Intergenic
1092093281 12:5821623-5821645 AGTTATCTGCAGAAGATGGCAGG - Intronic
1092381558 12:8000911-8000933 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1092922543 12:13245519-13245541 AGCTGTCTACAGATGACGGCAGG + Intergenic
1093031873 12:14295977-14295999 AGTTATCTGCGGAAGATGGCAGG + Intergenic
1093036286 12:14335315-14335337 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1093048926 12:14484995-14485017 AGTTACCTGCAAAAGATGGCAGG + Intronic
1093049672 12:14490990-14491012 AGTTACCTGCAAAAGATGACAGG + Intronic
1093392086 12:18635562-18635584 GGTTATCTGCATAAGATGGCAGG + Intronic
1093645725 12:21583643-21583665 AGTTATCTGCAGAAGATGGCAGG - Intronic
1093766273 12:22966885-22966907 AGGTAGGTGCAGGTGATGGCAGG - Intergenic
1093964536 12:25310929-25310951 AGTTATCTGCAGAAGACGGCAGG - Intergenic
1094102526 12:26779235-26779257 AGTTATCTGCAGAAGATGGCAGG - Intronic
1094819396 12:34212699-34212721 GGTTATCTGCAGATAATGGCAGG - Intergenic
1095054617 12:37584624-37584646 AGTTAGCTGGACATGGTGGCAGG - Intergenic
1095095414 12:38145375-38145397 GGTTATCTGCAGATAATGGCAGG + Intergenic
1095121508 12:38424871-38424893 AGTTTTCTGCAGAAAATGCCAGG + Intergenic
1095190258 12:39250137-39250159 AGCTATCTACAGAGGATGGCAGG - Intergenic
1095723843 12:45430671-45430693 AGTAATCTCCAGATAATGGTAGG - Exonic
1095844402 12:46729995-46730017 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1095856243 12:46863702-46863724 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1096288710 12:50322933-50322955 AGTTATCTACAGAAGATGGCAGG - Intergenic
1096345735 12:50844520-50844542 AATTAGCTGGACATGATGGCAGG - Intronic
1096457472 12:51799464-51799486 AGTTATCTGCAGAAGATGGCAGG + Intronic
1097032658 12:56100789-56100811 AACTAGCTGCACATGATGGCAGG + Intronic
1097051689 12:56227018-56227040 AGATATCTGCAGCCCATGGCTGG - Intronic
1097076998 12:56402414-56402436 AGTTATCGCCAGAAGATGGCAGG - Intergenic
1097098682 12:56570724-56570746 AATTAGCTGGAGGTGATGGCGGG - Intronic
1097437843 12:59572281-59572303 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1097564650 12:61252456-61252478 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1097821385 12:64132191-64132213 AGTTATCTGCAGAAGAAGGCAGG + Intronic
1098673038 12:73254217-73254239 AGTTAACTGCAGAAGATGGCAGG - Intergenic
1098731049 12:74037321-74037343 AGTTATCTGCAGAAGATAGCAGG - Intergenic
1098733288 12:74065604-74065626 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1098749845 12:74279564-74279586 AGTTATCTGCAGAAGATGACAGG - Intergenic
1098831907 12:75374052-75374074 AGTTATCTGCGGAAGATAGCAGG + Intronic
1098889326 12:75992805-75992827 AATTATATGCACATGATGGAAGG - Intergenic
1099183382 12:79492615-79492637 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1099365921 12:81765357-81765379 AGTTATCTGCAGAATATGGCAGG - Intergenic
1099375646 12:81893930-81893952 AGTAATCTGCAGAAGATGGCAGG - Intergenic
1099526360 12:83723084-83723106 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1099689778 12:85938010-85938032 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1099735783 12:86565012-86565034 AGTTATCTGCAGAAGATAGTAGG - Intronic
1099821351 12:87715107-87715129 AGTCATCTGCAAAGAATGGCAGG + Intergenic
1099995069 12:89769557-89769579 AGTTATCTGAAGAGGATGGCAGG + Intergenic
1100083302 12:90878185-90878207 AGTTATCTGCAGAAGATGTCAGG - Intergenic
1100241155 12:92711635-92711657 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1100851631 12:98718379-98718401 AATTAGCTGCATGTGATGGCAGG - Intronic
1101264129 12:103066095-103066117 AGTTATCTGCAGAAGATGACAGG - Intergenic
1101534670 12:105606131-105606153 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1101543069 12:105682609-105682631 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1102097003 12:110248925-110248947 TCTTATCTGCAGATGAGGCCAGG - Intergenic
1102915305 12:116748039-116748061 AATTAGCCGCACATGATGGCAGG + Intronic
1103035609 12:117654036-117654058 AGTTATCTGCAGAAGATGGCAGG - Intronic
1103396526 12:120611420-120611442 AGTTACCTGCAGAACATGTCAGG - Intergenic
1105033330 12:132900520-132900542 AATTATCTGCAGACAATGTCAGG + Intronic
1105740106 13:23315149-23315171 AGTTATCTTCAGAAGATGGCAGG - Intronic
1106305117 13:28502841-28502863 ATTTATTTGAAAATGATGGCTGG + Intergenic
1107126434 13:36851402-36851424 AGTCATCTGCACATGAGGGTGGG - Intronic
1107711718 13:43157111-43157133 AGATATCTACAGATGGTGGGTGG - Intergenic
1107983578 13:45755999-45756021 AGTTATCTGCAGAAGATGACAGG + Intergenic
1108193700 13:47970430-47970452 AGTTACGTGAAGATGATGACTGG - Intronic
1108302439 13:49092012-49092034 TGTTATCTGCGGAAGATGGCAGG + Intronic
1108556643 13:51600014-51600036 AGCTATCTGGAGATGAGGGAGGG - Intronic
1108904275 13:55449944-55449966 AGTTATTTGCAGAAGATGGCAGG - Intergenic
1108914305 13:55588898-55588920 ACTTATCTGCAGGAGATGGCAGG + Intergenic
1109293221 13:60500091-60500113 AGTTATCCACAGAAGATGGCAGG - Intronic
1109712683 13:66180849-66180871 AGTTTTCTACAGAAGATGGCAGG + Intergenic
1109914047 13:68956168-68956190 AGTAATCTGCTGATGTTGGCTGG + Intergenic
1109933294 13:69245202-69245224 AGTTATTTGCAGATAGTGTCAGG + Intergenic
1109951026 13:69502232-69502254 AGTTATCTGCAGAAGATAGCAGG + Intergenic
1110834138 13:80064656-80064678 TGTTATCTGCAGAAGATGGCAGG + Intergenic
1111317499 13:86581776-86581798 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1111470900 13:88681086-88681108 AGTTATGTACAGATGATGGCAGG + Intergenic
1112231129 13:97590191-97590213 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1112249931 13:97770305-97770327 AATTATCTGCAGAAGATGGCAGG + Intergenic
1113319708 13:109221690-109221712 CGTTATCTGCAGAAGATGGCAGG + Intergenic
1113553239 13:111209651-111209673 AGTTATCTCCAGATAATTTCTGG + Intronic
1114205868 14:20570742-20570764 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1114905378 14:27120449-27120471 TGCTATCTGAAGAAGATGGCAGG + Intergenic
1115059714 14:29173867-29173889 AGTTATCTGCAGAAGATGACAGG - Intergenic
1115143396 14:30199360-30199382 AGTTATCTCCAGAAGATAACAGG - Intergenic
1115503001 14:34065732-34065754 AGTCACCTGGAGGTGATGGCAGG - Intronic
1115967411 14:38906740-38906762 ATTGATCTGCAGATGTTGACTGG + Intergenic
1116058905 14:39896911-39896933 AGTTATCTGTAGAATATGGCAGG - Intergenic
1116068091 14:40009144-40009166 AGTTATCTGAAGAAGATGGGAGG - Intergenic
1116158382 14:41236692-41236714 AGCTATCTGCAGAAGGTGACAGG + Intergenic
1116308048 14:43283474-43283496 AGTTATCTGCAGAAGATGGTAGG + Intergenic
1116415069 14:44669285-44669307 AGTTATTTGCAGAAGATGGCAGG - Intergenic
1116531457 14:45978252-45978274 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1117001597 14:51376285-51376307 AGTTATCTGCAGAAGATCACAGG - Intergenic
1117216840 14:53560148-53560170 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1117634130 14:57724346-57724368 AGTTATCTGCAGAAGATGGCAGG - Intronic
1118122436 14:62860197-62860219 AGTTATCTGCAGAAGACGGCAGG + Intronic
1118385505 14:65252570-65252592 AGTTATTTGTGAATGATGGCAGG + Intergenic
1118501832 14:66369364-66369386 AGTTATCTGTGGATGATTGCAGG - Intergenic
1118880777 14:69824045-69824067 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1119107566 14:71938866-71938888 AGTTACCTGCAGAAGATGACAGG + Intronic
1119555773 14:75551222-75551244 AGATAAATGCAGAGGATGGCAGG - Intergenic
1120082027 14:80227557-80227579 AGTTATCTGCAGAAGATGGCAGG + Intronic
1120169404 14:81233959-81233981 AGTTATCTGCAGAAAATGGCAGG - Intergenic
1120231424 14:81845278-81845300 AGTTATCTGCAGAAGATAGCAGG + Intergenic
1120250743 14:82059676-82059698 AATTATCTGCAAATGATGGCAGG + Intergenic
1120555997 14:85930472-85930494 AGTTATCTGCATAAGATGGCAGG + Intergenic
1120866567 14:89300329-89300351 AATTATCTGGGCATGATGGCGGG - Intronic
1122557228 14:102587707-102587729 ATTTTGCTGCAGATGGTGGCAGG - Intergenic
1122679248 14:103444626-103444648 AATTAGCTGGACATGATGGCGGG + Intronic
1122737502 14:103851476-103851498 AGTTATCTGAGCATGATGGTGGG + Intergenic
1123817817 15:23997529-23997551 AGTTATCTGTGGATGATGGCAGG + Intergenic
1123908503 15:24943681-24943703 AGTTAACTACAGAGGATAGCAGG + Intronic
1124390076 15:29246946-29246968 AAATATGTGCAGATGATGACTGG + Intronic
1126283607 15:46986250-46986272 AGTTGTCTGCAGAAGATGGCAGG - Intergenic
1126313849 15:47347055-47347077 AATTATCTAGACATGATGGCGGG - Intronic
1127356911 15:58209162-58209184 AGTTATCTGCAGAAGATGGCAGG - Intronic
1128765193 15:70247101-70247123 AGACCTCTGCAGATGAAGGCTGG - Intergenic
1129734966 15:77954969-77954991 AGTTAGCTGGACATGGTGGCGGG + Intergenic
1129785723 15:78308917-78308939 AGGTATGTGCAGAGGATGGGAGG - Intergenic
1130217280 15:81984324-81984346 ATCTATCTTCAGGTGATGGCTGG - Intergenic
1131724007 15:95202768-95202790 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1133386462 16:5374064-5374086 AGGTGCCTGCACATGATGGCAGG - Intergenic
1133386465 16:5374084-5374106 AATTAGCCGCACATGATGGCAGG - Intergenic
1135061641 16:19276033-19276055 AGTTATCTGCGGATGATGCACGG + Intergenic
1135625999 16:23995469-23995491 AGCTATCTGTGGATTATGGCAGG - Intronic
1136250938 16:29004564-29004586 AGTTATCTGCAGAAGATGGCGGG - Intergenic
1138868382 16:60850758-60850780 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1139229154 16:65265966-65265988 GATTCTCTGCAAATGATGGCTGG + Intergenic
1139258445 16:65566624-65566646 AATTAGCTGGATATGATGGCAGG + Intergenic
1140530970 16:75665712-75665734 AATTATCTGGACATGGTGGCAGG + Intronic
1140816909 16:78629581-78629603 AGTAAGCTGCAGAGGTTGGCAGG - Intronic
1141559546 16:84858065-84858087 AGTTATCTGCAGAAGATGGCAGG + Intronic
1141907570 16:87037540-87037562 AGTTAGCTGCTCATGGTGGCAGG - Intergenic
1142540081 17:652141-652163 AATTATCTGGACATGGTGGCAGG - Intronic
1142739089 17:1920166-1920188 AATTATCTGCAAATAATGGAAGG + Intergenic
1143050118 17:4118377-4118399 AGTTATCTGCAAAAGATAGTAGG + Intronic
1143087888 17:4430282-4430304 AGTTAGCTGCGCATGGTGGCGGG - Intergenic
1143145272 17:4771405-4771427 AGTTATCTGTGCATGGTGGCGGG - Intergenic
1143160882 17:4870054-4870076 AGTTAGCTGGGCATGATGGCGGG - Intronic
1145032427 17:19515058-19515080 AATTATCTGCGCACGATGGCAGG - Intronic
1146237981 17:31185921-31185943 AGTTATCTGCAGAAGATGGCAGG - Intronic
1146615831 17:34356821-34356843 AATTAGCTGCACGTGATGGCGGG - Intronic
1146836352 17:36113973-36113995 AGTTATCTGAACAAGATGGCAGG - Intergenic
1146850931 17:36221013-36221035 AGTTATCTGAACTAGATGGCAGG - Intronic
1149799389 17:59552945-59552967 AATTAGCTGGAGATGGTGGCGGG + Intergenic
1149880659 17:60286999-60287021 ATTTAGCTGCACATGGTGGCAGG + Intronic
1150594302 17:66590699-66590721 AATTAGCTGGACATGATGGCGGG + Intronic
1151037814 17:70821615-70821637 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1151628351 17:75292328-75292350 AATTAGCTGGACATGATGGCGGG - Intergenic
1153089704 18:1330131-1330153 AGTTAACTGCAGAAGATGGCAGG - Intergenic
1153131278 18:1857740-1857762 GGTTATCTGTAGAAGATGGCAGG + Intergenic
1153217696 18:2835633-2835655 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1154068461 18:11131068-11131090 AGTTATCTGCAGAAGGTGGCAGG - Intronic
1154252674 18:12757306-12757328 AGTTACCTGCAGAAGATGGCAGG + Intergenic
1154506169 18:15042859-15042881 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1155136492 18:22999313-22999335 AGTTGTAGGCAGATGGTGGCTGG + Intronic
1155940704 18:31799567-31799589 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1156582549 18:38394433-38394455 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1156606368 18:38671734-38671756 AGTTATCTTCAGAAGATGGCAGG - Intergenic
1156990307 18:43400806-43400828 AGTTATCTGCAGAAGACGGCAGG + Intergenic
1157341198 18:46779996-46780018 AGTTATCTGGAGAAGATGGCAGG - Intergenic
1157998507 18:52588155-52588177 AGTTATCTGCAGAAGATGGAAGG + Intronic
1159277137 18:66235494-66235516 AGTTATCTGTGAATGCTGGCAGG - Intergenic
1159287787 18:66375451-66375473 AGTTATCTGCAGAAGATAGCAGG - Intergenic
1159559108 18:69975382-69975404 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1160593959 18:79961747-79961769 CGTTATCTTCAGATGTTGACTGG - Intergenic
1160700451 19:504410-504432 AGTTAGCTGGACATGGTGGCAGG - Intronic
1161150542 19:2705989-2706011 AGTTAGCTGGACATGATGGTGGG - Intergenic
1161928811 19:7321934-7321956 AGTTATCTGGGCATGGTGGCGGG + Intergenic
1161928845 19:7322268-7322290 AGTTATCTGGGCATGGTGGCGGG - Intergenic
1161996610 19:7716759-7716781 ACTTATATTAAGATGATGGCAGG + Intergenic
1162359333 19:10208336-10208358 AATTAGCTGGACATGATGGCAGG + Intronic
1164030085 19:21396064-21396086 AATTATCTGGGTATGATGGCAGG - Intergenic
1164097089 19:22021374-22021396 AGTTATCTGCAGAAAATGGCAGG + Intergenic
1164117261 19:22234605-22234627 AGTTATCTGCAGAAAATGGCAGG + Intergenic
1166402324 19:42492533-42492555 AATTAGCTGGACATGATGGCGGG + Intergenic
1166553280 19:43681323-43681345 AATTATCTGGTCATGATGGCGGG - Intergenic
1167304658 19:48700685-48700707 AATTATCTGCATGTGATGGCTGG - Intronic
1167305267 19:48704639-48704661 AATTATCTGCATGTGATGGCTGG - Exonic
1167395433 19:49225356-49225378 AGTTATCTGGGCATGGTGGCAGG - Intergenic
1167657483 19:50774832-50774854 AGTTAGCTGGACATGATGGTGGG - Intergenic
1167678947 19:50907553-50907575 AGTTAGCTGGATATGGTGGCAGG - Intronic
1167951576 19:53031895-53031917 AGTTATCTGCAGAGGATGGTAGG - Intergenic
1168023058 19:53623799-53623821 AATTAGCTGGACATGATGGCAGG + Intergenic
1168043603 19:53778217-53778239 AATTATCTGGACATGATGGTGGG + Intergenic
1168539339 19:57197401-57197423 AGTTATCTGCAGAAGATGGCAGG + Intronic
925499410 2:4486952-4486974 AATAATCTGCAGAAAATGGCAGG + Intergenic
925631442 2:5897703-5897725 AAGTATTTGCAGCTGATGGCAGG + Intergenic
926108580 2:10167766-10167788 AGTTATCTTCAGATGAGGACAGG - Intronic
926161467 2:10492994-10493016 AATTATCTGGGCATGATGGCAGG + Intergenic
926810399 2:16750706-16750728 TAGTATCTGCAGAAGATGGCAGG + Intergenic
926825569 2:16902261-16902283 GGTTATCTGCAGAAGATGGCAGG + Intergenic
927008714 2:18879693-18879715 ACTTATCTGCAGAAGATGGCAGG - Intergenic
927032404 2:19135260-19135282 AGTGATCTCCAGCTGATAGCTGG + Intergenic
928687017 2:33760303-33760325 AGCCATATGCTGATGATGGCAGG - Intergenic
928805180 2:35141254-35141276 AGTTTTTTACAGATGATGGAAGG - Intergenic
929505044 2:42521901-42521923 AATTAGCTGGACATGATGGCAGG - Intronic
929550259 2:42886001-42886023 AATTATCTGAAGATTATGTCAGG - Intergenic
930295407 2:49547540-49547562 AGTTACCTGCAGAAGATGGCAGG + Intergenic
930446589 2:51481344-51481366 AGTTATCTGCCAATGAAGACAGG - Intergenic
930626777 2:53707497-53707519 AATTATCTGCGCGTGATGGCGGG + Intronic
930668751 2:54125599-54125621 ACTTAGCTGGAGATGGTGGCAGG + Intronic
930910148 2:56620868-56620890 AGTTATCTGCAGAAGATGCCAGG - Intergenic
931987157 2:67753412-67753434 AGTTGTCAGCAAATGATGGTAGG + Intergenic
932845601 2:75132938-75132960 AGTTTCCTGCAGCTGTTGGCAGG + Intronic
933265687 2:80178412-80178434 AGTTATCTGCAGAAGATGACAGG + Intronic
933767063 2:85716847-85716869 AGGGAACTGCAGCTGATGGCTGG + Intergenic
934305739 2:91820565-91820587 AGTTAACTGGAGAAGATGACCGG - Intergenic
934327517 2:92032177-92032199 AGTTAACTGGAGAAGATGACCGG + Intergenic
934465906 2:94262756-94262778 AGTTAACTGGAGAAGATGACCGG + Intergenic
935183932 2:100714870-100714892 AGTTATTTTCAGAAGATGGTAGG - Intergenic
935425113 2:102911356-102911378 AGTTATTTGCAGAAGATGGCAGG + Intergenic
935555596 2:104506612-104506634 AATTAGCTGGACATGATGGCGGG - Intergenic
935564312 2:104590282-104590304 AGTTATCTGCAGAAGATGGCAGG + Intergenic
935760550 2:106316707-106316729 AGTTAGCTGGACATGGTGGCAGG - Intergenic
936641221 2:114314661-114314683 AGTTATCTGGACAAGATGGGAGG - Intergenic
936646294 2:114376411-114376433 AATTATCTGTGGATAATGGCAGG + Intergenic
937531189 2:122829577-122829599 ATTTATCTGCAGAGGATGGCAGG - Intergenic
937582066 2:123499196-123499218 AGTTCTCTGCAGAAGAAGACAGG + Intergenic
937785210 2:125887757-125887779 AGTTATCTGCAGAGGATGGCAGG + Intergenic
937800324 2:126074699-126074721 ACTTATCTGAAGAAGATGGCAGG - Intergenic
937852573 2:126648767-126648789 AGCTATCTGCAGGAGATGACAGG + Intergenic
938894575 2:135737526-135737548 GGTTATATGCAAATGATGCCAGG - Intergenic
939069058 2:137517827-137517849 AGTTATCTGCAGAAGATGGCAGG - Intronic
939213869 2:139212211-139212233 AGTTATCTGCAGAAGATGGCAGG - Intergenic
939633368 2:144551812-144551834 AGTTATCTGCAGATGATGGCAGG + Intergenic
939755229 2:146101775-146101797 AGTTATCTGCAGAGGAAGGCAGG - Intergenic
939788688 2:146546142-146546164 AGTTATCTGCAGAAGATGCCAGG + Intergenic
939806237 2:146778445-146778467 AGTTATCTGCAGAAGATGGCAGG - Intergenic
940145891 2:150543218-150543240 TCTTATCTGCAGATTATGGGAGG - Intergenic
940171315 2:150832741-150832763 AGTTATCTGCAGAAGTTGATAGG + Intergenic
941536905 2:166734870-166734892 AGTTATCTGCAGATTGTGGTAGG - Intergenic
941668014 2:168261101-168261123 AGTTATCTGCAGAAGATGGCAGG - Intergenic
942321943 2:174743517-174743539 ACTTATCTGCAGATGATGGCAGG - Intergenic
942987905 2:182163965-182163987 AGTTATCTGCAGATGATGCCAGG - Intronic
943006893 2:182395812-182395834 AGTTATCTGGAGAAGATGGCAGG - Intronic
943239222 2:185362601-185362623 AGTTATCTGCAGAAGATGGCAGG + Intergenic
943263575 2:185697222-185697244 AGATATCTGTGGATAATGGCAGG - Intergenic
943273384 2:185836669-185836691 AATTAGCTGCACATGTTGGCAGG + Intergenic
943384066 2:187181119-187181141 AGCTATCTGTGGAAGATGGCAGG + Intergenic
943388126 2:187227107-187227129 AGTTATCTGCAGAAGATGGTAGG - Intergenic
943517601 2:188907271-188907293 AGTTATCTGCAGAAGATGGCAGG + Intergenic
944213130 2:197227060-197227082 TGTTTTCTGCTGAGGATGGCAGG - Intronic
944226126 2:197350259-197350281 AGTTATCTGGGCATGGTGGCGGG + Intergenic
944813172 2:203348090-203348112 AGTTAGCTGGGCATGATGGCGGG + Intronic
945544867 2:211138128-211138150 AGTTATCTGCAGAAGATGGCAGG - Intergenic
945642175 2:212443808-212443830 ACTTATCTGCAGAACATGGCAGG - Intronic
945717838 2:213380698-213380720 AGTTATCTGCAGAAGATGGCAGG + Intronic
945725848 2:213471524-213471546 AGTTATCTGCAGAAGATGGCAGG + Intronic
946527871 2:220539996-220540018 AGTTATCTGCAGAAGATGGCAGG + Intergenic
946703777 2:222437821-222437843 AGTTATCTGCAGAAAATGGTAGG + Intronic
946790918 2:223299731-223299753 AGTTATCTGCAAATGATGGCAGG - Intergenic
947021711 2:225684697-225684719 AATTATCTGGGCATGATGGCAGG - Intergenic
947184322 2:227441613-227441635 AGTCATCTGCAGGTGCTGGCAGG + Intergenic
947440718 2:230118695-230118717 AGTTATCTGCAGAAGATGGCAGG + Intergenic
947440843 2:230120228-230120250 AGTTATCTGCAGAAGATGGCAGG - Intergenic
948956862 2:241299764-241299786 AATTAGCCGCACATGATGGCGGG + Intronic
1170092312 20:12604140-12604162 AGGTATCTGCAGAGGATGACAGG + Intergenic
1170269812 20:14512900-14512922 TGTTATTTGCACATGATGTCAGG - Intronic
1170996605 20:21366399-21366421 AGTTATCTGGGCATGGTGGCAGG + Intronic
1171055346 20:21901187-21901209 TGCTAACTGCAGATGATGCCTGG - Intergenic
1171210666 20:23314551-23314573 GGCTATCTTCAGCTGATGGCTGG + Intergenic
1171436116 20:25125919-25125941 AGTCATCTGAGGAAGATGGCAGG - Intergenic
1172006248 20:31820530-31820552 ATTCACCTGGAGATGATGGCAGG - Exonic
1172248793 20:33464444-33464466 AGTTATCTGGGCATGGTGGCAGG + Intergenic
1174816448 20:53691341-53691363 AATTAGCTGGACATGATGGCAGG + Intergenic
1175378921 20:58549176-58549198 TGTGATCTGCAAATGATGGGAGG - Intergenic
1175391339 20:58629321-58629343 TGTCATCTGCAGAGGCTGGCTGG - Intergenic
1175601530 20:60277877-60277899 AGTTATCTCCAGAGGACTGCTGG - Intergenic
1175625640 20:60486468-60486490 AGCTATCTGCATGTGAGGGCTGG + Intergenic
1176422631 21:6528195-6528217 AGCTTTCTGCAGACCATGGCAGG - Intergenic
1176705070 21:10110462-10110484 AATTATCTGGGCATGATGGCAGG - Intergenic
1176791684 21:13326165-13326187 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1176870521 21:14080129-14080151 GGTTATCTGCAGATAATGGCAGG - Intergenic
1176998157 21:15580155-15580177 AGTTATCTGCAGAAGACGGCAGG - Intergenic
1177139421 21:17342298-17342320 GGTTATCTGCAGGAGACGGCAGG + Intergenic
1177164511 21:17584680-17584702 AGTTAGCTGGACATGGTGGCGGG + Intronic
1177470044 21:21548709-21548731 AGCTATCTTCAGATAATGCCAGG + Intergenic
1177505564 21:22014211-22014233 AGTTATCTGCAGAAGATGGAAGG + Intergenic
1177913172 21:27056181-27056203 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1177933700 21:27316962-27316984 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1177991074 21:28037167-28037189 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1178012657 21:28305146-28305168 AGTTATCAGCAGAAGATGGCAGG - Intergenic
1178060758 21:28851167-28851189 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1178571966 21:33746691-33746713 AATTAGCTGGACATGATGGCAGG + Intronic
1178634463 21:34290168-34290190 AATTACCTTCAGATAATGGCAGG - Intergenic
1178950515 21:36981546-36981568 AATTATCTGGACATGGTGGCGGG - Intronic
1179257279 21:39727689-39727711 AGTCATTTGGAGATGGTGGCTGG + Intergenic
1179415153 21:41192550-41192572 AGTTATCTGAAGAAGATGGCAGG + Intronic
1179698124 21:43136511-43136533 AGCTTTCTGCAGACCATGGCAGG - Intergenic
1180317453 22:11287896-11287918 ACTTATCTGCAGATGCTGAATGG - Intergenic
1180514579 22:16129726-16129748 AATTATCTGGACATGATGGCAGG + Intergenic
1180587041 22:16901929-16901951 AGTTAACTGGAGAAGATGACCGG + Intergenic
1180591150 22:16938396-16938418 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1181367439 22:22388973-22388995 AGCTACCTGCAGAAGATGGCAGG + Intergenic
1181420650 22:22795802-22795824 AGTTATCTGTAGAGGATGGCAGG - Intronic
1181554699 22:23662067-23662089 AGTTATCTGGGCATGATGGCGGG + Intergenic
1181997325 22:26893052-26893074 ATTTAGCTGCAGATGTGGGCAGG - Intergenic
1182391727 22:30002977-30002999 ACTTACCTGTAGATGACGGCAGG - Exonic
1183396299 22:37572820-37572842 AATTATCTGCGCATGGTGGCGGG + Intronic
1183584314 22:38743436-38743458 AATTAGCTGGAGATGGTGGCAGG + Intronic
1184603564 22:45558404-45558426 AGTTATCTGCAGAAGATGGCAGG + Intronic
949125667 3:443175-443197 AGTTATCTGCAGAAGATGGCAGG + Intergenic
949245863 3:1924893-1924915 AGTTATCTGCAGAAGGTGGCGGG - Intergenic
949417595 3:3830912-3830934 AGTTATCTGCAGAAGATGGCAGG + Intronic
949445608 3:4131024-4131046 AGTTATCTGCAGAAGATGGCAGG - Intronic
949638777 3:6012487-6012509 AGTTATCTGCAAAAGATGGCAGG - Intergenic
949905871 3:8858028-8858050 AGTTATCTGCAAATGACAGCAGG - Intronic
950104132 3:10377581-10377603 TGGTAACTGCAGGTGATGGCTGG - Intronic
951003616 3:17592822-17592844 AGTTATCTACAGAAGATGGCAGG - Intronic
951122567 3:18945537-18945559 AGTTATCTGCAGAAGATGGCAGG - Intergenic
951229194 3:20157293-20157315 TGTTAACAGCAGAAGATGGCAGG - Intergenic
951291521 3:20876775-20876797 AGTTATCTGCACAAGACAGCAGG + Intergenic
951384522 3:22027505-22027527 AGTTATCTGCAGAAGATGGCAGG - Intronic
951426328 3:22550240-22550262 AGTTATATGCAGATTATGTGAGG + Intergenic
951571105 3:24064220-24064242 AGTTAACTGCAGAGTGTGGCAGG + Intergenic
951599873 3:24361871-24361893 ACTTATGGGCAGATGATAGCAGG + Intronic
951970766 3:28441895-28441917 AGTTATCTGCAGAAGATGGCAGG + Intronic
952605448 3:35142045-35142067 ATTTATCTGCAGAAGATGGCAGG + Intergenic
952976739 3:38703000-38703022 AGATATGTGCAGATCAAGGCAGG - Intronic
953976896 3:47388811-47388833 AATTAGCTGGACATGATGGCAGG - Intronic
954054115 3:48007647-48007669 AGTTATCTGTAGAAGATGGCAGG - Intronic
954206066 3:49059864-49059886 AGTTAGCTGGATGTGATGGCAGG - Intronic
954243487 3:49312338-49312360 AATTATCTGGACATGGTGGCGGG + Intronic
954363312 3:50133748-50133770 AGTTACCTGCAGATGAGGACTGG - Intergenic
954551360 3:51484322-51484344 AATTATCTGGACATGGTGGCAGG + Intronic
955035581 3:55264062-55264084 AGTTATCTGCAGAGGATGGCAGG - Intergenic
955677016 3:61459375-61459397 ACTTATGTGAAAATGATGGCTGG - Intergenic
956306872 3:67835592-67835614 AGTTATCTGCAGAAGATGGCAGG - Intergenic
956360449 3:68441408-68441430 AGTAATCTGCAGAAGATGGCAGG - Intronic
956384265 3:68700520-68700542 AGTTATCCTAAGGTGATGGCTGG - Intergenic
956509658 3:69980342-69980364 AGTTATCTGCAGAAGATGGCAGG - Intergenic
956703897 3:71982917-71982939 AGTTATCTGCAGAAGATGACAGG + Intergenic
957048127 3:75392272-75392294 AGACATCAGCAGATGCTGGCAGG + Intergenic
957247584 3:77733927-77733949 AGTTATCTGCAGAAGATGGCAGG + Intergenic
957754594 3:84469396-84469418 AGTTATCTGCAGAAGATGGCAGG - Intergenic
958179879 3:90046512-90046534 AGTTATCCACAGAGGATAGCAGG + Intergenic
958487681 3:94732504-94732526 AGTTATCTGCAGAAGATGGCAGG + Intergenic
959174001 3:102881827-102881849 AATAATCTGCAGAGGTTGGCTGG - Intergenic
959203655 3:103279275-103279297 AGTTATCTGCAGAAGATGGCAGG + Intergenic
959377348 3:105602864-105602886 AGTTATCTGCGGAAGATGGTAGG + Intergenic
959439506 3:106359152-106359174 AGTTATCTGCAGAAGACGGCAGG - Intergenic
959746017 3:109777303-109777325 AGTTATCTGCAGAAGATGGCAGG + Intergenic
959997856 3:112698292-112698314 AGTTATCTGCAGAAGATGGAAGG - Intergenic
960349526 3:116575671-116575693 AGTTATCTTCAGAAAATGGCAGG - Intronic
960494749 3:118360810-118360832 AGTTATCTGAAGATGATGGCAGG + Intergenic
960508015 3:118516542-118516564 AATTAGCTGCAAATGATGGCAGG + Intergenic
960510685 3:118545381-118545403 ATCTATATGTAGATGATGGCAGG - Intergenic
961262845 3:125616393-125616415 AGTTATCTGCAGAAGATGGTAGG - Intergenic
961481155 3:127181787-127181809 AATTAGCTGGGGATGATGGCAGG + Intergenic
961787620 3:129357170-129357192 AGTGATGTGCAGAGGCTGGCAGG + Intergenic
961880199 3:130056382-130056404 AGACATCAGCAGATGCTGGCAGG + Intergenic
963418684 3:145031155-145031177 AGTTAATTGGAGATGCTGGCAGG + Intergenic
963630307 3:147723190-147723212 AGTTATCTGCAGAAGATTACAGG - Intergenic
963661389 3:148132115-148132137 AGTTATCTGCAGAAGGTGGCAGG - Intergenic
964297669 3:155251891-155251913 AGTTATCTGCAGATGATGGGAGG - Intergenic
964679249 3:159318944-159318966 AGTTATCTGCAGAAGATGGCAGG + Intronic
965226770 3:166000794-166000816 AGTTATCTGCAGAAGATGGTAGG + Intergenic
965251334 3:166348297-166348319 AGTTATCTGCAGAAGATTCCAGG + Intergenic
965291744 3:166889610-166889632 AGTTATATGCAGAAGATGGCAGG + Intergenic
965708648 3:171534809-171534831 AGTTATCTGCAGAGGATGGCAGG + Intergenic
965729856 3:171760318-171760340 AGTTATCACTAGATGAAGGCAGG - Intronic
965863420 3:173174666-173174688 AGTTATCCGCATAGGAAGGCTGG - Intergenic
965893161 3:173540124-173540146 AGTCATCTGCAGAGGATGGCAGG + Intronic
966044333 3:175530951-175530973 AGTTATCTGCAGAAGATGGCAGG + Intronic
966445690 3:179998529-179998551 AGTTATCTGCAGAAGATGGCAGG - Intronic
966480564 3:180403936-180403958 AGTTATCTGCAGAGGGTGGTAGG - Intergenic
966661310 3:182417979-182418001 AGTTATCTGCAAATGATGGCAGG - Intergenic
966754725 3:183358140-183358162 AATTATCTGGGCATGATGGCGGG + Intronic
967307867 3:188076442-188076464 TGTTCTGTGCAGCTGATGGCTGG + Intergenic
967487332 3:190048346-190048368 AGTTATCTGGGCATGGTGGCAGG + Intronic
968800180 4:2738091-2738113 AGTTAGCTGCAGAAGATGGCAGG - Intergenic
968906942 4:3457937-3457959 AGTTATCTGCGGAAGATGGCAGG - Intergenic
969822765 4:9732893-9732915 AGACATCAGCAGATGCTGGCAGG - Intergenic
970941614 4:21640944-21640966 AGTTATCTGCAGAGAGTGGCAGG - Intronic
970945947 4:21691845-21691867 AGTTAGCTGCGCATGGTGGCGGG - Intronic
971101014 4:23466452-23466474 AGTTATCTGCAGAAGATAGCAGG + Intergenic
971334295 4:25708385-25708407 AGTTAGCTGGGCATGATGGCAGG - Intergenic
971443678 4:26718484-26718506 TTGTATCTTCAGATGATGGCAGG - Intronic
971817226 4:31505045-31505067 AGTTATCTGCAGAAGATGGCAGG - Intergenic
971857654 4:32062863-32062885 AGTTATCTGCAGAAGATGACAGG + Intergenic
971979298 4:33732903-33732925 AGTTACCTGCAGAAGATGGCAGG + Intergenic
972047927 4:34692705-34692727 AGTTATCTGCAGGTGATACCAGG + Intergenic
972095490 4:35342661-35342683 AGTTACTTGCAGAAGACGGCAGG - Intergenic
972201301 4:36717183-36717205 AGTTATCTGTAGAAGATGGCAGG + Intergenic
972805913 4:42529297-42529319 AGTTACCTGCAGATTATGGCAGG - Intronic
972882965 4:43448184-43448206 AGTTATCTGCAGAAGATGGCAGG + Intergenic
972925585 4:44002547-44002569 AGTCAACTGCTGCTGATGGCAGG + Intergenic
973024171 4:45246272-45246294 AGTTATTTGAAGATGATTACTGG - Intergenic
973102922 4:46294720-46294742 AGTTATCTGCAGAAGATGGCAGG - Intronic
973118436 4:46489013-46489035 AGTTATCTGCAGAAGATGGCAGG - Intergenic
973120983 4:46520928-46520950 TGTTATTTGCAGAAGATGGCAGG + Intergenic
973130193 4:46639725-46639747 AGTTATATTCAGAACATGGCAGG + Intergenic
973143678 4:46798576-46798598 AGCTTTCTGCAGATCATGGCAGG - Intronic
974204132 4:58677000-58677022 ATTTAACTTGAGATGATGGCTGG + Intergenic
974262374 4:59542299-59542321 AGTTATCTGCAGAAGATGGTAGG + Intergenic
974289565 4:59912712-59912734 AGTTAACTGTAGAAGATGGCAGG - Intergenic
974564786 4:63568283-63568305 AGTTATCTCCAGAAGATGGCAGG - Intergenic
974644619 4:64674794-64674816 AATTATCTGCAGGAAATGGCAGG + Intergenic
974688523 4:65265560-65265582 AGTAATCTGCTGAGGATGGTGGG - Intergenic
974746917 4:66088935-66088957 AGTTATCTTCAGAAGATGGCAGG + Intergenic
975024465 4:69531602-69531624 AGTTATCTGCAGAAGATGGCAGG - Intergenic
975386719 4:73767539-73767561 AGTTATCTACAGAAGATGGCAGG + Intergenic
975453377 4:74557308-74557330 AGTTAGCTGGACATGGTGGCGGG - Intergenic
976034208 4:80795851-80795873 AGTTATTTGCAGAAGATGGCAGG + Intronic
976104880 4:81605974-81605996 AGAGATCTGGAGAGGATGGCTGG - Intronic
976291565 4:83423760-83423782 AATTAGCTGTATATGATGGCGGG + Intronic
976702360 4:87985181-87985203 ACTCACCTGCAGGTGATGGCTGG + Intergenic
977031619 4:91891377-91891399 AGTTATCTACAGAAGATGGCAGG - Intergenic
977204714 4:94155654-94155676 AGTTATCTGCAGAAGATGACAGG - Intergenic
977270184 4:94908691-94908713 AGGTATCTGCAGCTGAAGACAGG + Intronic
977337380 4:95716128-95716150 AGTTATCTGCGGAGGGTGTCAGG + Intergenic
977430763 4:96928182-96928204 AGGTATCTGCAGAAGATGGCAGG - Intergenic
977465998 4:97383344-97383366 AGTTATCTGCAGAAGATGGCAGG - Intronic
977626279 4:99192684-99192706 AGTTATCTGCAGAAGATGGCAGG + Intergenic
977701734 4:100029917-100029939 AGTTATCTACAGAAGTTGGCAGG + Intergenic
977847096 4:101779251-101779273 AGCAATCTGCAGATGATGTCAGG + Intronic
977930415 4:102743849-102743871 AGTTATCTGCAGAAGATGGCAGG + Intronic
978330173 4:107603925-107603947 ACTCATCAGCAGATGAAGGCTGG - Intronic
978341593 4:107725579-107725601 AGTTATCTGGAGAATATGTCAGG + Intergenic
978772155 4:112467810-112467832 AGTTATCTGCAGAAGATGGCAGG + Intergenic
978818597 4:112937474-112937496 AATTATCTGGAGGTGGTGGCAGG - Intronic
978899080 4:113926848-113926870 TGTTATCTGCAGAAGACGGCAGG + Intronic
978966848 4:114750914-114750936 AATTATCTGCAGAAGATGGCAGG - Intergenic
979404636 4:120294688-120294710 AGCCTTCTGCAGATGATGGAGGG + Intergenic
979456991 4:120937983-120938005 GGTTATCTGCAGCTGAAGGGAGG + Intergenic
979595735 4:122532215-122532237 AGTTCTCTGAAGATGATAGCAGG + Intergenic
979767017 4:124474565-124474587 AGTTATCTGTAGAAGATGGCAGG - Intergenic
980377328 4:131967149-131967171 AATTATCTGGGCATGATGGCAGG - Intergenic
980385790 4:132087061-132087083 AGTTATCTGCAGAAGATGGCAGG + Intergenic
980387950 4:132111211-132111233 AGTTATCTGCAGAATATGGCAGG + Intergenic
980405894 4:132353821-132353843 AGTTATCTGCAGAAGATGGCAGG + Intergenic
980497528 4:133605392-133605414 AGTTATCTACAGAAGATTACAGG + Intergenic
980629520 4:135414256-135414278 AGTTATATGCAGAAGATGGCAGG - Intergenic
980957729 4:139445887-139445909 AGTTATCTGCAGAAGATGTCAGG - Intergenic
981462808 4:145031775-145031797 AGTTATTTGCAAAAGATGGCAGG - Intronic
981873532 4:149515163-149515185 AGTTATCTCCAAAAGATGGCAGG - Intergenic
982354484 4:154451268-154451290 AGTTGTCTGCAGAGAATGGCAGG - Intronic
982597778 4:157407056-157407078 AGTTATCTGCAGAAGATGGCAGG + Intergenic
982608728 4:157546767-157546789 AGTTAGCTGAGCATGATGGCAGG + Intergenic
982623345 4:157732931-157732953 GGTTATCTGCAGAAGATGGCAGG + Intergenic
983027387 4:162755265-162755287 AGTTATCTGCAGAAGATGGCAGG - Intergenic
983185061 4:164691545-164691567 AGTTATCTGCAGAAGATGGCAGG - Intergenic
983231699 4:165135367-165135389 AATTATCTGGCCATGATGGCGGG + Intronic
983339033 4:166434439-166434461 AGTTATCTGCAGAGAATGGAAGG - Intergenic
983582673 4:169324782-169324804 AGTTATCTGCAGAAGATGGCAGG - Intergenic
984060287 4:174982054-174982076 AGTTATCTGCAGAAGATGGCAGG + Intergenic
986087107 5:4462688-4462710 ATTTATCTGCAGAAGATAGCAGG - Intergenic
986573418 5:9188822-9188844 AGTTATCTGGAGGGGATGGGAGG - Intronic
986742916 5:10719476-10719498 AGTTATCTGCAGAAGATGGCAGG - Intronic
986938334 5:12918780-12918802 AGTTACCTGAAGAAGATGGCAGG + Intergenic
986959836 5:13199189-13199211 AGTTAACTGCAGAAGATGGCAGG - Intergenic
987153171 5:15061636-15061658 AGTTATCTGCAGAAGATGGCAGG - Intergenic
987468192 5:18297014-18297036 AGTTATCTGCAGAAGATGGCAGG + Intergenic
987504385 5:18749824-18749846 AGTTAACTACAGAAGATGACAGG - Intergenic
987578345 5:19758341-19758363 AATTATATGCAGAAGATGGCAGG + Intronic
987657141 5:20821681-20821703 AGTTATTTGCAAAAGATGGCAGG + Intergenic
988056571 5:26105297-26105319 AGTTATCTGCAGAAGATGGCAGG + Intergenic
988107755 5:26772517-26772539 AGTTATCTGCAGAAGATGGCAGG - Intergenic
988169205 5:27632867-27632889 AGCGATCTGCAGAAGATGGCAGG + Intergenic
988188771 5:27901207-27901229 GGTTATCTGCAGAAGATGGCAGG - Intergenic
988228766 5:28448097-28448119 ATTTATCTGCAGAAGATGGTAGG - Intergenic
988258173 5:28848511-28848533 AGTTACGTGCAGATAATGACAGG - Intergenic
988562127 5:32290818-32290840 CGTTATCTGCAGAAGATGGCAGG - Intronic
988671683 5:33388503-33388525 AATTATCTGGATATGGTGGCAGG + Intergenic
988766410 5:34382267-34382289 AGTTATCTGCAAAAGATGGCAGG - Intergenic
989045210 5:37267620-37267642 GGTTATCTGAAGAAGATGGTAGG + Intergenic
989097828 5:37797291-37797313 AGTTATCTGCAGAAGATGGCAGG - Intergenic
989307506 5:39974650-39974672 AGCTATCTGAAGAAGATGGCAGG + Intergenic
989457647 5:41661797-41661819 AGTTATCTGCAGAAGATGGCGGG + Intergenic
989486387 5:41996388-41996410 AGTTATCTGCAAAAGATGGCAGG + Intergenic
990061943 5:51661039-51661061 AATTAGCTGCACGTGATGGCAGG + Intergenic
990254636 5:53954288-53954310 AGGTATTTGCAGATGATGGATGG - Intronic
990430485 5:55730144-55730166 AGTTACCTTCAGATGTTGGCTGG - Intronic
990817245 5:59799265-59799287 AGTTAACTGCAGAGAATGACTGG + Intronic
991013809 5:61910929-61910951 AGTTATCTGCAGAAGATAGCAGG + Intergenic
991033542 5:62105893-62105915 AGTTATCTGCAGAAAATGGCAGG - Intergenic
991946143 5:71900111-71900133 AGTTATCTGCAGAAGATGGCAGG - Intergenic
992109883 5:73482906-73482928 AGTTATCTGCAGAAGATGACAGG + Intergenic
992242936 5:74789722-74789744 AGTTATCTGAAGAAGATGGCAGG - Intronic
992242952 5:74789838-74789860 AGTTATCTGCAGAAGATGGCAGG - Intronic
993035841 5:82756391-82756413 AATGATCTGCAGATGATGCAGGG + Intergenic
993203391 5:84847511-84847533 AGTTATCTGCAGAAGACAGCAGG - Intergenic
993231904 5:85247562-85247584 AGTTTTCTGCAAAAGATGGCAGG + Intergenic
993319825 5:86458549-86458571 AGTTATCTGCAGAAGATAGTAGG - Intergenic
993367471 5:87050985-87051007 AGTTATCTGCAGAAGATGGCAGG + Intergenic
993412585 5:87591841-87591863 AGTTATCTGCAGAAGATGGTAGG + Intergenic
993780691 5:92062365-92062387 AGTTATCTGCAGAAGATGGCAGG - Intergenic
993791788 5:92218882-92218904 ATTTATCTGCAGAAGATGGCAGG - Intergenic
993947450 5:94132675-94132697 AATTCTCTGCACATGGTGGCGGG - Intergenic
994291377 5:98032000-98032022 AGTTATCCACAGAAGATGGCAGG + Intergenic
994351126 5:98747568-98747590 AATTAGCTGGACATGATGGCAGG + Intergenic
994539518 5:101076899-101076921 ATTTAATTGCAGATGATGGCAGG - Intergenic
994595958 5:101835208-101835230 AGTTAGCTGGGCATGATGGCAGG + Intergenic
994855438 5:105113613-105113635 AGTTATCTGCAGAAGATGGCAGG + Intergenic
994984423 5:106915762-106915784 AGTTATCTGCAGAAGATGGCAGG + Intergenic
995269560 5:110205495-110205517 AGCTATGTGCAGAAGATGGCAGG + Intergenic
995427736 5:112043755-112043777 AGTTATTTGCAGAAGATGGCAGG + Intergenic
996018556 5:118567827-118567849 AGTTATCTGCAGAAGGTGGCAGG - Intergenic
996164958 5:120212537-120212559 AGTTATCTGCAGAAGATCTCAGG + Intergenic
996392205 5:122973814-122973836 AGTTATCTGCAGATGATGGCAGG + Intronic
996825560 5:127677806-127677828 AATTATCTGCAGAAGATGGCAGG - Intergenic
996912226 5:128668945-128668967 AATTATCTGTGGGTGATGGCAGG - Intronic
997001363 5:129766069-129766091 AGGTATCTGCAGACAATGGAAGG - Exonic
997511433 5:134457522-134457544 AGTTAGCTGGGCATGATGGCGGG + Intergenic
997702830 5:135916363-135916385 AGTTATATGCTGAAGATGGTTGG + Intergenic
998290339 5:140908580-140908602 AGTTAGCTGCAGAAGATGGAAGG + Intronic
999145574 5:149391113-149391135 AATTAGCTGGGGATGATGGCAGG - Intronic
999644003 5:153700234-153700256 AATTAGCTGCACATGGTGGCGGG + Intronic
1000089637 5:157919147-157919169 AATTAGCTGCAGCTGGTGGCAGG - Intergenic
1000223249 5:159234277-159234299 AGGTATCTGCAGAAGATGGCAGG + Intergenic
1000349321 5:160340860-160340882 AATTATCTGGACATGGTGGCAGG + Intronic
1000416970 5:160993873-160993895 AGTTATCTACAGAAGATGGCAGG - Intergenic
1000621622 5:163492964-163492986 AGTTATCTGCATAGGATAACAGG + Intergenic
1001173592 5:169444614-169444636 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1001827423 5:174756748-174756770 AATTATCTGGACATGGTGGCGGG - Intergenic
1002997963 6:2304718-2304740 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1003469924 6:6420103-6420125 AGTTACCTGCAGATGGTGGAAGG + Intergenic
1003695901 6:8406168-8406190 AGTCATCTGCAGAAGATGGCAGG + Intergenic
1003791217 6:9549963-9549985 AGTTATCTTCAGAAGATGGTAGG - Intergenic
1005185165 6:23157044-23157066 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1005562054 6:27050377-27050399 AGTTTTCAGCAGATGAGGGATGG - Intergenic
1005977608 6:30812143-30812165 AGTGCTCTCCAGTTGATGGCTGG + Intergenic
1006001553 6:30969047-30969069 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1006062349 6:31433194-31433216 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1007844655 6:44743160-44743182 ATTTATATGAAGATGATTGCAGG - Intergenic
1008079360 6:47178414-47178436 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1008266925 6:49439317-49439339 AGTTATCTGCAGAAGATGGCAGG + Intronic
1008400289 6:51055443-51055465 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1008820395 6:55625124-55625146 AGTTATCTGCAGAAGACGGCTGG - Intergenic
1008868032 6:56238657-56238679 AGGTATCTGCTGAAGGTGGCAGG - Intronic
1009308634 6:62122274-62122296 GGTTATCTGCAGAAGATGGCAGG - Intronic
1009390114 6:63135106-63135128 AGTTATCTGCAGAAGATGACAGG + Intergenic
1009747257 6:67833255-67833277 AATTATCTGGACATGGTGGCAGG - Intergenic
1009806492 6:68606924-68606946 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1009851928 6:69208986-69209008 AGTTATCTGCAGAAGATGGCAGG + Intronic
1010108012 6:72190934-72190956 AGTTATCTGCAGAAGACAGCAGG + Intronic
1010818629 6:80388372-80388394 AGTTATCTGCAGATAATGGCAGG - Intergenic
1011039347 6:83013302-83013324 AGTTATCTGCAGAAGATGGCAGG + Intronic
1011069098 6:83361637-83361659 ATTTATCTGCAGAAGATGGCAGG - Intronic
1012108574 6:95197765-95197787 AGTTATCTGCAGAAGGTGGGAGG + Intergenic
1012344585 6:98170291-98170313 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1012730458 6:102874291-102874313 AGTTATCTGTAGAAGATGGCAGG - Intergenic
1012820800 6:104082890-104082912 AGTTATCTGCAGAAGATGGCCGG - Intergenic
1012920797 6:105219573-105219595 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1012964129 6:105655322-105655344 AGTTATCCATAGAAGATGGCAGG - Intergenic
1013215486 6:108023686-108023708 AGTTTGCTGAGGATGATGGCAGG - Intergenic
1013406668 6:109849774-109849796 AGTTATCTGTAGAAGATGGCAGG - Intergenic
1013466630 6:110423090-110423112 AATTAGCTGGACATGATGGCAGG + Intergenic
1014363402 6:120508382-120508404 AGTTATCTGAAAAAGATGGCAGG + Intergenic
1014416983 6:121195361-121195383 GGTTATCTGCAGAAGATGGTAGG - Intronic
1014534200 6:122596658-122596680 AGTTATCTGCAGAAGATGGCAGG + Intronic
1014538833 6:122649790-122649812 AGCTGTCTTCAGAAGATGGCAGG + Intronic
1014631638 6:123796773-123796795 AGTTGTCTGCAGAAGATGGCAGG - Intergenic
1014763108 6:125379699-125379721 ATTCATCTACACATGATGGCAGG + Intergenic
1014857560 6:126420589-126420611 AATTATCTGCAGATATTTGCTGG + Intergenic
1014895649 6:126896546-126896568 AGTTATTTGGGGATGATGGTAGG - Intergenic
1015029139 6:128573053-128573075 AGTTAGCTGCGCATGGTGGCAGG - Intergenic
1015095453 6:129409629-129409651 AGTGATCTGCAGAAGATGGCAGG + Intronic
1015443289 6:133272593-133272615 AGTTATCTGTAGAAGATGGTTGG + Intronic
1015466851 6:133557745-133557767 AGTTATCAGCAGAAGACGGCAGG + Intergenic
1015475746 6:133657463-133657485 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1015862089 6:137691813-137691835 AGTTATCTGTGGATGATGGCAGG - Intergenic
1016144287 6:140649374-140649396 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1016576261 6:145572615-145572637 AGTTATCTGCAGAAAACGGCAGG + Intronic
1017154197 6:151308359-151308381 AGTTAGCTGGGCATGATGGCAGG - Intronic
1017227809 6:152041120-152041142 AGTTATCTGCAGGAGATGCAGGG + Intronic
1017443152 6:154483254-154483276 AAATGTCTGCATATGATGGCTGG - Intronic
1017977121 6:159368085-159368107 AGTTATCTGCAGAAGATGGCTGG + Intergenic
1018535035 6:164810522-164810544 GGTTATATACAGAAGATGGCAGG + Intergenic
1018599881 6:165527498-165527520 AGTTATCTGGTGGAGATGGCAGG - Intronic
1018732881 6:166666093-166666115 ATTGATCCGCAAATGATGGCAGG + Intronic
1018803795 6:167243019-167243041 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1019677499 7:2323179-2323201 AATTAGCTGGACATGATGGCAGG + Intronic
1019787890 7:2990407-2990429 TGTTTTCTGCAAATAATGGCAGG - Intronic
1020315236 7:6901085-6901107 AGACATCAGCAGATGCTGGCAGG + Intergenic
1020710346 7:11597597-11597619 AGTTATCTGCAGAAGATGGCAGG - Intronic
1021180874 7:17504358-17504380 AATTATCTGGGCATGATGGCAGG - Intergenic
1021893515 7:25211470-25211492 AGTTAGCTGGACATGGTGGCTGG + Intergenic
1022539575 7:31123440-31123462 AATTGTCTGCAGAAGAGGGCAGG - Intergenic
1023505339 7:40893910-40893932 AATTAGCTGCACATGGTGGCAGG + Intergenic
1023581892 7:41692412-41692434 AGTTCTCTGCAGCAGAAGGCAGG + Intronic
1024040534 7:45550116-45550138 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1024058916 7:45683832-45683854 AGTTACCTGCAAAAGATGGCAGG + Intronic
1024159164 7:46656756-46656778 AGTTTTCTGCAGATGACGATAGG + Intergenic
1024799696 7:53061855-53061877 ACTTGTCTGCAGATTATGTCAGG + Intergenic
1024866099 7:53906315-53906337 AGTTATCTGAAAAAGGTGGCAGG - Intergenic
1024884345 7:54124683-54124705 AGCTATCTAAAGAAGATGGCAGG + Intergenic
1026046492 7:66909127-66909149 AGTTATATGCAGAAGATGGCAGG + Intergenic
1026771234 7:73201149-73201171 AGTTAGCTGGGCATGATGGCGGG + Intergenic
1027012102 7:74754546-74754568 AGTTAGCTGGGCATGATGGCGGG + Intronic
1027075939 7:75191508-75191530 AGTTAGCTGGGCATGATGGCGGG - Intergenic
1027685793 7:81277926-81277948 AGTTATCTGCAGAAAATGGCAGG - Intergenic
1028043857 7:86091437-86091459 AGTTATCTGCAGAAAAGGGCTGG - Intergenic
1028141732 7:87281955-87281977 AGTTATCTTCAGAAGATGGCAGG - Intergenic
1028216433 7:88139267-88139289 AATTAGCTGGATATGATGGCAGG + Intronic
1028582682 7:92423539-92423561 AGTCATCTGGAGAGGAAGGCTGG - Intergenic
1028725464 7:94082267-94082289 AGTTATCTGCACTTCCTGGCTGG - Intergenic
1028935010 7:96455034-96455056 AATTATCTGCAGAAGATGGCAGG - Intergenic
1030277455 7:107736085-107736107 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1030351080 7:108488428-108488450 AATTAGCTGGACATGATGGCAGG + Intronic
1030368750 7:108673998-108674020 AGTTTTCTGCAGAAGATGGCAGG - Intergenic
1030479471 7:110084029-110084051 AGTTTTCTGCAAAGGATGCCAGG - Intergenic
1030931292 7:115525712-115525734 AGTTATCTGCGGAAGATGGCAGG + Intergenic
1030968743 7:116027126-116027148 AGTTCTCTGCAGACATTGGCAGG + Intronic
1031236824 7:119187986-119188008 AGTTATCTGCAGAAGATGACAGG - Intergenic
1031676555 7:124618320-124618342 AGTTATCTGCAGAAAATGGCAGG - Intergenic
1031761416 7:125717088-125717110 AGTTATCTGAAAATAATGGTAGG - Intergenic
1032153107 7:129446987-129447009 AGTTATCTGCAGAAGATGGCAGG + Intronic
1032256509 7:130301556-130301578 AGTTGTCTGCAGATGAATGAAGG - Intronic
1032827910 7:135590258-135590280 AGTTAGCTGGGCATGATGGCGGG - Intronic
1034864492 7:154629371-154629393 AGTTATCTGCATGAGATGTCAGG - Intronic
1036527350 8:9547549-9547571 AGTTATCCACAGAGGATGGCAGG + Intergenic
1037364596 8:18108298-18108320 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1038302047 8:26361089-26361111 ATTTATCTGCAGATGATTTGCGG + Exonic
1038538488 8:28371898-28371920 AGTTACCTGGACATGATGGTGGG + Intronic
1039292313 8:36109912-36109934 AGTTATCTACAGAGGATAGCAGG + Intergenic
1039324174 8:36466555-36466577 AGTTATCTACAGAAGATGTGAGG + Intergenic
1039874050 8:41570416-41570438 AATTAGCTGGACATGATGGCAGG + Intergenic
1040030987 8:42823460-42823482 ATTTATCTGTGGATGATGGCAGG + Intergenic
1040911943 8:52528388-52528410 TGTTATCTGCAGAAGATGGCAGG - Intergenic
1041121125 8:54587275-54587297 AGTTAGCTGGACATGATGGTGGG + Intergenic
1041172227 8:55155815-55155837 TGTTATCTGCTGTTGATGCCAGG - Intronic
1041623729 8:60001252-60001274 ACATACCTGCAGATGGTGGCTGG - Intergenic
1041709413 8:60879746-60879768 AATTAGCTGGACATGATGGCAGG - Intergenic
1041934551 8:63321300-63321322 AGTTATCTGCAGAAGATGACAGG - Intergenic
1042001067 8:64124026-64124048 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1042085615 8:65105668-65105690 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1043232520 8:77820933-77820955 ACTCATCTGCAGGTGATGGCAGG + Intergenic
1043259973 8:78184223-78184245 AGCTATCTGCAGAAGATGACAGG + Intergenic
1043878263 8:85510839-85510861 AGTTAGCTGGGCATGATGGCAGG + Intergenic
1044150798 8:88773045-88773067 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1044285975 8:90412476-90412498 AGTTATCTGCAGAAGATGGTAGG + Intergenic
1044565987 8:93661671-93661693 AGTTATCTGGGCATGGTGGCAGG + Intergenic
1045221835 8:100207037-100207059 AGTTATCTGCAGAAGATGGCAGG - Intronic
1046063987 8:109175192-109175214 GGTTATCTGCAGAAGATGGCAGG + Intergenic
1046128677 8:109941632-109941654 AGTTATCTGAAGAAGATTGTGGG + Intergenic
1046197552 8:110884193-110884215 CGTTATCTGCAGAAGAGGGCAGG - Intergenic
1046417642 8:113937824-113937846 AGTTGTCTGAAGAAGATGGCAGG + Intergenic
1046436524 8:114196507-114196529 AGTTATTTGCAGAAGATGCTAGG + Intergenic
1046585788 8:116147749-116147771 AGTTATTTGCAGAAGATGGCAGG + Intergenic
1047453625 8:124989283-124989305 AGTTATCTGTGGATGATAGCAGG - Intergenic
1050482671 9:6102573-6102595 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1050573534 9:6967606-6967628 TGTTATCTGGAGATCATGACAGG + Intronic
1050808464 9:9714718-9714740 AGTTCTCTGCTGATGGTGGGAGG + Intronic
1050888738 9:10796784-10796806 AGTTATCTGCAGAAGATGGTAGG + Intergenic
1050970754 9:11869676-11869698 AGTTAACTGCAGTTTATGGCAGG - Intergenic
1051882143 9:21850632-21850654 AGTTATCTGCAGAAGATGGCAGG - Intronic
1051966460 9:22834547-22834569 AGTTACCTGCAGAAGATGGCAGG - Intergenic
1052178190 9:25490714-25490736 AATTAGCTGGGGATGATGGCAGG - Intergenic
1052442272 9:28512312-28512334 AGTTATCTGCAGAAGATGACAGG + Intronic
1052591584 9:30503399-30503421 AGTTATCTGGGCATGGTGGCAGG + Intergenic
1052965876 9:34340342-34340364 ATTCATCTGCAGATTGTGGCAGG + Intronic
1053143071 9:35693461-35693483 AGTTATCTGGGCATGGTGGCGGG - Intergenic
1053610815 9:39711399-39711421 AGTTATTCACAGAAGATGGCAGG - Intergenic
1053614481 9:39749393-39749415 AGTTATCTGGTGATGCTGGTGGG + Intergenic
1053642324 9:40097524-40097546 AATTATCTGGGCATGATGGCAGG - Intergenic
1053695960 9:40639533-40639555 AGTTAACTGGAGAAGATGACCGG + Intergenic
1053763814 9:41367941-41367963 AATTATCTGGGCATGATGGCAGG + Intergenic
1053868851 9:42469421-42469443 AGTTATTCGCAGAAGATGGCAGG - Intergenic
1053872514 9:42507331-42507353 AGTTATCTGGTGATGCTGGTGGG + Intergenic
1054087439 9:60759759-60759781 AGTTATTCGCAGAAGATGGCAGG + Intergenic
1054239037 9:62592999-62593021 AGTTATCTGGTGATGCTGGTGGG - Intergenic
1054242707 9:62630996-62631018 AGTTATTCACAGAAGATGGCAGG + Intergenic
1054261397 9:62869011-62869033 AGTTATCTGGTGATGCTGGTGGG + Intergenic
1054307207 9:63438751-63438773 AGTTAACTGGAGAAGATGACCGG + Intergenic
1054323214 9:63694916-63694938 AATTATCTGGGCATGATGGCAGG - Intergenic
1054405940 9:64762743-64762765 AGTTAACTGGAGAAGATGACCGG + Intergenic
1054439566 9:65248230-65248252 AGTTAACTGGAGAAGATGACCGG + Intergenic
1054490841 9:65773709-65773731 AGTTAACTGGAGAAGATGACCGG - Intergenic
1054542429 9:66279120-66279142 AATTATCTGGGCATGATGGCAGG + Intergenic
1054553166 9:66627521-66627543 AGTTATCTGGTGATGCTGGTGGG - Intergenic
1055240831 9:74183700-74183722 AGTTCTCAGCAGAAGAGGGCAGG - Intergenic
1055328566 9:75158316-75158338 AATTAGCTGGACATGATGGCAGG + Intergenic
1055507003 9:76958251-76958273 TGTACTCTGCAGATGATGGTAGG + Intergenic
1055775107 9:79759540-79759562 AGTTATCACCAGATCATGACAGG + Intergenic
1055903944 9:81271234-81271256 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1056106519 9:83352600-83352622 TGTCATCTTCAGATGATGGAAGG - Intronic
1056156662 9:83845179-83845201 AGTTAGCTGCAGAAGATGGCGGG - Intronic
1056241169 9:84647895-84647917 AGTTATCAGCAGATTATGGTAGG + Intergenic
1056314237 9:85372975-85372997 AATTATCTGCTGAAGATGGCAGG + Intergenic
1056353876 9:85778348-85778370 AGTTATCTGCAGAAGATGGCGGG + Intergenic
1056455953 9:86760372-86760394 AGTTGACCGCAGTTGATGGCAGG + Intergenic
1056877188 9:90345183-90345205 AATTAGCTGCACATGGTGGCGGG - Intergenic
1057004945 9:91548846-91548868 AATTATCTGCAGAGGATGAGAGG + Intergenic
1057791257 9:98126678-98126700 AGCTGGCTGCAGAAGATGGCTGG - Exonic
1058007038 9:99927621-99927643 AATTATCTGGGCATGATGGCAGG - Intronic
1058019893 9:100076050-100076072 AGTTATCTGCAGAAGATGGCAGG - Intronic
1058239796 9:102542463-102542485 AGTTATTTACAGATGATGTCAGG - Intergenic
1058259260 9:102809698-102809720 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1058544169 9:106042782-106042804 TTATATCTGCAGAAGATGGCAGG + Intergenic
1059196508 9:112375898-112375920 AGTTATCTGCAGAAGAAGGCAGG + Intergenic
1062135467 9:134924993-134925015 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1062507063 9:136883017-136883039 AATTAACTGAACATGATGGCAGG - Intronic
1062617878 9:137406376-137406398 AGTTATCTGGAGCTGAGAGCTGG + Intronic
1202778407 9_KI270717v1_random:13146-13168 AGTTAACTGGAGAAGATGACCGG + Intergenic
1202790102 9_KI270719v1_random:80561-80583 AATTATCTGGGCATGATGGCAGG - Intergenic
1203452643 Un_GL000219v1:134434-134456 TGTTCTCTGCAGATATTGGCTGG + Intergenic
1185599691 X:1330308-1330330 ATTTAGCTGGACATGATGGCAGG + Intergenic
1186279492 X:7977088-7977110 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1186384097 X:9091792-9091814 AGTTATCTGCAGAAGATGGCAGG + Intronic
1186469770 X:9812139-9812161 AGTTGTCTGCAGAAGATGGCAGG + Intronic
1186479762 X:9887724-9887746 AGTTATCTGCACATGATAGAAGG + Intronic
1187604862 X:20871832-20871854 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1189154887 X:38746752-38746774 AGTTATTTGCAGAAGATGGCAGG + Intergenic
1190255269 X:48757773-48757795 AGTTATCTGCAGAGAATAGCAGG - Intergenic
1190527882 X:51346279-51346301 AGTTATATGCAGAGCATGGCAGG + Intergenic
1190601542 X:52097865-52097887 AATTATCTGAGGATAATGGCAGG + Intergenic
1190730494 X:53222640-53222662 AGTAGTCTGGAGATGAAGGCAGG - Intronic
1190849182 X:54222006-54222028 AATTAGCTGCACGTGATGGCAGG + Intronic
1190996751 X:55617499-55617521 AGTTATCTACAGAAGATGGCAGG + Intergenic
1191095709 X:56671205-56671227 AGTTATCTGTGGAAGATAGCAGG + Intergenic
1191189786 X:57654760-57654782 AATTATCTGCAGATCCTGCCAGG + Intergenic
1191607366 X:63077503-63077525 AATTAACTACAGATGATGCCAGG + Intergenic
1191630040 X:63312619-63312641 AGTTATCTGAAGAAGTTGACAGG + Intergenic
1191631292 X:63324848-63324870 ATTTATCTTCAGATAATGACAGG - Intergenic
1191658808 X:63629837-63629859 AGTTATCTGCTGAAGATGGCAGG + Intergenic
1191719244 X:64215740-64215762 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1191759358 X:64629893-64629915 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1191769500 X:64740129-64740151 AGTTATTTGCAGAAGAAGGCAGG + Intergenic
1191932924 X:66394130-66394152 AGTTATCTGCAGAAGACAGCAGG - Intergenic
1191941263 X:66483896-66483918 AGTTATCTGCAGAAGATGACAGG + Intergenic
1192297714 X:69868047-69868069 AGTTATCTGCAGAAGATGGCAGG + Intronic
1192531689 X:71893168-71893190 AGTTATCTGCAGAGGATGGTAGG + Intergenic
1192673256 X:73168448-73168470 GGTTACCTGCAGAAGATGGCAGG + Intergenic
1192793572 X:74408069-74408091 AATTATCTGGGCATGATGGCGGG - Intergenic
1192898700 X:75471878-75471900 AGTTATCTGCAGAAGATGGCAGG - Intronic
1192996189 X:76515546-76515568 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1193053487 X:77125736-77125758 AGTTTTCTGCAGAAGATGGCAGG - Intergenic
1193297777 X:79852642-79852664 AGTTATGTGCAGATGATGGCAGG - Intergenic
1193356253 X:80523093-80523115 AGTTATCTGCAGAAGACAGTAGG - Intergenic
1193447152 X:81618739-81618761 AGTTATCTGCAGGAGATGGCAGG - Intergenic
1193832946 X:86310065-86310087 AGTTATCTGCAGAAGATGACAGG - Intronic
1193904483 X:87225799-87225821 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1193957280 X:87878178-87878200 AGTTATCTGCAGAAGGTGGCAGG - Intergenic
1194179594 X:90695967-90695989 AGTTATCTGAAGAAGATGGCAGG + Intergenic
1194210275 X:91062322-91062344 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1194443546 X:93961071-93961093 AGTTATCTGCAGAAGATGGAAGG - Intergenic
1194513420 X:94822284-94822306 AGTTATCTGCAGAAGATGACAGG + Intergenic
1194521079 X:94919407-94919429 AGTTATCTGCAAAAGATGACAGG - Intergenic
1194649419 X:96497840-96497862 AGTTATCTGTAGATAATGGCAGG - Intergenic
1194833955 X:98658772-98658794 AGTTATCTGCAGAAGGTCCCAGG - Intergenic
1194849249 X:98852206-98852228 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1194870718 X:99127835-99127857 AGTTATCTGTGGATTACGGCAGG - Intergenic
1195782357 X:108479897-108479919 AGTTTTTTGCAGAGGATGGCAGG + Intronic
1196135972 X:112209875-112209897 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1196610745 X:117711909-117711931 AGTTATCAGCAAATTCTGGCAGG - Intergenic
1196723101 X:118873118-118873140 AGTTGCTTCCAGATGATGGCTGG - Intergenic
1196960344 X:120993725-120993747 AGTACTCTGCAGATACTGGCTGG + Intergenic
1197002284 X:121452889-121452911 AGTTATCTGCAGAAGATGACAGG - Intergenic
1197044411 X:121978294-121978316 AGTTACCTGCAGAATATGGCAGG - Intergenic
1197097464 X:122612806-122612828 AGTTATCTGCAGAAGATGGTAGG - Intergenic
1197245049 X:124159026-124159048 AGTTATCTGCAGAAGATGGCAGG + Intronic
1197372060 X:125637898-125637920 AGTTACCTGCAGAAGATGGCAGG + Intergenic
1197380003 X:125727937-125727959 AGTTTTCTGCAGAAGATGGCAGG + Intergenic
1197386776 X:125812275-125812297 AGATATCTGCAGTAGATTGCAGG + Intergenic
1197409326 X:126096447-126096469 AGTTATATGCAGAAGATGGCAGG + Intergenic
1197477361 X:126941361-126941383 AGTTATCTGCATAAGATGACAGG + Intergenic
1197521993 X:127510339-127510361 AGTTATCTGTAGATGGTGGCAGG - Intergenic
1197591864 X:128419355-128419377 AGTTATCTGCAGAAGATGACTGG - Intergenic
1198169999 X:134096222-134096244 AGTTATCTGTGGAGGATGGCAGG - Intergenic
1198701296 X:139400264-139400286 AGTTATCTGCAGAAAATGGAAGG - Intergenic
1198741516 X:139848063-139848085 AGATTTCATCAGATGATGGCAGG - Intronic
1198934038 X:141887847-141887869 TGTTATCTGCAGAAGATTGAAGG - Intronic
1199008504 X:142730855-142730877 AGTTATCTCCAGAGGATGGCAGG - Intergenic
1199024376 X:142919687-142919709 ACTTATCTGCAGAAGATGGCAGG - Intergenic
1199040588 X:143111068-143111090 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1199144445 X:144348997-144349019 AGGTATCTGAAGAAGATAGCAGG + Intergenic
1199580347 X:149354143-149354165 AGTTACCTGTGAATGATGGCAGG - Intergenic
1200340497 X:155390672-155390694 AGTTATCTGCAGAAGATGACAGG + Intergenic
1200501688 Y:3957896-3957918 AGTCATCTTCAGAGGATGACAGG + Intergenic
1200521268 Y:4211998-4212020 AGTTATCTGCAGAAGATTTCAGG - Intergenic
1200526256 Y:4278136-4278158 AGTTATCTGAAGAAGATGGCAGG + Intergenic
1200709922 Y:6474113-6474135 AGGTGTCTGCAAAAGATGGCTGG + Intergenic
1200746061 Y:6904904-6904926 AGTTACCCACAGAAGATGGCAGG + Intergenic
1200973127 Y:9177742-9177764 ATTTATCTACAGAAGATGGCAGG + Intergenic
1201024193 Y:9690595-9690617 AGGTGTCTGCAAAAGATGGCTGG - Intergenic
1201193721 Y:11471449-11471471 AGTTAACTGGAGAAGATGACAGG + Intergenic
1201303816 Y:12533788-12533810 GGTTATCTGCACATTATGGAAGG + Intergenic
1201732638 Y:17221499-17221521 AATTAGCTGCACATGGTGGCGGG - Intergenic
1201765801 Y:17572653-17572675 GGTTATCTGCAGATAATGGCAGG - Intergenic
1201796633 Y:17903443-17903465 AGTTATCTGCAGAAAATGGCAGG + Intergenic
1201798423 Y:17926667-17926689 GGTTATCTGCAGAAGATGGCAGG - Intergenic
1201803130 Y:17979290-17979312 GGTTATCTGCAGAAGATGGCAGG + Intergenic
1201804922 Y:18002542-18002564 AGTTATCTGCAGAAAATGGCAGG - Intergenic
1201835751 Y:18333336-18333358 GGTTATCTGCAGATAATGGCAGG + Intergenic
1202137951 Y:21686771-21686793 ATTTGTCTACAGAAGATGGCAGG - Intergenic
1202177213 Y:22108819-22108841 AGTTGTCAGCAAAAGATGGCCGG + Intergenic
1202214148 Y:22477565-22477587 AGTTGTCAGCAAAAGATGGCCGG - Intergenic
1202358017 Y:24072505-24072527 AGTTATCTGCAGAAAATGGCAGG + Intergenic
1202359743 Y:24095357-24095379 GGTTATCTGCAGAAGATGGCAGG - Intergenic
1202511035 Y:25574757-25574779 GGTTATCTGCAGAAGATGGCAGG + Intergenic
1202512761 Y:25597608-25597630 AGTTATCTGCAGAAAATGGCAGG - Intergenic