ID: 996393241

View in Genome Browser
Species Human (GRCh38)
Location 5:122986480-122986502
Sequence CAGAAAAAAGAGAAGTGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1387
Summary {0: 1, 1: 0, 2: 11, 3: 93, 4: 1282}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996393241 Original CRISPR CAGAAAAAAGAGAAGTGGGA GGG Intronic
900274342 1:1814090-1814112 CAGAAAGAATAAAAGTGGGAAGG - Intronic
900424972 1:2573194-2573216 CACACAAAAGAGAAATGGGCTGG + Intergenic
900731614 1:4265617-4265639 CCGAAAAAAAAGAAGGGGGTTGG - Intergenic
901125616 1:6926398-6926420 AAGAAAAGAGAGAGGAGGGAGGG - Intronic
901464286 1:9411326-9411348 AAGAAAAGAGAGAGGTGGGCAGG - Intergenic
902200677 1:14831153-14831175 CAAAAACAAGAGAATTGGGCAGG - Intronic
902233557 1:15043622-15043644 AAAAAAAAAAAGAAGTGGGGAGG - Intronic
902412847 1:16221541-16221563 CAGATAAAAGTCTAGTGGGATGG + Intergenic
902648043 1:17817677-17817699 AAGAAAAAAGAAAAGTGGTTGGG - Intronic
903425075 1:23247365-23247387 AAGAAAAAAGAAAAATGGGCTGG + Intergenic
903649792 1:24915675-24915697 TAGAAAAAAGAGCAGTGCAAAGG + Intronic
903873089 1:26451360-26451382 AAGAAAAATGAGGAGTTGGATGG - Intronic
903955399 1:27022008-27022030 CAGAAGGAAGATAAGGGGGAGGG + Intergenic
904076525 1:27847005-27847027 CTGCAAAAAGAGAAGAGGGCAGG - Intronic
904308906 1:29612559-29612581 AAGAAGAAAGAGAAGGTGGAAGG - Intergenic
905128277 1:35731568-35731590 AAGCAAAAACAGAAGTGGGGGGG + Intronic
905322895 1:37130316-37130338 GAGAAATGAGAGAAGTGTGAGGG - Intergenic
905374777 1:37512893-37512915 TAGAAAAAAGAAAAGTGGCCAGG + Intronic
905806158 1:40879102-40879124 AAGAAAAAAGAAAAGAAGGAGGG + Intergenic
906504290 1:46366548-46366570 CTAAAAAAAGAGAAGGGGGTTGG + Intergenic
906949589 1:50323504-50323526 CAGCAAGAAATGAAGTGGGAGGG - Intergenic
907466093 1:54638147-54638169 CAGAAAAAATAGATTTGGGCTGG + Exonic
907744879 1:57203268-57203290 AAGAAAAATGACAAGTGAGAGGG - Intronic
907786974 1:57622026-57622048 AAGAAACAGGAGAGGTGGGAGGG + Intronic
908203501 1:61821508-61821530 CAGACAAATGTGAAGTGGCAAGG - Intronic
908276967 1:62483371-62483393 CAGAAAAAAAATCAGTGGTATGG + Intronic
908295972 1:62713443-62713465 AAGAAGAAAGAGAAGGTGGAAGG - Intergenic
908556065 1:65257241-65257263 AAGAAAAGAGAGGTGTGGGATGG - Intronic
908930760 1:69313949-69313971 CAGAAGAAAGAGAAAGGAGAAGG + Intergenic
909286840 1:73830275-73830297 CAGAAAAAGGAGAGAGGGGAAGG + Intergenic
909971094 1:81990783-81990805 CAGAAGAAAGTGAAGTCCGAGGG + Exonic
909995895 1:82278893-82278915 CAGAAAAGAGAGTGGAGGGATGG - Intergenic
910159883 1:84261291-84261313 GAAAACAAAGAGCAGTGGGAAGG - Intergenic
910321960 1:85956056-85956078 CAGAAAAGAGAGACTTGGAACGG + Intronic
910455691 1:87395186-87395208 CAGGAAAAGCAGCAGTGGGAGGG + Intergenic
910646712 1:89522997-89523019 GAAAAAAAAGGGAAATGGGAAGG - Intergenic
910687085 1:89928461-89928483 AAGAAAAAAGAAAAATGGGCTGG + Intronic
910734732 1:90441009-90441031 AAGAAAAGGGAGAAGAGGGAAGG - Intergenic
910988192 1:93027003-93027025 TAAAAAAAAAAAAAGTGGGAGGG + Intergenic
911198358 1:95018557-95018579 AAGAAAAAAGAAAAAAGGGACGG + Intronic
911479163 1:98415266-98415288 CAGAAAAAAGAGAATTCCAAGGG - Intergenic
911479184 1:98415624-98415646 CAGAAAAAAGAGAATTCCAAGGG + Intergenic
911733049 1:101309707-101309729 AAGAACAAAGGGAAGTCGGAAGG - Intergenic
911785469 1:101941106-101941128 CAGAAAAGTGCGAAGTGTGATGG + Intronic
912009819 1:104946383-104946405 AAGAAAAAAGAAAAATGGGCTGG + Intergenic
912174440 1:107139968-107139990 CAGAAGAGAGAGGGGTGGGATGG + Intergenic
912323056 1:108732722-108732744 AAGAAAAAAGAGAAAAGAGAGGG - Intronic
912510001 1:110182922-110182944 CAGAGAAATGAGAAATGGGATGG + Intronic
912587657 1:110781209-110781231 GAGGAAAAAGAGAAGTGTGCAGG + Intergenic
912880604 1:113409212-113409234 AAGGAAAAAGAGAAATGGAATGG + Intronic
912902049 1:113661724-113661746 CAGAGAAAAGAGAAGGGTGGAGG + Intronic
913233948 1:116764458-116764480 CAAAAGGAAGAGAAGTGGGATGG - Intronic
913240502 1:116825835-116825857 CACAAAGAAGAGGAGGGGGACGG + Intergenic
913423500 1:118699940-118699962 GAGGAAAAAGAGGAGTAGGAGGG - Intergenic
913551078 1:119917313-119917335 CAGAAAAAAAAGCAGCCGGAGGG + Intronic
913710997 1:121483270-121483292 AAGAAAAAAAAGAGGGGGGAGGG + Intergenic
914430252 1:147614104-147614126 CTGAAATAAGAGAAGTTAGAGGG + Intronic
914682303 1:149947175-149947197 CAGAACAAGGAGATCTGGGATGG - Intronic
914690902 1:150025855-150025877 CTGAAAAAAGAGATGTGGTCAGG + Intergenic
914733990 1:150398542-150398564 CAGAAAAAAGGGAAAGGGAAAGG - Intronic
914803665 1:150977301-150977323 GAGACAAAAGAGAAGGTGGATGG + Intergenic
914861147 1:151387195-151387217 CACAAAAAATGGAATTGGGAAGG + Intergenic
915221316 1:154376957-154376979 AAGAGAAAAGAGCAGTGGGCTGG - Intergenic
915620813 1:157082856-157082878 TAGGAAAGAGAGAATTGGGAAGG + Intergenic
916191336 1:162181145-162181167 CAGACAAAAGAGGACTGGGCAGG + Intronic
916362614 1:163987957-163987979 CAGAAAAAAGAAAAGAGGGATGG + Intergenic
916492542 1:165314641-165314663 CTAAAAAAAGAGAAAAGGGATGG - Intronic
916684056 1:167128442-167128464 CAGAAAACAGAGAAGAAGGGAGG + Exonic
916766436 1:167864902-167864924 AAAAAAAAAGAGCTGTGGGAAGG + Intronic
916795404 1:168162477-168162499 TAGAAGAAAGAGAACTGGCAGGG + Intergenic
916824138 1:168428214-168428236 CAGAAAAAGGAAAAGTGGAGAGG + Intergenic
917070171 1:171141899-171141921 GAGAAGAAGGAGAGGTGGGAAGG - Intronic
917361555 1:174181829-174181851 CAGAAAGAAGGGAGGTGGGTAGG + Intronic
917389772 1:174522524-174522546 AAGAAAAAAGAAGAGGGGGAAGG + Intronic
917469429 1:175314010-175314032 GGGAAAAAAAAGAGGTGGGAGGG - Intergenic
917513414 1:175687265-175687287 GAGTAAGAAGAGAAGTGAGATGG - Intronic
917872842 1:179257128-179257150 CAGAATCAAGAGAAGTAGGATGG + Intergenic
918157600 1:181864453-181864475 CAGGAGCAAGAGAAGTGGGGAGG + Intergenic
918216653 1:182397556-182397578 AAGAAAAAAGAAAAGAAGGAAGG - Intergenic
918781532 1:188705766-188705788 CAGAATAAAGAGAAATCGGGTGG - Intergenic
918817339 1:189205522-189205544 CAGCTAAAAAAGAAGTTGGAGGG + Intergenic
918934334 1:190900768-190900790 CAGAAAAAAAATGAGAGGGAAGG + Intergenic
919391630 1:196992347-196992369 TAGAAAAAATAGAAGTGCAAGGG - Intronic
919775826 1:201193356-201193378 CAGAGAGGAGAGAAGTGGTAGGG + Intronic
919916114 1:202140435-202140457 CAGATAAAAGGGAATTGGGCTGG - Intronic
921055686 1:211540912-211540934 CAAAAGAAAGAGAAGTTTGATGG + Intergenic
921601721 1:217113360-217113382 CAGAAACAGGGGAGGTGGGATGG - Intronic
921691844 1:218160647-218160669 CAGAAGGAAGAGAAGTGGAGAGG - Intergenic
922087246 1:222362593-222362615 CAGCAAAGAGATAAGTGAGAAGG + Intergenic
922273959 1:224059271-224059293 CTGAAAATAGAGAAGAGGAAAGG + Intergenic
922409409 1:225356458-225356480 CAAAAATTAGAGAAGTGGGTTGG - Intronic
922896259 1:229102797-229102819 CAGTAAGAAGAGAACTGTGATGG - Intergenic
922905006 1:229167639-229167661 AAGAGAAGGGAGAAGTGGGAGGG + Intergenic
922913121 1:229233906-229233928 CAGAAACAAGAGGAATGGGGAGG + Intergenic
923125660 1:231032545-231032567 CTGCTAAAAGAGAAGTGGCAAGG - Intronic
923156773 1:231285984-231286006 CAAAAAAAAAAGAAGTGGGATGG + Intergenic
923699650 1:236287772-236287794 CAGAAAAAAGGGACGAGGAAGGG - Intergenic
923715460 1:236421478-236421500 AAAAAAAAAAAGAACTGGGAAGG - Intronic
923821454 1:237447852-237447874 AAGAAAAAAGAAAAGAGGGAGGG - Intronic
923842397 1:237687411-237687433 AAGAGAAAAGGGAAGGGGGAAGG - Intronic
924043483 1:240006285-240006307 CAGAAGAAAGAGAAGAAGCATGG - Intergenic
924070161 1:240269056-240269078 TAGAAAATAGACAAATGGGATGG - Intronic
924328180 1:242916594-242916616 AAGAAAAAAGAGAAAGGGAAAGG + Intergenic
924334161 1:242970230-242970252 CAAAGAAAAGAGAAATGGAAAGG + Intergenic
924657337 1:245984899-245984921 CAGAGCAAGGAGAAGTCGGATGG - Intronic
924941611 1:248816113-248816135 CAGAAAAAAGGGGTGTGGGATGG + Intronic
1062820967 10:534295-534317 CAGCAGGAAGAGGAGTGGGAAGG - Intronic
1062846746 10:713113-713135 CAGAAAGAGGAGAAGTGTAAAGG + Intergenic
1063111914 10:3045442-3045464 CACAACAAAGAAAGGTGGGAGGG + Intergenic
1063352985 10:5373686-5373708 CAGAAAAGAGGGATGTGGGCAGG - Intronic
1063412065 10:5843946-5843968 CAGAAAGGAGAGAAGAGAGAAGG - Intergenic
1063963786 10:11328858-11328880 CAGAAAACAGAAAAGGGGGCTGG - Intronic
1064146047 10:12827169-12827191 AAGAAAAGAGAGAAGAGAGAGGG - Intronic
1064743750 10:18459282-18459304 CAGAAAAATGATAGCTGGGAGGG - Intronic
1064939408 10:20715865-20715887 GAGAAGAAAGAGAAGAAGGAAGG + Intergenic
1065171940 10:23039525-23039547 CAGAAAAAAAAGAAATGTGTTGG - Intergenic
1065334944 10:24647476-24647498 AAGACAAAAGAAAAGTAGGAGGG + Intronic
1065386417 10:25138118-25138140 CAGAAAAAAAAGCAGGGGAAAGG + Intergenic
1065817157 10:29492568-29492590 CAGCAAAAAGAAAAGTGCGGAGG - Intronic
1065952375 10:30663922-30663944 CAGAGAAAAGAGATGAGGGAAGG - Intergenic
1066383730 10:34923224-34923246 TAGAAAAAAGAGTAGTGAAAGGG + Intergenic
1066627286 10:37419654-37419676 GAGAAAAAAGAGGAGAGGGTAGG - Intergenic
1066720445 10:38331668-38331690 TAGAAAAAAGAGAAGCTGGCTGG - Intergenic
1067176297 10:43950358-43950380 GAGAGAAAAGGGAAGAGGGAAGG - Intergenic
1067827783 10:49591837-49591859 CAGGAAAAAGAGGAGTTGGGGGG + Intergenic
1067854433 10:49780109-49780131 GAGAAAAAAAAGAAGGGAGAAGG - Intergenic
1068123265 10:52806594-52806616 GAAAAAAAAAAAAAGTGGGAGGG - Intergenic
1068136492 10:52954689-52954711 CAGAAAAGACAGGACTGGGATGG + Intergenic
1068231862 10:54178103-54178125 CAGCCAACAGAGAAGTAGGATGG + Intronic
1068420742 10:56788994-56789016 CAGAAAAAAGAAAAGAGGCCAGG - Intergenic
1068533427 10:58213707-58213729 AAGAAAAAATAGAAATGGGCTGG + Intronic
1068594080 10:58883608-58883630 AAGAAGAAAGAGAAGGGAGAAGG + Intergenic
1068836816 10:61564454-61564476 AAGAAAAAAAAGAAGGGGGACGG + Intergenic
1069190573 10:65482941-65482963 AAGAAAAAAGAGGAAGGGGAAGG - Intergenic
1069740154 10:70682208-70682230 CAGAAGAAAGAGAAGAGGACCGG + Intronic
1069802249 10:71089271-71089293 GAAAGAAAAGAGCAGTGGGAAGG + Intergenic
1069903240 10:71717842-71717864 AAGAAAGAAGAGAGGTGGGGTGG + Intronic
1070209856 10:74305493-74305515 CAGAAAAAAGAGCTAAGGGAGGG - Intronic
1070265649 10:74900008-74900030 CAGAAAAAAGAGAGGTCAGTAGG + Intronic
1070320215 10:75348977-75348999 GAGAAAAAAGAGAAACAGGAAGG - Intergenic
1070474783 10:76819797-76819819 CAGAAAAAAGAGTAGAGACACGG - Intergenic
1070603182 10:77879799-77879821 CAGGAAAAACAGATGGGGGAGGG + Intronic
1070696564 10:78568297-78568319 CAGAAGCAAGAGAAGAGGAAGGG - Intergenic
1070835865 10:79446480-79446502 CAGAAATAGGAGAAGGGGGGGGG - Intergenic
1070968012 10:80541579-80541601 CAGAAAAGAGGGGAGAGGGAAGG - Intronic
1071179888 10:82971065-82971087 GAGAAAAAAGAGAAAGGCGAAGG + Intronic
1071352065 10:84756557-84756579 AAGCCAAAAGAAAAGTGGGAGGG - Intergenic
1071372140 10:84963009-84963031 TAGAAAAAACAAAAGGGGGAAGG - Intergenic
1071385727 10:85119317-85119339 CAAAAAGGAGAGAAGTGGGCTGG - Intergenic
1071571076 10:86697515-86697537 AAGAAAAAAAAGAAGTTGGCCGG - Intronic
1071613897 10:87056960-87056982 CAAAAAAAAGAAAGGAGGGATGG - Intronic
1071859122 10:89654792-89654814 CAGGAGAGAGAGAATTGGGAGGG + Intergenic
1072075002 10:91961819-91961841 TGGAATAATGAGAAGTGGGAAGG + Intronic
1072180821 10:92978111-92978133 AAGAAAAAAGAAAAGTGGGCTGG + Intronic
1072494277 10:95940142-95940164 AAGAAGAAAGAGAAGAGGGGAGG + Intergenic
1072774272 10:98173698-98173720 GGGAAAAAAGAGTAGGGGGAGGG - Intronic
1073007153 10:100333259-100333281 GAGAAAACAGAGGAGGGGGAAGG + Intergenic
1073108201 10:101045237-101045259 AAGAGACAAGAGAAGAGGGAGGG - Intergenic
1073137793 10:101229374-101229396 CAGAGAAGAGAGAAGAGAGAGGG - Exonic
1073163981 10:101427497-101427519 GAGAAGAAAGAGAAGAAGGAAGG - Intronic
1073513887 10:104060360-104060382 GAGAAGAAAGAGAAGGAGGAGGG + Intronic
1073696534 10:105876045-105876067 AAAAAAAAAGAGAAGTGAAAAGG - Intergenic
1073940180 10:108688915-108688937 AAGGAAAAAGAAATGTGGGAGGG - Intergenic
1074650352 10:115515932-115515954 CTTAAAAAAAAGAAGTGGAAAGG - Intronic
1074879301 10:117641206-117641228 CAAAAAAAAGAAAAGAAGGAAGG - Intergenic
1075248550 10:120846079-120846101 CAGAAAAAAGAGTAGAGACACGG - Intergenic
1075641064 10:124064869-124064891 CACAAAAAACGGAAGTGGGAAGG - Intronic
1076542651 10:131223951-131223973 GTGAAGAGAGAGAAGTGGGAGGG - Intronic
1076553300 10:131302597-131302619 AAAAAAAAAAAGAATTGGGAGGG - Intronic
1077359348 11:2133833-2133855 CAGGAAGAAGAGAGGTGAGAGGG + Intronic
1078176440 11:8974975-8974997 CTTAAACAAGAGAAGTGGGTTGG - Intergenic
1078509138 11:11972841-11972863 CAGAAATAAGAGGCCTGGGAGGG + Intronic
1078509161 11:11972937-11972959 CAGAAATAAGAGGCCTGGGAGGG + Intronic
1078811709 11:14774573-14774595 GAAAAAGAAGAGGAGTGGGAGGG - Intronic
1079697081 11:23495355-23495377 AAGAAAGAAGAGAAGGAGGAAGG + Intergenic
1079730362 11:23933356-23933378 CAGGAAAAAGACAAAAGGGATGG - Intergenic
1080135004 11:28844449-28844471 GAAAAAAGAGAAAAGTGGGAGGG - Intergenic
1080408817 11:32004254-32004276 AAGAAAAATGAGAAGTGAGGAGG - Intronic
1080454825 11:32408550-32408572 AAGAAAAAAGAAAAGAAGGAAGG + Intronic
1080991910 11:37546572-37546594 CAGAAGAAAGAGAAGTTTAAAGG + Intergenic
1081356666 11:42121805-42121827 CAGAAAAAAGAGTAGAGACACGG - Intergenic
1081559513 11:44200294-44200316 AAAAAAAAAAAAAAGTGGGAAGG - Intronic
1081590898 11:44422401-44422423 CTCAAAAAAGAAAAGAGGGAGGG - Intergenic
1082757916 11:57096455-57096477 AAGAAAAAAGAGAAGGGGTCTGG - Intergenic
1082840691 11:57687248-57687270 TAGAAAAAAAAAATGTGGGAAGG - Intronic
1082970263 11:59012859-59012881 AAGAGAAGAGAAAAGTGGGAAGG + Intronic
1083036893 11:59646510-59646532 TTGAAAAAAGTGAAGTGGGTTGG - Intronic
1083136852 11:60687093-60687115 AAGAAAAAAGAGCAATGGAAAGG - Intergenic
1083327793 11:61881962-61881984 TAGAAAAAAGGGCAGAGGGAAGG + Intronic
1083349786 11:62019322-62019344 GAGACAAAAGGGAAGTGTGAGGG + Intergenic
1083544545 11:63538650-63538672 CAGGACATGGAGAAGTGGGAAGG + Intronic
1083646877 11:64176810-64176832 CAGAAAAAAAAGGGGTGGGGGGG + Intergenic
1084135297 11:67174439-67174461 CAGAAAATAGAATAGTGGAAAGG - Intronic
1084491176 11:69479421-69479443 CAGAAAACAGAGAAGAGTTAGGG - Intergenic
1084521401 11:69665242-69665264 AAGAAAAAAGAGGAGAGGAAGGG + Intronic
1084583413 11:70038908-70038930 GAGAGAAAATAGAAGGGGGAAGG + Intergenic
1084695034 11:70747966-70747988 ACGAAAAAAGAGGAGAGGGAAGG + Intronic
1084705162 11:70811856-70811878 CAGAAAAATGATAAGATGGATGG - Intronic
1084725304 11:70938008-70938030 CAGAAAAAAATAAAGTGAGAAGG - Intronic
1085134421 11:74073022-74073044 CAGGCAAAAGAGAAGGGTGACGG + Intronic
1085470035 11:76752123-76752145 CAGAGAAAGGAAAAATGGGATGG - Intergenic
1086060886 11:82698790-82698812 CAGCAAAAAGAGAACTGAAATGG + Intergenic
1086186682 11:84025906-84025928 AAGAAAAAAGAGAAGAGGAGAGG + Intronic
1086449604 11:86903130-86903152 AAGAAAAAAGAAAGGTAGGAAGG - Intronic
1086654962 11:89343034-89343056 CAGAAAGCAGACAAGTAGGAAGG - Intronic
1087025470 11:93645202-93645224 AAAAAAAAAGAAAAGTGGAAAGG - Intergenic
1087066033 11:94028962-94028984 AAGTAAAAAAAGAAGTGGGAAGG - Intronic
1087074053 11:94112106-94112128 CAGAAAAAGGAGAATGGGCATGG + Exonic
1087245468 11:95830642-95830664 CAGAGAAAAGAAGAATGGGAAGG - Intronic
1087352363 11:97048123-97048145 AAGAAAAAAGAGGAGGGTGATGG - Intergenic
1087601318 11:100319447-100319469 CAGAAAAAAGGGAAGTCAGCTGG - Intronic
1087844590 11:102958676-102958698 AAAAAAAAAGAGAAATCGGAAGG - Intergenic
1088380622 11:109188649-109188671 CAGAAAAAAGAAATGGGGAAAGG - Intergenic
1089024203 11:115251442-115251464 CAGAAAATTGGGAAGTGGGAGGG + Intronic
1089113926 11:116078765-116078787 CAGAAAAGAGGGAAGAGGGAAGG + Intergenic
1089124330 11:116165871-116165893 CAGGAGAAAGAAGAGTGGGATGG + Intergenic
1089353370 11:117833988-117834010 CAAAAAACAGAGAGGTAGGAGGG + Intronic
1090073285 11:123562234-123562256 CAGAAAAGAGAGAAGCAGGGAGG - Intronic
1090480277 11:127061760-127061782 CAAAGAAAGGAGAAGGGGGAAGG - Intergenic
1090591475 11:128274862-128274884 CAGAGAATGGAGAAGCGGGAAGG - Intergenic
1090786130 11:130049234-130049256 CAAAAAAAAGAGGAGAGGGGAGG + Intergenic
1090851259 11:130572476-130572498 CAGAAAAGAGAGAATAGGGATGG - Intergenic
1090936076 11:131343748-131343770 CTGAGTAAAGAGAAGTTGGAAGG + Intergenic
1091328665 11:134713047-134713069 CAGTATAAAGAGAGGTGGAATGG - Intergenic
1091988113 12:4930540-4930562 CAGTAAGAATAAAAGTGGGAGGG - Intronic
1092001466 12:5036034-5036056 AAGAAAAAAGAAAAGAAGGAGGG + Intergenic
1092163560 12:6329244-6329266 CAGAAAAAAGTGGGGTTGGAAGG + Exonic
1092206629 12:6618527-6618549 CAAAAAAAAAAAAAGAGGGAAGG + Intergenic
1092233754 12:6792777-6792799 CTGAAAAAGGAGAAGAGGCAAGG + Intronic
1092358327 12:7815448-7815470 CAGAAAAGATTGAAATGGGATGG - Intronic
1092388842 12:8057196-8057218 CAGAAAAATGAGAAGGTGGTAGG + Intergenic
1092459707 12:8675421-8675443 CAGTAAAAAGAGAGGTGGCCGGG - Intergenic
1092763269 12:11828780-11828802 AAGAAAAAAGATAATGGGGAGGG - Intronic
1093026100 12:14246853-14246875 AAAAAAAAAGAGAAGTGCAATGG - Intergenic
1093110262 12:15143780-15143802 GAGAAGAAAGAGGAGTTGGAGGG + Intronic
1093274321 12:17105193-17105215 AAGAAAGGAGAGAAGAGGGAGGG - Intergenic
1093287110 12:17277367-17277389 CAGAAAAGTGAGGAGTGGGGAGG + Intergenic
1093408542 12:18837046-18837068 CTGAAATAAAAGAAGTGAGATGG - Intergenic
1095194776 12:39300839-39300861 AAGAAAAGAGAGAAAGGGGATGG - Intronic
1095326779 12:40904311-40904333 AAGGAAAAAGAGAAGAGGGCTGG - Intronic
1096122999 12:49100721-49100743 AAAAAAAAAAAGAAGTGGGCTGG - Intronic
1096193044 12:49632570-49632592 CCGAAGAAAGAGGAGGGGGAAGG - Intronic
1096317362 12:50579829-50579851 AAGAAATAAGGGAAGTGAGAAGG - Intronic
1096322819 12:50630346-50630368 GAGAAGAAAGACAAGAGGGAAGG - Intronic
1096776722 12:53968872-53968894 AAGAAAAGAGAGGGGTGGGAAGG - Intergenic
1096842214 12:54386439-54386461 AAGATAAAAGAGAAGAGAGAGGG + Intronic
1096911365 12:54987790-54987812 GGGAAAAAAGAGAAAGGGGAAGG - Intergenic
1096985797 12:55756167-55756189 CAGAAAAGAGGGAAAAGGGAAGG + Exonic
1097103226 12:56604167-56604189 CAGAGAGGAGAGAAGTGGGGCGG - Intronic
1097514276 12:60585100-60585122 AAAAAAAAAAAAAAGTGGGAAGG + Intergenic
1097519989 12:60655418-60655440 CACAAATAAGAGAAATGGCAAGG + Intergenic
1098008012 12:66019779-66019801 CAGAAAACAGAGCAGAGTGATGG + Intergenic
1098240905 12:68466005-68466027 AAGCAAAAAGAAAAGGGGGAGGG + Intergenic
1098364517 12:69688730-69688752 CAGAAGAAAGAGAAGCTGGAGGG + Intronic
1098402098 12:70086628-70086650 CAGAAAAAAGAGTAGAGATACGG - Intergenic
1098504854 12:71237612-71237634 TAGAAAAAAGAGGAGGAGGAGGG - Intronic
1098511018 12:71314242-71314264 CAGACCAAAGAACAGTGGGAAGG - Intronic
1098769006 12:74528690-74528712 CAGAAAAAAAAGAAGAATGATGG - Intergenic
1098795345 12:74880958-74880980 AAAAAAAAAAAGAAATGGGAGGG + Intergenic
1098915278 12:76250931-76250953 AAAAAAAAAAAGAAGAGGGAAGG - Intergenic
1099853468 12:88134548-88134570 CATAAAAAATAAAACTGGGAAGG + Intronic
1100112777 12:91265614-91265636 CAGAAAAAAAAGAAATGAAAAGG + Intergenic
1100406828 12:94279134-94279156 AAGAAAAAAAAGAATTGGAAGGG - Intronic
1100455176 12:94744795-94744817 CAGAAATCGGAGAAGGGGGAGGG - Intergenic
1100556145 12:95695918-95695940 AAGAGAAAAGAAAAGAGGGAGGG - Intronic
1100915430 12:99415680-99415702 CAAAAAAAAGGGCAATGGGAGGG - Intronic
1101595759 12:106163268-106163290 CAGAAAGGAGAGAAAAGGGAAGG - Intergenic
1101686281 12:107025601-107025623 TAGCAAAAACAGAAGTGGAAAGG - Intronic
1101746714 12:107547204-107547226 GAGAAGAAGGAGAAGGGGGAGGG + Intronic
1101787650 12:107899344-107899366 CAGGAGAAAGATCAGTGGGAAGG - Intergenic
1102106819 12:110332052-110332074 CACAATAAAAATAAGTGGGAAGG + Intronic
1102159575 12:110757571-110757593 CAGAAAAATGGGAAGGGGGCTGG - Intergenic
1102216511 12:111165272-111165294 CTGAGAAAAGAGAAGTAGGAAGG + Intronic
1102366909 12:112345265-112345287 AAGAAAAAAAAAAAGTGTGATGG + Intronic
1102496331 12:113321741-113321763 TAGAAACAAGAGATTTGGGATGG - Intronic
1102548563 12:113674274-113674296 CAGAAAAGAGAGAGGAAGGAAGG - Intergenic
1102595636 12:113990712-113990734 CACATAAGAGAGAGGTGGGAGGG - Intergenic
1102942027 12:116951531-116951553 CAAAAGAAAGAGAAAAGGGAAGG - Intronic
1102975262 12:117202451-117202473 CAGAAATAAGAGAGGAGGGTGGG + Intergenic
1103244781 12:119447308-119447330 CAGTACAAGGGGAAGTGGGAGGG - Intronic
1103279987 12:119749508-119749530 CATAATCAAGAGAAGGGGGAAGG + Intronic
1103618090 12:122168138-122168160 AAAAAAAAATAGAAGTGGGAAGG + Intronic
1103632881 12:122276956-122276978 CAGAAAAAAAAAAGGTGGGGTGG - Intronic
1103812931 12:123630348-123630370 CACTAAACAGAGAAGTGGAAAGG + Intronic
1104264886 12:127222210-127222232 CAGAAGGATGAGGAGTGGGAAGG - Intergenic
1104314308 12:127682746-127682768 CAGAAAAAAAAAAAGTGTGCCGG - Intergenic
1104508869 12:129357610-129357632 AAGAAAGAAGTGAAGTGGCAAGG + Intronic
1105332723 13:19433021-19433043 CAGGAACAAGAGAAGAGTGACGG - Intronic
1105673339 13:22644024-22644046 CAGGAAACAGAGAGGTGGCAGGG + Intergenic
1105712705 13:23028375-23028397 CAGGAGAAAAAGAAGTGGGTTGG + Intergenic
1105764586 13:23546848-23546870 CGGAAAAAATAGAAAAGGGAAGG + Intergenic
1105962641 13:25356046-25356068 AAGAAAAATGAGAACGGGGAGGG - Intergenic
1105983809 13:25545929-25545951 CATAAAAAACAGAAGTAGGCTGG - Intronic
1106181690 13:27374730-27374752 CAGAAAACTGAGAAGTAGGCAGG - Intergenic
1106197847 13:27509417-27509439 CTGGAGATAGAGAAGTGGGAAGG - Intergenic
1106202840 13:27556227-27556249 CAGAATAAAGAGAGGTAAGATGG - Exonic
1106301300 13:28468691-28468713 CAGGAACAAGAGAAGGGGGGAGG - Intronic
1106521241 13:30499476-30499498 AAGAAAAAAGAGAAACGGGAAGG - Intronic
1106666863 13:31860433-31860455 CAGAAGAAAGAAAAGGAGGATGG - Intergenic
1106878817 13:34106648-34106670 CAAAAAAAAAAGAAAGGGGAGGG - Intergenic
1106906538 13:34415426-34415448 CAGAGAAAAGAAAGGTTGGAGGG + Intergenic
1107031015 13:35853802-35853824 CAAAAATAAAAGTAGTGGGAAGG - Intronic
1107045820 13:35991060-35991082 GAGAAAAAGCAGAAATGGGATGG + Intronic
1107153538 13:37140211-37140233 CAGAAAACACAGAAGTGAAAGGG - Intergenic
1107703464 13:43073950-43073972 CAAAAAAAAAAGAAGAAGGATGG - Intronic
1107726930 13:43308274-43308296 CAAAGAAAGGAGAAGTGAGAGGG - Intronic
1107999586 13:45894024-45894046 GAGAAAAAAAAAAATTGGGATGG - Intergenic
1108081146 13:46737522-46737544 CAGCACAAAGGGATGTGGGATGG - Intronic
1108454552 13:50599717-50599739 AAGACAGAGGAGAAGTGGGAGGG - Intronic
1108964077 13:56274582-56274604 AAAAAAAAAGAGAAGGGGCATGG - Intergenic
1109357630 13:61251621-61251643 CAGACAATAGAAAAGTGGGTGGG - Intergenic
1109580441 13:64324981-64325003 CAGAAAAAATAGATGTTGTAAGG - Intergenic
1109741161 13:66557853-66557875 GACAAAGAAGAGAAGTGGGCTGG + Intronic
1109756457 13:66767233-66767255 CACAAAAAAGAGCAAAGGGAAGG + Intronic
1109802087 13:67393779-67393801 CAGAAATAAAAAAAGTGGAAAGG - Intergenic
1110257470 13:73447547-73447569 TAGAAACATGGGAAGTGGGAAGG - Intergenic
1110319783 13:74148353-74148375 CAAAGAACAGAGAAATGGGATGG - Intergenic
1110458130 13:75712588-75712610 CAAAAGAAAGAGAGGTGAGATGG - Intronic
1110568118 13:76976600-76976622 CAGAAAGAAGAGAAATGTGCTGG - Intergenic
1110619985 13:77584634-77584656 TACAAAAAATAGAAATGGGATGG - Intronic
1110763757 13:79258902-79258924 GAGAAAAAAGAGAAGAGAGGAGG + Intergenic
1110956042 13:81553477-81553499 CCGCAGAAAGAGAAATGGGAGGG - Intergenic
1111065946 13:83091425-83091447 CAGAAAAAGGCAATGTGGGAAGG - Intergenic
1111731960 13:92087754-92087776 AAAATAAGAGAGAAGTGGGAAGG - Intronic
1111734182 13:92116096-92116118 CAGAAAAAAAATAAGTGTGGTGG + Intronic
1111980622 13:95011900-95011922 CTCAAAAAAGAAAAGTGGGGGGG - Intergenic
1112537435 13:100273917-100273939 AAGAAAAAAGGGAAGAAGGAAGG - Intronic
1112561441 13:100518347-100518369 CAGGAAGAAGAGATGTGGGGTGG + Intronic
1112729228 13:102341169-102341191 AACAAAAAAAAGAAGTAGGATGG + Intronic
1113205842 13:107914962-107914984 AATAAAATAAAGAAGTGGGAAGG - Intergenic
1113307147 13:109090854-109090876 GATAAGAAAGAGAAATGGGACGG - Intronic
1113470498 13:110541577-110541599 CTGAAAAATGAGAAGTCAGAAGG - Intronic
1113904634 13:113813471-113813493 GAGAAAAAAGATAAGGTGGAGGG + Exonic
1114254116 14:20987285-20987307 GAGGAAGAAAAGAAGTGGGAGGG + Intergenic
1114281317 14:21194837-21194859 GAGAAAGAAGAGAAGAAGGAAGG - Intergenic
1114338963 14:21723356-21723378 CAGAAAGAAGGGAAATAGGATGG - Intergenic
1114351685 14:21859836-21859858 CAGAAAAAAAATACGTAGGAAGG - Intergenic
1114484924 14:23056810-23056832 GAGAAAGGAGAGCAGTGGGAAGG - Intronic
1114525388 14:23364771-23364793 AAGAAAAAGGAGAATGGGGAGGG + Intronic
1114827939 14:26104364-26104386 AAGAAAAAAGAGATGTTAGAAGG - Intergenic
1115084156 14:29493208-29493230 GGAAAAAAAGAGAAGAGGGAAGG + Intergenic
1115318046 14:32046941-32046963 CAGAAAAATGTGAAGGAGGAAGG + Intergenic
1115939391 14:38591524-38591546 CAGAAAACATAAAAGTGGAAAGG - Intergenic
1115975254 14:38990151-38990173 CAGAAAAGAGGGAAGAGGAAAGG - Intergenic
1116253481 14:42518023-42518045 GTGGAAAAAGAGAACTGGGAAGG + Intergenic
1116614570 14:47118535-47118557 GATAAAAAAGAGAAATGTGATGG - Intronic
1116668924 14:47816678-47816700 CAGAAAAAAAAGAATTCAGAAGG - Intergenic
1116851753 14:49915876-49915898 CAGAAAAAAGGAAAGTAGCATGG - Intergenic
1117367404 14:55042828-55042850 CATGAAAAAGAGATGTTGGAAGG - Intronic
1117480562 14:56140020-56140042 CAGGAAAAAGAGAAGGGGGAAGG - Intronic
1117557498 14:56901026-56901048 AAGAAAAAAGAGAAGCTGAAGGG + Intergenic
1118567976 14:67163460-67163482 CAGGAAAAAAAAAATTGGGAAGG + Intronic
1118595677 14:67433335-67433357 CAGAGAGAAGAGAAAAGGGAGGG + Intergenic
1118762125 14:68886342-68886364 AAGAAGAAAGAGTAGGGGGAAGG - Intronic
1118779270 14:68995791-68995813 TAGAGGAAAGAGAATTGGGAGGG - Intergenic
1118923734 14:70172899-70172921 CAAAAAAAAGGAAAGTGGGAAGG + Intronic
1118929553 14:70228452-70228474 CAGAAAACAAGGAAGTGAGAAGG - Intergenic
1119600654 14:75974139-75974161 CAGAAAAAAAAGAAGGGAGATGG + Intronic
1119826706 14:77662629-77662651 CAGAAAAAAACCAAGAGGGAGGG + Intergenic
1119951219 14:78747608-78747630 CAGAAAAAATACAGATGGGATGG - Intronic
1120395958 14:83967002-83967024 AAGAAGAAAGAGAAGAAGGAAGG - Intergenic
1120527885 14:85598894-85598916 ATGAAATAAGAGAAATGGGATGG + Intronic
1120625936 14:86826556-86826578 CAGAAGAAAGAGAAAGAGGAGGG + Intergenic
1120789570 14:88566930-88566952 AAAAAAAAAGAGAACTGGAATGG + Intronic
1121035880 14:90703242-90703264 CAGAAAAAAGACAATCTGGAAGG + Intronic
1121166888 14:91810380-91810402 ATGAAAGAAGAGAAGTAGGAAGG + Intronic
1121477021 14:94218223-94218245 AAGAGAAAGGAGAAATGGGAAGG + Intronic
1121634245 14:95443037-95443059 AAGAAAAAAGAGAGGTTAGAAGG + Intronic
1121787705 14:96674837-96674859 GAGACAAAGGAGGAGTGGGAGGG - Intergenic
1122362252 14:101174407-101174429 TGGAAAAAAGTGAAGTTGGAGGG - Intergenic
1122389947 14:101373381-101373403 CAGCAGAAAGGGAAGTTGGAGGG - Intergenic
1123736452 15:23188914-23188936 CAGCAAGAAGAGAACTGTGAGGG + Intergenic
1123954666 15:25322922-25322944 CTGAAAAATGAGAAGAGGAAGGG - Intergenic
1124257172 15:28153662-28153684 AAGAAAAAAAAGTAGTTGGAAGG + Intronic
1124287158 15:28411889-28411911 CAGCAAGAAGAGAACTGTGAGGG + Intergenic
1124295544 15:28499743-28499765 CAGCAAGAAGAGAACTGTGAGGG - Intergenic
1124567159 15:30826835-30826857 AAGAAAAAAAAGTAGTTGGAAGG - Intergenic
1124934818 15:34160385-34160407 CAAAAGATAGAGAACTGGGAAGG - Intronic
1124998303 15:34745610-34745632 CAAAGAAGAGAGAAGTGGGTAGG - Intergenic
1125242432 15:37591201-37591223 CAGAAAAAAGAGAGGAAGTAGGG - Intergenic
1126120777 15:45249449-45249471 AAAGAAAAAGGGAAGTGGGAGGG + Intergenic
1126238129 15:46409485-46409507 CAGAAAAAAGAGCAGAGCAATGG - Intergenic
1126492016 15:49247447-49247469 GAGAAAAAAGAAAAGAAGGAAGG + Intronic
1126496377 15:49295147-49295169 AAGAAGAAAGAGAAGAAGGAGGG + Intronic
1126499060 15:49324400-49324422 CAAAAAAAAAAAAAGAGGGAGGG + Intronic
1126752442 15:51890784-51890806 CTTAAAAATGAGAAGGGGGATGG - Intronic
1127017944 15:54709382-54709404 CACATAGAAGAGAAGTTGGAAGG - Intergenic
1127112478 15:55689472-55689494 CAAAAAAAAGAAAAAGGGGAGGG + Intronic
1127117870 15:55744736-55744758 CAGAATAAAGGTATGTGGGAAGG + Intergenic
1127933778 15:63616205-63616227 CAGAAAAAAATTAAGGGGGAAGG + Intronic
1127962724 15:63901837-63901859 GAGGAAAAAGAGGGGTGGGAAGG - Intergenic
1128240689 15:66099184-66099206 AAGAAAAAGGAGGGGTGGGAGGG - Intronic
1128986144 15:72223003-72223025 AAGAAAAAAAAAAAGTTGGAGGG - Intronic
1129248953 15:74297726-74297748 CAGGAAAGAAAGAAGAGGGAAGG + Intronic
1129268666 15:74408290-74408312 CAGAGCAAACTGAAGTGGGAGGG + Intergenic
1129594136 15:76946449-76946471 AAAAAAAAAAAGAAGGGGGAGGG + Intronic
1129797255 15:78387227-78387249 CAGACCTAGGAGAAGTGGGAAGG + Intergenic
1129799520 15:78403489-78403511 AAAAAAAAAAAGGAGTGGGATGG + Intergenic
1129969605 15:79766522-79766544 CAGAAAAAAGATTAGGGGCAGGG - Intergenic
1130202102 15:81841714-81841736 CAGAAAAAAAAAAAGTGTCAGGG + Intergenic
1130413946 15:83672620-83672642 AAGAGAAAAGAGGTGTGGGATGG + Intronic
1130529330 15:84734362-84734384 CAGAAAAAAAAAAAGCGGGGGGG - Intergenic
1130539846 15:84814503-84814525 CATAAAAAAAAAAAATGGGAAGG + Intergenic
1130668145 15:85886956-85886978 CAGTAGAAAGGGAAGTGGGTTGG + Intergenic
1130811808 15:87386924-87386946 AAGAAGAGAGAGAGGTGGGAGGG + Intergenic
1131748163 15:95472899-95472921 CAAACAACAGAGAAGAGGGATGG + Intergenic
1131792069 15:95975800-95975822 CAGAAAAGAGGGAAGGAGGAAGG + Intergenic
1131813738 15:96201264-96201286 CCGAAAATAGAGACGTAGGAAGG - Intergenic
1131951218 15:97683701-97683723 AAAAAAAAAGAGAAGGGGGAGGG + Intergenic
1131990570 15:98088893-98088915 CAGAAATAATAGAAGTGTGAAGG - Intergenic
1132099573 15:99014403-99014425 CAGAAATAATAGAAGTGTGAAGG + Intergenic
1133115709 16:3576963-3576985 TAGAAAAAAGAGATGTGGCCAGG - Intronic
1134010068 16:10845382-10845404 CTCTAAAAAGAGAAGTGAGAAGG + Intergenic
1134376984 16:13686130-13686152 AAGAAAAAAGAGGAGAGAGAAGG - Intergenic
1135419950 16:22299070-22299092 AAGAAAACAGAGATGTGGTAGGG + Intronic
1135471043 16:22730953-22730975 CGCAAAAAGGAGGAGTGGGAAGG - Intergenic
1135745344 16:25012179-25012201 CCCAAAGAAGAGAAGTAGGATGG - Intronic
1135934800 16:26770611-26770633 GAGGAAAAGGAGAAGAGGGAAGG + Intergenic
1135964249 16:27022769-27022791 CAAAAAAAAAAAAAGAGGGAAGG + Intergenic
1136089032 16:27905122-27905144 CACAAAAAAATGCAGTGGGATGG - Intronic
1137507376 16:49065878-49065900 TAGAAAAAAGAGCAGGTGGAAGG - Intergenic
1137545400 16:49399560-49399582 AAAAAAAAAAAAAAGTGGGAGGG + Intergenic
1137874839 16:51986143-51986165 CATAAATAAGAGAAGTGGGATGG + Intergenic
1137924789 16:52530333-52530355 CAAAAAAAAAAAAAGTGGGGTGG - Intronic
1138150882 16:54655650-54655672 AAGAAAAAGCAGAAGTGGAAAGG + Intergenic
1138293843 16:55870241-55870263 CAGAAAGAAGAGAGGAGGGGAGG + Intronic
1138299637 16:55915388-55915410 GAGAGAAAAGAGCAGTGGAAGGG + Intronic
1138319403 16:56099056-56099078 CAGCAAAAAGAGAAGGAGGTGGG + Intergenic
1138364926 16:56467402-56467424 AAAAAAAAAGAAAAGTGGAAAGG - Intronic
1138726252 16:59142562-59142584 CACAAGAGAGAGAAGTGGGGAGG - Intergenic
1138798722 16:60000715-60000737 CTGAAAGAGGAGAAGTGAGATGG + Intergenic
1138860998 16:60757215-60757237 TAGAAAGAAGAAAAGTGGAAAGG - Intergenic
1139135210 16:64195048-64195070 TTGAAAAAAAAGAAGTGGGGTGG + Intergenic
1139389595 16:66598361-66598383 CTGAAAGAGGAGAAGTGGGTGGG - Intergenic
1139467434 16:67161454-67161476 AAAAAAAAAAAAAAGTGGGAGGG + Intronic
1139743971 16:69059499-69059521 AAGAAAAAAGAAAAGTGGCCAGG - Intronic
1139851586 16:69953822-69953844 AAAAAAAAAAAGAAGAGGGAGGG + Intronic
1139880563 16:70176729-70176751 AAAAAAAAAAAGAAGAGGGAGGG + Intronic
1140192467 16:72829635-72829657 CAGAAAAAGGATGAGTGGGAGGG - Intronic
1140371946 16:74418788-74418810 AAAAAAAAAAAGAAGAGGGAGGG - Intronic
1140764279 16:78141419-78141441 AAAAAAAAAAAGAAGGGGGATGG - Intronic
1140823658 16:78685912-78685934 AAGAAAAAAGAGAGGTGGGTAGG + Intronic
1140850197 16:78928190-78928212 AAAAAAAAAGAAAAGTGGTAGGG - Intronic
1141513560 16:84528010-84528032 CCAAGAAAAGAGAAGTGGGTTGG + Intronic
1141517596 16:84556424-84556446 CTGCAAAAAGAGAGGAGGGAGGG + Intergenic
1141645531 16:85365382-85365404 CAGGGAAAAGAGAAGAGTGAAGG - Intergenic
1141784692 16:86191257-86191279 CAAAAAAAAGAGAAGCCTGAAGG + Intergenic
1141865369 16:86746520-86746542 CAGAGAAAAGAGAAGAGACACGG + Intergenic
1141931631 16:87208500-87208522 CAGCAAAAAGAGAAGGAGAAAGG + Intronic
1142131977 16:88435290-88435312 CAGAAAAAAGAGAAGGCCGGAGG + Exonic
1142301491 16:89261150-89261172 CAAAAAAAAGAAAAGTCGGCCGG + Intergenic
1142467064 17:142074-142096 GATAAGAAAGAGAAGTGGGCAGG + Intergenic
1142495836 17:305852-305874 CAAAAAAAAGAAAGGAGGGAGGG - Intronic
1142746694 17:1962873-1962895 AAAAAAAAAGAGATGTGGGAAGG + Intronic
1142753514 17:2002243-2002265 AAGAAAAAAGAAAGGAGGGAGGG - Intronic
1143096040 17:4478940-4478962 CTCAAAAAAGAAAAGAGGGAGGG - Intronic
1143266966 17:5645492-5645514 CAAAAAAAAAAAAAGAGGGAAGG - Intergenic
1143332473 17:6147921-6147943 CAGAATAAAAAGAAATGGGGAGG - Intergenic
1143373925 17:6456401-6456423 CAGAAAAATGACAAGAGGCATGG - Intronic
1143418423 17:6768675-6768697 CAGCAATAACAGAAGTGGGATGG - Intronic
1143622717 17:8090131-8090153 GAGAAAAGAGAGAACAGGGAAGG + Intergenic
1144542172 17:16155004-16155026 CAGAAGAAAGAAAAGGGTGATGG - Intronic
1144554902 17:16273593-16273615 CAGAAAAAAAAGCAGTGGCAGGG + Intronic
1144827446 17:18114102-18114124 AAGAAAAAGGACAAGAGGGAGGG - Intronic
1145262420 17:21362432-21362454 CAGATAAAGGAGAAGATGGATGG + Intergenic
1145284151 17:21491599-21491621 CACAAAAAAGAGGAGAGAGATGG + Intergenic
1146220744 17:31017566-31017588 CTGAAAAAAGAAAACTGTGATGG - Intergenic
1146357052 17:32142891-32142913 CAGCCAAAAGAGAAGAGTGAAGG - Intronic
1146483313 17:33223147-33223169 AAAAAAAAAGAAAAGGGGGAAGG - Intronic
1146660582 17:34662830-34662852 CAGTAAAAAGAGCACTGGGCTGG + Intergenic
1146911643 17:36652093-36652115 GAGAAAAAAGAGAAAGGGAAAGG - Intergenic
1147310500 17:39593283-39593305 GAGAAAAAAGAGAAAAGAGAAGG + Intergenic
1147494108 17:40899573-40899595 GAGGAAAAAGTGAAGTGGGGTGG - Intergenic
1147621529 17:41871343-41871365 AAAAAAAAAAAAAAGTGGGATGG - Intronic
1147665981 17:42148416-42148438 AAAAAAAAAAAGAAGTGGGCAGG + Intronic
1147727978 17:42578513-42578535 CAAAAAAAAAAAAAGTGGGAAGG + Intergenic
1148068139 17:44888679-44888701 GAGAAAAAAGAGAAGCAGTAAGG + Intronic
1148118443 17:45192425-45192447 AAGAAAAAAGAAAAGGAGGAAGG - Intergenic
1148558233 17:48591231-48591253 CGGAGAAAAGACAAGTGGAAGGG + Intronic
1148574968 17:48703968-48703990 GAGGAAAAAGAGAAGTGAGTTGG - Intergenic
1148648490 17:49232843-49232865 AAAAAAAAAGAGGAGGGGGAGGG - Intergenic
1148876613 17:50691064-50691086 CAAAAAAGAGAGAAGTGGTCAGG - Intronic
1149183874 17:53974370-53974392 CCAAATAAAGAGAATTGGGAAGG + Intergenic
1149255846 17:54825537-54825559 CAAAAACAAGAAATGTGGGAAGG + Intergenic
1149407402 17:56367777-56367799 CAAGAAAAAGAGAAGTGGATGGG + Intronic
1149712623 17:58756536-58756558 CAGAAAAGAGAGCAGTTTGAGGG - Intronic
1150440165 17:65184715-65184737 AAGAAAAGAGAGAGGAGGGAGGG - Intronic
1150543624 17:66130014-66130036 AAGAAGAGAAAGAAGTGGGACGG + Intronic
1150669764 17:67182453-67182475 CAGAAAGATGAGAAGTGAGCAGG + Intronic
1151001132 17:70377735-70377757 CAAGACAAACAGAAGTGGGATGG + Intergenic
1151229973 17:72677458-72677480 AGGAAAAAAGAGAAGAGGGTGGG + Intronic
1151262598 17:72928522-72928544 AAGAAAACAGAGCAGTGGGTGGG + Intronic
1151777774 17:76218987-76219009 CAAAAAATAAAGAAGGGGGATGG + Intronic
1151852847 17:76701213-76701235 CAGAAAGATGAGAGGAGGGAGGG + Intronic
1151924812 17:77187374-77187396 CAGAAAAAAGGGGTGTGGGGGGG - Intronic
1152228463 17:79103323-79103345 GAGGAAGAAGAGGAGTGGGAGGG + Intronic
1152268578 17:79310492-79310514 GAGAAAAGAGAGGGGTGGGAGGG - Intronic
1152273098 17:79336821-79336843 CAATAAAAAGTGAAGTGGGCCGG + Intronic
1152302032 17:79500640-79500662 CGGGAAAAGGAGAAGGGGGATGG - Intronic
1152682254 17:81674668-81674690 CAAAAAAAAAAAAAGTAGGAGGG - Intergenic
1152815024 17:82402758-82402780 AAGAAAGAAAAGAAATGGGATGG + Intronic
1203167345 17_GL000205v2_random:110025-110047 CAGAATAAAAAGAAGAGGGTTGG - Intergenic
1153151442 18:2099404-2099426 AAGAAAAAAGAAAAGAGAGAGGG + Intergenic
1153268534 18:3296103-3296125 AAAAAAAAAAAAAAGTGGGAGGG - Intergenic
1153885459 18:9460507-9460529 TAGACAACAGAGAAGTGGGGAGG + Intergenic
1154478461 18:14791601-14791623 CAGAAAAAAGAGAAGTGAAACGG + Intronic
1154928985 18:20972847-20972869 TAAAAAAAAGAAAAGTGGGATGG + Intronic
1154940280 18:21106161-21106183 CAGCCAGAAGAGAAGTGGAAAGG + Intronic
1155946780 18:31861923-31861945 CAGAAAAAAAAAAAGGGGGGGGG + Intronic
1156360289 18:36378607-36378629 AAAAAAAAAGAGAGATGGGAAGG + Intronic
1156389579 18:36638158-36638180 TAGAAAAGAGAAAAGTGTGATGG + Intronic
1156417928 18:36917917-36917939 CAGAAACAGGAAAAATGGGAGGG - Intronic
1156876034 18:42013105-42013127 AAAAAAAAAAAAAAGTGGGAAGG - Intronic
1156934556 18:42687756-42687778 AAAAAAAAAGAGAAATGGAAAGG + Intergenic
1157053831 18:44200893-44200915 AAGAAAAAAGAGAACAGGAATGG + Intergenic
1157119277 18:44893707-44893729 AGGAAAAAAGAAAAGAGGGAGGG + Intronic
1157345131 18:46822568-46822590 GAGGAAAAAGAGAAGTTGGGAGG + Intronic
1157379786 18:47203094-47203116 CAGAAAAGAGAGAAAAGGAAAGG + Intergenic
1157514177 18:48299113-48299135 CAGAAAATAGTGAAATGGGAGGG + Intronic
1157766438 18:50300900-50300922 CAAAAATGAGAGAAGAGGGAAGG + Intergenic
1157956060 18:52098991-52099013 CAGAAAAGAGAAAAGTTGAAGGG + Intergenic
1158961342 18:62590064-62590086 CAATAAAAAGATAAGTGGGCCGG - Intergenic
1158962659 18:62599310-62599332 CTGTAAAAAGAGAGGTGGGGGGG - Intergenic
1159076043 18:63683083-63683105 AAGAAAAAAGGGAAGAGAGAAGG - Intronic
1159130307 18:64273778-64273800 CAGAAGAAAGAGAATTGTCACGG - Intergenic
1159153857 18:64556520-64556542 CAGAAAAGAGACATGTGGGCTGG - Intergenic
1159502803 18:69295431-69295453 CAGAAAGAAGAGAAGGAGCAAGG + Intergenic
1160037523 18:75315624-75315646 CAGACATAAGAGAGGTGAGAAGG - Intergenic
1160212472 18:76893807-76893829 CATAAAAAAGAAAGGTGGGCCGG - Intronic
1160236403 18:77089412-77089434 CACAAAGAAGAGAAGAGGCAGGG + Intronic
1160239427 18:77112559-77112581 CTGGAAACAGAGAAGGGGGAGGG - Intronic
1160286306 18:77546866-77546888 TAGAAGAAACAGAAGAGGGAGGG - Intergenic
1160734372 19:655486-655508 AAAAAAAAAGAAAAGTGGGGGGG + Intronic
1160829788 19:1098388-1098410 CAGTGAAAAGAGGGGTGGGAGGG + Intergenic
1160886313 19:1350471-1350493 AAGAAAAAAGAAAAGTGGCTGGG - Intergenic
1161066475 19:2240961-2240983 CAGAGAGAAGAGCAGTGGGTGGG - Intronic
1161307453 19:3575964-3575986 AAGAAAAATGAAAGGTGGGAGGG + Intronic
1161428116 19:4215775-4215797 CAAAAAAAAAAAAAGTGGCACGG + Intronic
1161661572 19:5549717-5549739 CAGAAAAAAGAGTAGAGACACGG - Intergenic
1161689250 19:5721305-5721327 AAAAAGAAAAAGAAGTGGGAGGG - Intronic
1161829079 19:6589868-6589890 CAGAAAAAAGAACAGAGAGAGGG - Intronic
1162251170 19:9444783-9444805 AAGAAAGAAGAGAAGAGAGAGGG + Intergenic
1162667035 19:12222393-12222415 CAGTGAAATGAGAACTGGGAAGG - Intergenic
1163087104 19:14989574-14989596 AAGAAAAAAGATAAGTGGTCAGG + Intronic
1163276084 19:16285191-16285213 AAGAAGAAAGAGAAGGGGAAGGG + Intergenic
1163276093 19:16285236-16285258 AAGAAGAAAGAGAAGGGGAAGGG + Intergenic
1163277585 19:16295091-16295113 AAAAAAAAAGAGGAGGGGGAGGG + Intergenic
1163369020 19:16891756-16891778 CAAAAAAAAGAGAAGAGGAGAGG + Exonic
1163484680 19:17578713-17578735 CAGAAAAAAGAAAAATGGCTGGG + Intronic
1163503412 19:17689100-17689122 TAAAAAAAAGAAAAGTGGGGAGG - Intergenic
1163596298 19:18222998-18223020 CAGAAAAAAAAGAAATGGGGAGG - Intronic
1164183168 19:22837585-22837607 CAGAACAATGAGCAGTGTGACGG - Intergenic
1164211940 19:23106207-23106229 AAGAAAAAAGAGGAGGAGGAAGG + Intronic
1164600532 19:29560461-29560483 GGGAACCAAGAGAAGTGGGATGG - Intronic
1164916743 19:32058168-32058190 CAGAAGAAAGAAAGGAGGGAAGG - Intergenic
1165109235 19:33492054-33492076 AAAAAAAAAGACAAGAGGGAAGG + Intronic
1165144524 19:33722780-33722802 GAGAAAAGAGAGATGTGGGTGGG - Intronic
1165294421 19:34915293-34915315 AAGAAAAAAGAAAAGAAGGAAGG + Intergenic
1165588855 19:36947661-36947683 CAAAAAAAAGTGGAGTGGGTAGG - Intronic
1165831717 19:38733867-38733889 CAGAAGAAAGGGAGTTGGGATGG - Intronic
1165887727 19:39090779-39090801 AAAAAAAAAAAGAAGTGGGAAGG - Intronic
1166012113 19:39950249-39950271 CAGCAACAAGAGGAGTGGGCTGG + Intergenic
1166121937 19:40691512-40691534 CAGAGAAAAGAGCTGGGGGAAGG + Exonic
1166242102 19:41501524-41501546 GAGAACAAAGAAAAGAGGGATGG + Intergenic
1166329581 19:42070216-42070238 CAGGAGAGAGAGAAGAGGGAGGG + Intronic
1166425584 19:42675777-42675799 AAGAAAAAAGAAAATTGGAAAGG - Intronic
1167002505 19:46754337-46754359 AAGAAAAAACAAAAGTGGGGTGG - Intronic
1168067513 19:53926912-53926934 CAGAAAAAAGAAGAGTGAGGGGG + Intronic
1168075891 19:53980867-53980889 TAGAATACAGAGAAGAGGGAGGG + Intronic
1168139256 19:54374397-54374419 CAGAACTAAGGGAACTGGGAGGG - Intergenic
1168158756 19:54493844-54493866 CAGAACTAAGAGAACTGGGAGGG + Intergenic
924992112 2:321137-321159 CAGAAAAATGAGAAGTGAGATGG - Intergenic
925020485 2:564203-564225 CAGAAAAAGGAAAGGTGGGAAGG + Intergenic
925125559 2:1453404-1453426 CGGAAAACAGGGGAGTGGGAAGG + Intronic
925407972 2:3619246-3619268 AAGAAAAAAGGAAAGTGGAAAGG - Intronic
925592396 2:5523267-5523289 GAGAAAAGAGAGAAGTAGGAAGG + Intergenic
926828382 2:16932768-16932790 CAGAAAAGGGGGAAGAGGGAAGG - Intergenic
927348877 2:22082432-22082454 CAGAAACTAGAGAGGTGGTAGGG + Intergenic
927367186 2:22311321-22311343 TAGAAAGAAAAGAAGTGTGAGGG + Intergenic
927717221 2:25360511-25360533 AAAAAAAAAAAAAAGTGGGAGGG - Intergenic
927798993 2:26079653-26079675 AAGAAAGAAGAGAAAAGGGAGGG - Intronic
928792774 2:34978514-34978536 TAGAAAAAACAGGAGTGGGTTGG + Intergenic
928857012 2:35814285-35814307 CAGAGAAAAGAGAGGAGAGAAGG - Intergenic
928877468 2:36056974-36056996 AAGAAAGAAGAGAGGAGGGAGGG + Intergenic
928948322 2:36791936-36791958 CAAAAAAAAAGGGAGTGGGAGGG + Intronic
928948383 2:36792257-36792279 CAGAGAGGAGAGAAGTGGCATGG - Intronic
928953484 2:36836692-36836714 CAGTAAAAAGAACAGTGGGCAGG + Intergenic
929113914 2:38428488-38428510 AAGAAAAAATAGAAGAAGGAGGG - Intergenic
929133875 2:38603756-38603778 CAGAAGAGAAAGAATTGGGATGG - Intergenic
929473085 2:42216219-42216241 AAAAAAAAAAAGAAGTGGGCCGG - Intronic
929619589 2:43341334-43341356 GAGAAAAATCAGAAGTGGGGTGG + Intronic
930755998 2:54973707-54973729 TACAAAAATGAGAAGTGTGATGG - Intronic
930791909 2:55341441-55341463 CAGAAAAAAAAAAAGGGGGCGGG - Intronic
930801825 2:55450751-55450773 CAGGAAAAAGAGAACAGGAAGGG + Intergenic
930802321 2:55455853-55455875 CAGGAAAAAGAGAACAGGAAGGG + Intergenic
930870732 2:56168229-56168251 CAAAAAAAGGAGAGGTGGAAGGG - Intergenic
930873197 2:56187064-56187086 AATAAAAAAGAGAAGGGAGAAGG - Intronic
931152095 2:59585689-59585711 GGGAAAAAAGAAAAGGGGGAGGG - Intergenic
931174075 2:59835325-59835347 AAGAAAAAAGAGAAGGGGGAAGG - Intergenic
931191192 2:60001989-60002011 AAGAAAAAAGAAAGGAGGGAGGG + Intergenic
931340520 2:61397088-61397110 AAGAAAAAAGAGAAGTTCAAAGG + Intronic
931705865 2:64945556-64945578 AGGAAAAAAGGGAAGAGGGAGGG - Intergenic
931905350 2:66836690-66836712 AAAAAAGAAGAGAAGAGGGAAGG + Intergenic
932155799 2:69416020-69416042 CAGAAAAAAGGAAAGGAGGAAGG + Intronic
932289797 2:70567177-70567199 CAAGATAAAAAGAAGTGGGAAGG - Intergenic
932518512 2:72380631-72380653 CTCAAAAAAGAGGAGAGGGAAGG + Intronic
933075139 2:77914962-77914984 AATAAAAATGAGATGTGGGATGG + Intergenic
933193706 2:79365649-79365671 AAAAAAAAAGGGAAGTGGGGGGG + Intronic
933256392 2:80085826-80085848 GAGAAAAGAGAGAAGGGTGAGGG + Intronic
933289264 2:80419860-80419882 CTGAAACAAAAGAAGTGGAAGGG + Intronic
933369302 2:81395062-81395084 AAGAAAATAAAGAAGGGGGAGGG + Intergenic
933583341 2:84152122-84152144 CAGAAAAAAAAGAAGAGTCAGGG + Intergenic
933808558 2:86017849-86017871 GGGAAAAAAGAGAAGGAGGAGGG - Intergenic
933917761 2:87013582-87013604 CTGAAGAAATAGAAGTGGGTTGG - Exonic
934005235 2:87756332-87756354 CTGAAGAAATAGAAGTGGGTTGG + Exonic
934632308 2:95940778-95940800 CAAAAAAATGTGAGGTGGGATGG - Intronic
934801194 2:97162507-97162529 CAAAAAAATGTGAGGTGGGATGG + Intronic
935163386 2:100548582-100548604 CAGAAAAAAGGGATGAGGAAGGG - Intergenic
935335709 2:102014028-102014050 CAAAAGAAAGAGAAGGGTGAGGG - Intronic
935547003 2:104410958-104410980 CTGAAGAAATAGAAGTGAGATGG + Intergenic
935768192 2:106390426-106390448 CTGAAGAAATAGAAGTGGGTTGG + Intergenic
935902831 2:107810953-107810975 GAGAAATAGGAGAAGTGGGGAGG + Intergenic
936259085 2:110942965-110942987 AAAAAAAAAGAAGAGTGGGAGGG + Intronic
936404198 2:112187699-112187721 CAGAAAAAAAAAAAGAGTGATGG - Exonic
936694825 2:114933612-114933634 TAGAAGAAAGAGAAATGTGAAGG + Intronic
936919802 2:117676266-117676288 CAGAAGCAAGAGCAGTGGGGAGG + Intergenic
937242216 2:120469549-120469571 AAAAAAAAAGATGAGTGGGAAGG + Intergenic
937284450 2:120741411-120741433 CAGAAGAGAGAGAAAGGGGAAGG - Intronic
937368004 2:121279003-121279025 CAAAAAAAAAAGGAGTTGGAAGG + Intronic
937392326 2:121500425-121500447 AAGAGAAAAGAAAAGAGGGAAGG + Intronic
937480105 2:122249378-122249400 CAGTCAGAAGAGAAGTGGGTAGG - Intergenic
937538981 2:122925386-122925408 AAGGTAAAAGAGAAGTGGCAAGG + Intergenic
937743924 2:125388217-125388239 CAGAAAGAAGTGAAATGGTATGG + Intergenic
938137165 2:128769048-128769070 TAGGAAGAAGAGAAGGGGGAGGG + Intergenic
938195741 2:129326069-129326091 AAGAAAAAAGAAAAGAAGGAAGG + Intergenic
938264659 2:129918632-129918654 GAAAAAAAAGAAAAGAGGGAGGG + Intergenic
938773820 2:134523732-134523754 CAGAGAAACGGGAAGTGGGGAGG + Intronic
938835339 2:135097208-135097230 AAAAAAAAAAAAAAGTGGGAAGG - Intronic
939054822 2:137352126-137352148 AATAAAAAAGAGAAGGGGGCAGG + Intronic
939059825 2:137408315-137408337 AAGATAAAGGAGAAGGGGGAAGG - Intronic
939556658 2:143682828-143682850 GCGAAAAAGGAGAAGTGGGTAGG - Intronic
939668566 2:144980780-144980802 GAGAAAAAGGAGATTTGGGAAGG - Intergenic
939755563 2:146105027-146105049 GATATAAAAGAGAAGAGGGAAGG - Intergenic
940424677 2:153516856-153516878 CTGTGTAAAGAGAAGTGGGAAGG - Intergenic
940656116 2:156489805-156489827 CAGGAAAGAGGGAAGAGGGAGGG - Intronic
940782558 2:157948533-157948555 CAACACAAAGAGAAATGGGATGG - Intronic
940832874 2:158487791-158487813 GAGAAGAGAGAGAAGGGGGAGGG + Intronic
941255483 2:163225629-163225651 CAGAAAGAAAAGAAAAGGGAGGG - Intergenic
941281378 2:163555861-163555883 CAAAAAACAGAGAAGGGAGAAGG + Intergenic
941950109 2:171146787-171146809 TCTAAAAAGGAGAAGTGGGAAGG - Intronic
942134009 2:172907333-172907355 CAGAATAGAGGGAAGAGGGAAGG - Intronic
942249899 2:174038683-174038705 AAGAGAAAAGAGAAACGGGAAGG - Intergenic
942457804 2:176149933-176149955 CAGAAGAAAAAGAAGCGAGAGGG - Intergenic
942861195 2:180614400-180614422 CAGTAATAATAGAAGTGGCATGG - Intergenic
942938216 2:181584348-181584370 CAGAAAAAAAAAAAGTTGGCTGG + Intronic
943344144 2:186717558-186717580 AAGGAGACAGAGAAGTGGGAGGG - Intronic
943498275 2:188652327-188652349 CTGAAAAAAGGGAAGTGTGGAGG - Intergenic
944177668 2:196850870-196850892 CAGCAAAAAAAGAACAGGGATGG + Intronic
944322058 2:198357783-198357805 CAGAAAAATCTGAAGTGGGGAGG - Intronic
944364277 2:198898264-198898286 AAGAAAAGAGAGAAGAAGGAAGG + Intergenic
944437654 2:199707206-199707228 CAGAAAATTGAGGAGTGGGGAGG - Intergenic
944547041 2:200809385-200809407 CAGAGAAAAGATAAGTGGCAAGG + Intergenic
944746779 2:202665166-202665188 AAGAAAAAAGAAAATTGAGAGGG - Intronic
944949447 2:204730588-204730610 AAAAAAAAAAAGTAGTGGGAAGG + Intronic
945195253 2:207231510-207231532 AAGAAAAAAAAGGAGGGGGAGGG + Intergenic
945554546 2:211262689-211262711 CAGAGAAAAGAGAGGAGAGAGGG - Intergenic
945829868 2:214770820-214770842 AATAAAAAAGAAGAGTGGGAGGG - Intronic
946492232 2:220159969-220159991 GAGGAAAAAGAGGAGTAGGAGGG - Intergenic
946523066 2:220487530-220487552 AAGAAAAAAGAGAAGTAGTTAGG - Intergenic
946577823 2:221095464-221095486 CAGAAAGCAGAAATGTGGGAGGG - Intergenic
946653514 2:221919687-221919709 CAGAAGGAAGAGAAATGGGAAGG + Intergenic
946762720 2:223010962-223010984 CAGGAAAAGTGGAAGTGGGAGGG + Intergenic
946765662 2:223037705-223037727 GAGAAAAAAGGGAGGTGTGATGG + Intergenic
946837487 2:223786912-223786934 CAAAAAAAAAAGAAGTGATATGG + Intronic
947154610 2:227149420-227149442 CAGAAAAGAGAGATGAGGAAGGG - Intronic
947161187 2:227216425-227216447 CAGAATAAAGAGATGCGGTAAGG - Intronic
947211822 2:227715621-227715643 CAGAATAAACAGAATTTGGAAGG - Intronic
947248341 2:228074976-228074998 GAGGAAAAAGAGAAGGAGGAAGG + Intronic
947478201 2:230471250-230471272 CAGAAAAATGAGAAGTGAGAAGG + Intronic
947673856 2:231960569-231960591 CAGAAAAAAAAAAAGAGAGAGGG - Intergenic
947695893 2:232188139-232188161 CAAAAAAAAGTGGAGGGGGAGGG + Intronic
947873568 2:233453353-233453375 CAGGACAAAGAGATGAGGGAAGG - Intronic
947959471 2:234222983-234223005 CAGGAAAGAGAGAAGTGCAAAGG + Intergenic
948309365 2:236973516-236973538 CAGGAAAAAGAGAAGTGATTTGG - Intergenic
948361426 2:237423193-237423215 CTAAAAAAAGAAAAGAGGGAAGG + Intronic
948620213 2:239229881-239229903 CAGGAAAAAGAGACCTGGAAAGG + Intronic
1168907524 20:1418022-1418044 CAGCAAAAAGAGCACTGGGTGGG - Intergenic
1168989253 20:2080167-2080189 CTGAAAAAAGAAAAAGGGGAAGG - Intergenic
1169095707 20:2896806-2896828 CAGAAATAAGTGAAGGGGAAAGG - Intronic
1169147713 20:3264353-3264375 CAGAAAAAAAAAAAGAGAGAAGG - Intronic
1169247782 20:4037536-4037558 AAAAAAAAAAAGGAGTGGGAAGG - Intergenic
1169259348 20:4124507-4124529 AAGAAAAAAGAGAGGGGGGCGGG - Intronic
1169267241 20:4174214-4174236 CAGAGACAAGAGAAGGGGCAAGG + Intronic
1169361818 20:4956789-4956811 AAAAAAAAAAAGAAGAGGGAAGG - Intronic
1169712231 20:8577727-8577749 CACAGAAAAGAGAACTGGCATGG - Intronic
1170039197 20:12022586-12022608 AAGAAAAAAGAAAAGTGAGTGGG - Intergenic
1170164522 20:13347440-13347462 CAGAAAGAAGAGACGTGGTTGGG - Intergenic
1170316669 20:15049298-15049320 AAGAAGAAAGAGAAGAGGGAGGG + Intronic
1170462785 20:16594012-16594034 AAGAAAAAAGAGAAGAGGAGAGG + Intergenic
1170709210 20:18775093-18775115 AAGAAAAGAGAAAGGTGGGAAGG - Intergenic
1170719014 20:18859084-18859106 CAAAAAAAAGAGAAGTTGCGTGG + Intergenic
1170901132 20:20464528-20464550 CAGACAAGAAGGAAGTGGGAGGG - Intronic
1171473137 20:25388078-25388100 AAAAAAAAAGAGAAGAGGGATGG + Intronic
1171991257 20:31698237-31698259 CAGAAAAAAGAGTCATTGGAGGG - Intronic
1172024230 20:31937104-31937126 AAAAAAAAAAAAAAGTGGGAGGG + Intronic
1172484649 20:35291053-35291075 CAGGAGAAAGAGAATTGGGAGGG - Intronic
1172493749 20:35362973-35362995 AAGAAAAGAAAGAAGGGGGAAGG - Intronic
1172766875 20:37355752-37355774 GAGAAAAAAAAGAAGGGTGAGGG + Intronic
1172917756 20:38456299-38456321 CAGACACAACAGTAGTGGGAAGG - Intergenic
1173122632 20:40307721-40307743 AAGAAAAAAGATAAAAGGGAAGG + Intergenic
1173673988 20:44817896-44817918 AAGAAAAAAGAGAACTAGGTAGG + Intergenic
1174373207 20:50108076-50108098 CTGTAATAAGAGCAGTGGGAAGG + Intronic
1174373497 20:50110329-50110351 CAGAACCAAAGGAAGTGGGAAGG + Intronic
1174709528 20:52690275-52690297 AAGAAAAAGGAGAAGGGGAAGGG - Intergenic
1175081204 20:56421835-56421857 AAGAAAAAAGGAAAGAGGGAAGG + Intronic
1175128995 20:56775112-56775134 CAGGAGAAAGAGAAGGGGGAGGG - Intergenic
1175280385 20:57800360-57800382 CAGAAACAAGAACAGTGAGAGGG - Intergenic
1175374708 20:58516043-58516065 CAGAAAAAAGAGAACCAGGAAGG + Intergenic
1175469883 20:59220008-59220030 GAGAGAAAAGAGGAGAGGGAGGG + Intronic
1175512856 20:59545787-59545809 AAGAAAAAAGTTAAGTGGAAGGG + Intergenic
1175925932 20:62471350-62471372 TTTAAAAAAGAGAAGTGGTAGGG - Intronic
1176334224 21:5580618-5580640 CAGAATAAAAAGAAGAGGGTTGG + Intergenic
1176393533 21:6240334-6240356 CAGAATAAAAAGAAGAGGGTTGG - Intergenic
1176404414 21:6349110-6349132 CAGAATAAAAAGAAGAGGGTTGG + Intergenic
1176432743 21:6639994-6640016 CAGAATAAAAAGAAGAGGGTTGG - Intergenic
1176467886 21:7075840-7075862 CAGAATAAAAAGAAGAGGGTTGG + Intronic
1176491447 21:7457618-7457640 CAGAATAAAAAGAAGAGGGTTGG + Intergenic
1176509195 21:7680765-7680787 CAGAATAAAAAGAAGAGGGTTGG - Intergenic
1176669649 21:9721015-9721037 CAGAAAAAAAATAGATGGGAAGG - Intergenic
1176740301 21:10595521-10595543 CAGGAACAAGAGAAGAGGGATGG + Intronic
1176968155 21:15235143-15235165 CAGGCAAAAGAGAAGAGGGCAGG - Intergenic
1177012470 21:15745050-15745072 CAGGAAAAGAAGGAGTGGGAAGG - Intronic
1177367720 21:20158845-20158867 CAGAAACAAGAAATGTGGAAAGG - Intergenic
1177592275 21:23185768-23185790 AAGAACAGAGAAAAGTGGGAAGG + Intergenic
1177670210 21:24214739-24214761 AAGAAAAGAGAGAAGGGGGAGGG + Intergenic
1177932919 21:27307270-27307292 CAGAAAAAAACAAAGTGGGAAGG + Intergenic
1178014159 21:28323779-28323801 CAGAACAAAGAGAAAAGAGAGGG - Intergenic
1178063537 21:28877616-28877638 GAGAAAAGAGAGAAATAGGAAGG + Intronic
1178158912 21:29888145-29888167 AAGAAAAAAGAAAGGAGGGAGGG - Intronic
1178304899 21:31483245-31483267 CATAAAACAAAGGAGTGGGAGGG - Intronic
1178452311 21:32713921-32713943 CATAATAAAGATAACTGGGAAGG + Intronic
1178564929 21:33675216-33675238 TAGAGAAATGAGAAATGGGAGGG - Intronic
1178579775 21:33828622-33828644 CAGAAAAAAAAGAAGAAAGAGGG - Intronic
1178691672 21:34755064-34755086 CAGGAAAAGGAGAAGAAGGAAGG + Intergenic
1179473285 21:41626327-41626349 TAGAAAAGAGAGGAGTGGGGCGG - Intergenic
1179579655 21:42333226-42333248 CAGAAAAAAAAGGAGTGGGGTGG - Intergenic
1181261824 22:21603545-21603567 AAAAAAAAAGACAAGTGGGCTGG + Intronic
1181371780 22:22424753-22424775 CAGGAATCAGAGATGTGGGAGGG - Intergenic
1181830699 22:25558220-25558242 CAGGGAGAAGGGAAGTGGGAGGG + Intergenic
1182025503 22:27115006-27115028 CAAAAAAAAAAAAAGTGGGAGGG + Intergenic
1182106856 22:27695833-27695855 AAGGAAAAAAAGAAATGGGAGGG + Intergenic
1182276015 22:29189150-29189172 AAGAAAAAAGAAAGGAGGGAGGG - Intergenic
1182334332 22:29573359-29573381 CATAAAAATGAGAAATGGGCCGG + Intronic
1182415742 22:30220534-30220556 TTGAAAAAAGAAAAGTGTGAAGG + Intergenic
1182455265 22:30446387-30446409 GGGAAAAAAGGGAAATGGGATGG - Intergenic
1182944128 22:34306059-34306081 AAAAAAAAAAAGGAGTGGGAGGG + Intergenic
1183008734 22:34927036-34927058 AAAAAAAGAGAAAAGTGGGAGGG + Intergenic
1183158936 22:36097510-36097532 CAGAAAGCAGAGTAGTGGGCTGG - Intergenic
1183251855 22:36735855-36735877 GAGAAAACAGAGAGGTGGAAGGG + Intergenic
1183538458 22:38416415-38416437 AAAAAAAAAGAAAAGTTGGATGG - Intergenic
1183660496 22:39217685-39217707 CAAAAACAAGAAAAGGGGGAAGG + Intergenic
1184045010 22:41967571-41967593 AAAAAAAAAAAGAAGAGGGATGG + Intergenic
1184116176 22:42423712-42423734 AAAAAAAAAGAAAAGAGGGATGG - Intronic
1184151127 22:42639323-42639345 CAAAAAAAAAAAAAGTGGGGGGG + Intronic
1184304621 22:43588618-43588640 CAGAAAAAATAGAACAGGGGAGG + Intronic
1184807627 22:46805695-46805717 CTGGAAACAGAGAGGTGGGATGG + Intronic
1184904363 22:47470603-47470625 AAGAAGAAAGAGAAGTGAAAAGG + Intronic
1184987885 22:48147762-48147784 CAGAAAAAAGAGAATGGAGCTGG - Intergenic
1185354270 22:50357404-50357426 AAGAAAAGAAAGAAGAGGGATGG - Intronic
949127947 3:469091-469113 GAGGAAAAGGAGAAGGGGGACGG - Intergenic
949567239 3:5256265-5256287 GAGAAAAAAGAGAAGGAGAAGGG - Intergenic
949662440 3:6294572-6294594 CAGATATAAGACAAGTGGAATGG + Intergenic
949722815 3:7010453-7010475 CTCTAAAAAGAAAAGTGGGAGGG + Intronic
949946397 3:9193286-9193308 GAGAAAAAAGAGCAATCGGATGG - Intronic
950183985 3:10933876-10933898 CAGAATAAAGAGCAGCAGGAGGG - Intronic
950480858 3:13242884-13242906 AGGAAAAAAGAGAAAAGGGAGGG + Intergenic
950701222 3:14749879-14749901 CATAAAGTAGAGAGGTGGGAAGG - Intronic
950704867 3:14773407-14773429 AAGAAAAAAGTGAGGGGGGAGGG + Intergenic
950753877 3:15155952-15155974 GGGAGAAAAGAGAAGTAGGAAGG + Intergenic
951268960 3:20602439-20602461 CAGGAAAGAGAGAAGAGTGAAGG - Intergenic
951306799 3:21073912-21073934 AGGAAAAAAGAGAAATGTGAAGG - Intergenic
951880469 3:27476676-27476698 TAGGAGAGAGAGAAGTGGGAAGG - Intronic
952064277 3:29549046-29549068 AAAAAAAAACAGAAGTAGGAGGG - Intronic
952405240 3:32999347-32999369 GGGAAGACAGAGAAGTGGGAGGG + Intronic
952782277 3:37113295-37113317 AAGAAAAAAAAGAAGTCAGAGGG - Intronic
952785252 3:37147896-37147918 CAGAAAAAAGAAAAAGGGAAGGG - Intronic
952934599 3:38386340-38386362 AAGAAAAAAGAAAGGTAGGAAGG + Intronic
952949925 3:38514767-38514789 CAAAAAAAAAAGCAGGGGGAGGG - Intronic
953020982 3:39112932-39112954 TAGAAAGAAGTGAAATGGGAAGG - Intronic
953150147 3:40317198-40317220 CAGAAGAAATTGAAGGGGGACGG + Intergenic
953196377 3:40738165-40738187 AATAAAAGAGAGAAATGGGATGG - Intergenic
954820164 3:53319328-53319350 AGTAACAAAGAGAAGTGGGAGGG + Intronic
955328097 3:58025086-58025108 AAGAAAAAAAAGAAATGGAAGGG - Intronic
955506116 3:59634872-59634894 CAGAAAACACAGAAGTAGGGTGG - Intergenic
955726782 3:61941713-61941735 CAAAAAAAGGGGAAGTTGGAGGG - Intronic
956599817 3:71008897-71008919 CAGAAAAAAGAGAGGTGGGGGGG - Intronic
956724425 3:72145492-72145514 CAGAAGGAAGAGAAGGAGGAAGG + Intergenic
956971532 3:74532008-74532030 CAGAAAAAACAGGAGAAGGAGGG + Intergenic
957049684 3:75401864-75401886 AAGAAAAAAGAAAAGTGAGTGGG + Intergenic
957178286 3:76841500-76841522 CAGGAAAAATAAAAGGGGGAGGG - Intronic
957432155 3:80124463-80124485 AGGAAAAAAGAAAAGTGGGGGGG - Intergenic
957447138 3:80327516-80327538 TAGAAAAAATAGAAGTGATAAGG + Intergenic
957759455 3:84536271-84536293 GAGAAAAAAGAAGAGAGGGAGGG + Intergenic
958425015 3:93969755-93969777 AAGAAAAAAGAGAGGAAGGAAGG - Intronic
958467252 3:94473144-94473166 AAAAAAAAAGAGAGGTGGCAGGG + Intergenic
958792585 3:98669232-98669254 AAGAAAAAAGAAAAGTTGGCTGG - Intergenic
958962621 3:100524410-100524432 GAGAAAAAAGATACATGGGAAGG - Intronic
959248367 3:103904963-103904985 CAGAAAAAGGAAAAGTAAGAAGG + Intergenic
959333736 3:105038415-105038437 ATGACAACAGAGAAGTGGGAAGG + Intergenic
959677340 3:109051220-109051242 CAGCAAAAAGAGAAATGGAGAGG - Intronic
960094002 3:113670605-113670627 AAAAAAAAAGGGAAGGGGGAAGG + Intronic
960340557 3:116469781-116469803 GAGAAGAAAGAGGAGTGAGAAGG + Intronic
960374974 3:116889557-116889579 AAGAATGAAGAGAAGTGGGTCGG + Intronic
960500899 3:118437158-118437180 AAAAAAAAAGAGAAATGGCAGGG - Intergenic
960538758 3:118842377-118842399 CAGAAAAAAGAAAAGGGGAGGGG + Intergenic
960547022 3:118927085-118927107 CAGGAAAAAAAAAAGTGGGTAGG + Intronic
960815627 3:121669007-121669029 AAGAAAAAAGATCAGTGAGATGG - Intronic
960826957 3:121797493-121797515 AAAAAAAAAAAGGAGTGGGATGG + Intronic
961004610 3:123396591-123396613 AAGAAAAAAGAGAGAAGGGAGGG + Intronic
961010455 3:123432341-123432363 CTGCAAAGAGAGAAGTGGGGAGG + Intronic
961095167 3:124148296-124148318 CAGAAATAGGATAACTGGGAAGG + Intronic
961144519 3:124583239-124583261 CAGAAAAAAGGGAAGTTTGTGGG - Intronic
961159399 3:124709991-124710013 CAGCAACAATAGAAGTTGGAAGG + Intronic
961203676 3:125063853-125063875 GAGAAGAAACAGAAGAGGGAAGG - Intergenic
961771245 3:129251679-129251701 AAAAAAAAAGAGAAGTGGCCGGG - Intronic
961882002 3:130068303-130068325 AAGAAAAAAGAAAAGTGAGTGGG + Intergenic
963006011 3:140726780-140726802 GAGAAAGAAGAGAAGAGTGAGGG + Intergenic
963015591 3:140821032-140821054 CATAAAAAAGGGATTTGGGAAGG + Intergenic
963400021 3:144786534-144786556 CAAAAACAAGAAATGTGGGAAGG - Intergenic
963410419 3:144920891-144920913 CAGAAACATGAGAACAGGGAAGG + Intergenic
963476199 3:145807835-145807857 CAGAGAAGAGTGAAGTGAGAGGG - Intergenic
963492170 3:146015718-146015740 CAGAAACAAGAGAAGAGCAAAGG - Intergenic
963718918 3:148837490-148837512 AAAAAAAAGGAGAAGTTGGATGG + Intronic
963826902 3:149965717-149965739 CGGGAAAAAGAGAAGAGTGAAGG + Exonic
963902054 3:150742394-150742416 GAGAAACAAGAGAAGTACGAAGG - Exonic
964001535 3:151779517-151779539 GAGCTATAAGAGAAGTGGGAAGG + Intergenic
964471727 3:157064059-157064081 CAGATGAAAAAGAAGTGGGGAGG - Intergenic
964558165 3:157963962-157963984 CAGAAAAAAAAAAAGGGGGGCGG + Intergenic
964698173 3:159533627-159533649 CAGAGAACAGAGATGTGGGGGGG - Intronic
965247624 3:166294326-166294348 CAGAAAAAAGAAAATGGTGATGG + Intergenic
965349781 3:167598322-167598344 AAGAAAAAAGAAATGTGAGAAGG + Intronic
965465579 3:169026561-169026583 CAAAAAAAAGGGAGGGGGGAGGG - Intergenic
965567556 3:170136884-170136906 AAGAGAAAAGAAAAGAGGGAGGG + Intronic
966481092 3:180410134-180410156 ATGAAAAAAATGAAGTGGGATGG + Intergenic
966798989 3:183744834-183744856 AAAAAAAAAGAATAGTGGGAAGG - Intronic
966854129 3:184182630-184182652 CAGAACAAGGAGAAGTGGTCAGG - Intronic
967111142 3:186295070-186295092 CAGCAAAAAGAGAAACTGGAAGG - Intronic
967193724 3:187008355-187008377 AAGAAAAAAGAGAAAAGGAAAGG + Intronic
967407883 3:189137758-189137780 CAGAGACACGAGAAGGGGGAAGG - Intronic
967458852 3:189721998-189722020 AAGAAAGTAGAGAAGTAGGAAGG + Intronic
967697516 3:192550134-192550156 TAGAAAAAAGGAAATTGGGATGG + Intronic
968053334 3:195671781-195671803 TAAAAAAAAAAGAAGTCGGATGG + Intergenic
968102479 3:195976580-195976602 TAAAAAAAAAAGAAGTCGGATGG - Intergenic
968152764 3:196351694-196351716 AAGAAGAAAGAGAAGTGTGAAGG + Exonic
968207927 3:196821134-196821156 TAAAAAAAAGAGAAGTGGCCAGG - Intronic
968726590 4:2250747-2250769 CAGAAAAGGGAGAAATGGGCTGG - Intronic
969199308 4:5589971-5589993 TAGAGAAAAGAGAAGGTGGAGGG + Intronic
969202582 4:5617733-5617755 CAGAGAAAACAGAAGTTCGAAGG + Intronic
969372633 4:6743515-6743537 AAGAAAAAGAAGAAGGGGGAGGG - Intergenic
969475149 4:7418118-7418140 CAGAAAAAAGGGAAGGAGGAAGG - Intronic
969581165 4:8066320-8066342 AAGAAAAAAGAAAGGAGGGAGGG + Intronic
969584977 4:8086341-8086363 AAAAAAAAAAAAAAGTGGGAGGG - Intronic
969692899 4:8715435-8715457 CAGAAAATAGAGGAGGAGGAAGG - Intergenic
970103783 4:12556765-12556787 CAGAACTAAGAGAAGTGAGAGGG - Intergenic
970117162 4:12710292-12710314 CAGAAAGAAGAAAAGGGGCAGGG - Intergenic
970213146 4:13731663-13731685 CAGAGATAAGAGAAGAGGCAGGG + Intergenic
970852535 4:20618170-20618192 CAGACAAAGGAGAAGGAGGAAGG - Intronic
971328396 4:25662914-25662936 CAGAACAATGAAAAGGGGGAGGG - Intronic
971435137 4:26613419-26613441 CAGAAAAGAGAGATGAGGAAAGG + Intronic
972572627 4:40324755-40324777 CAGAAAACAAAGTAGTGGGAAGG - Intergenic
972577423 4:40364698-40364720 CAAAAAAAAAAAAAGTGGGGAGG - Intergenic
972701211 4:41495837-41495859 AAGAAAGAAGAGCAGTGGGGAGG - Intronic
972838464 4:42903660-42903682 GGGAAAAAAGAAAAATGGGAAGG - Intronic
972921884 4:43952833-43952855 AATAAAAAAGAGTAGTGAGAAGG - Intergenic
972927041 4:44022426-44022448 GAGAAAAAAGAGGAAAGGGAAGG + Intergenic
973184264 4:47306283-47306305 GAGGAAAAAGAAAAGAGGGATGG + Intronic
973779068 4:54271623-54271645 AAGGAAAAAGGGAAGAGGGAAGG - Intronic
973848551 4:54937788-54937810 CAGACAAACAAGGAGTGGGAGGG + Intergenic
974013596 4:56629223-56629245 CAGAAAATAGATAAGTGGTTGGG + Intergenic
974047827 4:56912171-56912193 CACAAAAAAGAAATGTGAGAAGG + Intronic
974292621 4:59952457-59952479 CAGAAAAAGGTGAAGAGAGATGG - Intergenic
974428546 4:61768773-61768795 CAGAGAAAAGAGTAGAGGCACGG + Intronic
974607349 4:64170767-64170789 CAGAAAAATGAGAATTTGCAAGG + Intergenic
974622387 4:64375905-64375927 CAGAAAAAAAAGTATTGCGATGG - Intronic
975470684 4:74762605-74762627 AACAAAAAAGTGAAGAGGGAAGG + Intronic
975870017 4:78769630-78769652 AAAAAAAAAAAGAAGAGGGAGGG + Intergenic
975926716 4:79464122-79464144 GAGAAAACAGAAAAGAGGGAGGG + Intergenic
976022976 4:80653086-80653108 CTGAGAAAAGAGATGTAGGATGG - Intronic
976045295 4:80939851-80939873 AGGAAAAAAGAGCAGTGGGGTGG - Intronic
976102912 4:81584401-81584423 CAGAAAAGAGAGAAAGGGAAAGG + Intronic
976762777 4:88568502-88568524 AAGAAAAAAGAAGAGTGAGAAGG - Intronic
976838136 4:89399429-89399451 CTGAAAAAATAGAAGTGGTTGGG + Intergenic
977048303 4:92094414-92094436 AAGGATAAAGAGAAGAGGGATGG - Intergenic
977198578 4:94089108-94089130 CAGAAAAAAGAGTAGAGACACGG + Intergenic
977331772 4:95645395-95645417 CAGACATAAGAGAAATTGGATGG + Intergenic
977879404 4:102187003-102187025 AAGAAAAAAAAGAAAGGGGACGG + Intergenic
977968389 4:103183511-103183533 AAGAAAAAAATGAAGAGGGAGGG + Intronic
978227744 4:106358369-106358391 CAGAAAAAATAGAAGAGGCTGGG - Intergenic
978326062 4:107557530-107557552 CAGAAAACAGAGAAATAGCAGGG - Intergenic
978367217 4:107995045-107995067 CAGATAAGAGAGAAGGGAGAGGG - Intronic
978398198 4:108305012-108305034 CAACAATAAGAGAAGTGTGATGG + Intergenic
978878507 4:113671527-113671549 CAACACAAAGAGAAGTGCGATGG - Intronic
979216342 4:118169495-118169517 CAGAAAAACCTGAAGTGGGCCGG + Intronic
979242950 4:118465050-118465072 CAAAGAAAAGAGAAATGGAAAGG - Intergenic
979406098 4:120312188-120312210 CTACAAACAGAGAAGTGGGAAGG - Intergenic
979442723 4:120770451-120770473 AAAAAAAAAGAGAAATGAGAAGG - Intronic
979466050 4:121039778-121039800 CGGAGATAAGGGAAGTGGGAGGG - Intronic
979549926 4:121979228-121979250 CAGAGAAAAAAGTAGAGGGAAGG + Intergenic
979670062 4:123352219-123352241 CAGAAATAAGGGGAGTGGGAAGG + Intergenic
979774596 4:124573362-124573384 CAGAAAGAAGGGACGTGGGAAGG + Intergenic
979895313 4:126149621-126149643 CAGAAAAAAGAGTAGAGACACGG + Intergenic
980211777 4:129797746-129797768 AACAAAAAAGAGAATTGGGTGGG + Intergenic
980928640 4:139163897-139163919 CAAAAAAAAAGGAAGTAGGAAGG + Intronic
981049388 4:140295551-140295573 CAGCAAGGAGAGAAGTGAGACGG + Intronic
981138796 4:141242886-141242908 AAGAATAAAGAGAAGTTGGCTGG - Intergenic
981140287 4:141259762-141259784 AAGACAATAGAAAAGTGGGAAGG + Intergenic
981720635 4:147797929-147797951 CAGGACAAAGAGGAGAGGGATGG - Intronic
981850708 4:149226827-149226849 AACAAAATACAGAAGTGGGATGG - Intergenic
982640954 4:157959681-157959703 CAGAAAAAAAGTATGTGGGATGG + Intergenic
982663961 4:158238318-158238340 CAGATAAAGGAGAATTTGGAGGG + Intronic
982792131 4:159605374-159605396 TAAAAAAAAGAGAAGTAGGGTGG + Intergenic
982858939 4:160423873-160423895 CAGAAAAAAATGAAAAGGGATGG - Intergenic
982865463 4:160505182-160505204 GAGAAAAAAGAGCAGTTGAAAGG - Intergenic
982973039 4:162015278-162015300 AAGAAAAAAGGGAAGTGTGACGG + Intronic
983028767 4:162771921-162771943 CAGAACAAAGAGAAGAGGAGAGG + Intergenic
983057998 4:163122340-163122362 CAGAACAAAAAGAAGTGGAGAGG + Intronic
983091887 4:163513857-163513879 GAGAAGAAAGAGGAGTGGGAGGG - Intronic
983274977 4:165605782-165605804 CAGAATACAGAGAAGGAGGAAGG + Intergenic
983299312 4:165904870-165904892 CATCAAAAAGAGAAATTGGACGG + Intronic
983621510 4:169766158-169766180 CAGAAGAAACAGATTTGGGAAGG + Intergenic
983642119 4:169952724-169952746 CAGAAACTTGAGACGTGGGATGG - Intergenic
983659288 4:170116889-170116911 CAGAACAAAGAGTAGGAGGACGG - Intergenic
984103774 4:175518332-175518354 AAGAAGAAAGAGAAGTTAGAAGG - Intergenic
984277689 4:177629071-177629093 CAAAAAAAAGACATGTAGGACGG - Intergenic
984968493 4:185164597-185164619 CAGAAAAGAGAGATGAGGAAGGG - Intronic
985150081 4:186937918-186937940 GAAGAAACAGAGAAGTGGGAGGG + Intergenic
985516858 5:350781-350803 AAAAAAAAAAAGAAGTGGAAAGG + Intronic
986701342 5:10412483-10412505 GTGAAAAAAAGGAAGTGGGAAGG + Intronic
986748974 5:10768448-10768470 CAGAGAAATGGGAAGTGGTAAGG + Intergenic
986853098 5:11835862-11835884 GAAAAAAAAGAAAAGAGGGATGG - Intronic
987011787 5:13773854-13773876 CAGACAAAGGAGGAGTGGGTGGG + Intronic
987018266 5:13843402-13843424 GAGCAAAGAGAGAAGGGGGATGG - Intronic
987168865 5:15231693-15231715 AAAAAAAAAAAAAAGTGGGAGGG - Intergenic
987201953 5:15586271-15586293 GAGAAAGAAGACAAGGGGGAGGG - Intronic
987339047 5:16923044-16923066 AAGGAAAAAGAGAAGAGGGGAGG + Intronic
987427331 5:17788220-17788242 ATGAAAAAAGAGAAGACGGAGGG - Intergenic
987487354 5:18539535-18539557 CAGAAAAAAGAGTAGAGACATGG - Intergenic
987719952 5:21620173-21620195 CAGGAAAAAAAAAAGTGGGGGGG + Intergenic
988080767 5:26411508-26411530 GAGAAAGAAGAGATTTGGGAGGG + Intergenic
988213325 5:28237823-28237845 AAGAAAAAAGAAAAGAAGGAAGG - Intergenic
988290492 5:29278080-29278102 AAGAACAAAGAGAAATGGGTAGG - Intergenic
988687095 5:33535798-33535820 GGGTAAAAAGAGAAGTGGGAGGG + Intronic
988718215 5:33848767-33848789 ACTGAAAAAGAGAAGTGGGAGGG + Intronic
988903734 5:35762845-35762867 CAGCAATAAGGGAAGAGGGAGGG + Intronic
989087877 5:37695157-37695179 CAGGAGTAAGAGAAGGGGGAGGG + Intronic
989248769 5:39283158-39283180 AAGAAGTTAGAGAAGTGGGATGG - Intergenic
989512697 5:42306533-42306555 CAGACAAAGGAGAAGTTGGAAGG + Intergenic
989662946 5:43818909-43818931 CAGAAACCAGAGAACAGGGAAGG - Intergenic
989992456 5:50783171-50783193 GGGAAAAGAGAGAAGAGGGAAGG + Intronic
990136230 5:52646701-52646723 AAGAAGGAAGATAAGTGGGAGGG - Intergenic
990367074 5:55082038-55082060 CAGAAAAAAAAAAAGGGGGGGGG - Intergenic
990830504 5:59951928-59951950 CAGAGAAAGGAGAAGTGAGGAGG - Intronic
991001989 5:61792128-61792150 CAGAAAAAAGAGATGAGTGCTGG + Intergenic
991248076 5:64528824-64528846 AAAAAAAAAAAAAAGTGGGAGGG + Intronic
992797300 5:80264614-80264636 AAGAAAAAAGGGAAGGGGAAGGG - Intergenic
992861813 5:80918949-80918971 AAGAAAAAAGTGAAGGAGGAAGG + Intergenic
993196772 5:84758463-84758485 CAGGTAAAAGAGAAGTGAGCAGG - Intergenic
993332457 5:86617676-86617698 AAGAAAGAAGAGAAAAGGGATGG + Intergenic
993399774 5:87434494-87434516 TAGGAAAAAGAGATGTGGCAGGG + Intergenic
993477972 5:88388511-88388533 GAGAAAGAAGGGAAGTGGGGAGG + Intergenic
993516245 5:88838716-88838738 AAGGAAAAAGAGGAGTGGCAAGG - Intronic
993744819 5:91583861-91583883 CAAAAAAAAAAGAATTAGGATGG + Intergenic
994162173 5:96568945-96568967 CAGAAAATAGAAGAGTGGGCTGG + Intronic
994243437 5:97450617-97450639 GTGAAAAAGAAGAAGTGGGAAGG - Intergenic
994285517 5:97960497-97960519 AAGGAAACAGAGAAGGGGGAAGG + Intergenic
994286612 5:97976510-97976532 CTGAAATCAGAGAAGTGGGTTGG - Intergenic
994354505 5:98779911-98779933 CACAAAAAAGGTAACTGGGAGGG - Exonic
994456149 5:100010684-100010706 CAGGAAAAAAAAAAGGGGGACGG + Intergenic
994674512 5:102804009-102804031 GAGAAACAGGAGAAGTGTGAGGG + Intronic
994710135 5:103256347-103256369 GAGAAATAAGAGAAGAGGCAGGG - Intergenic
994715398 5:103315549-103315571 CAGAAAGTAGAGAAGTAGTAAGG + Intergenic
994753856 5:103770851-103770873 GAGAAAGAAGAGAAGAGGGATGG + Intergenic
995015111 5:107301195-107301217 CAAAAAAGACAGAAGTTGGAGGG + Intergenic
995311846 5:110722083-110722105 CAGAAGATAGAGATGTGGTAGGG + Intronic
995422369 5:111981885-111981907 AAAAAAAAAAAGAAGTGGCATGG - Intronic
995636991 5:114204145-114204167 TAGAAAAAATAAAAGTGGTAAGG + Intergenic
995714495 5:115068784-115068806 CAGAAAAAGGAGAAGAGGAGGGG - Intergenic
995850230 5:116537240-116537262 CAGAAAAGTTAGAACTGGGAAGG + Intronic
995980243 5:118093160-118093182 GAGAAGAAAGAGAAGAAGGAAGG + Intergenic
996116461 5:119625430-119625452 CAGAAAGAAGAGGAGGAGGAGGG - Intronic
996339311 5:122418680-122418702 AAGAAAAAAGAGAATTTGAAAGG + Intronic
996354494 5:122580914-122580936 AAGAGAAAAGAAAAGAGGGAAGG - Intergenic
996383121 5:122882534-122882556 CAGAACAAAGAGATGAGGGCAGG - Intronic
996393241 5:122986480-122986502 CAGAAAAAAGAGAAGTGGGAGGG + Intronic
996577986 5:124997715-124997737 AAGAAAAAAGAAAAAAGGGAGGG - Intergenic
996761825 5:126993744-126993766 AAGAAAGGAGAGAAGTGGAATGG - Intronic
996886600 5:128363187-128363209 CAGAAAAAAGAAAAGAGAAAAGG - Intronic
997121483 5:131177809-131177831 GAGAGAAAAGAGAAAAGGGAGGG - Intronic
997338487 5:133124182-133124204 AAGAAGAAAGAAATGTGGGAGGG + Intergenic
997446194 5:133942146-133942168 AAGAAAAAAGAAAAGTGGCCAGG + Intergenic
997654953 5:135547734-135547756 GAGATAAAAGTGGAGTGGGATGG + Intergenic
997708853 5:135986124-135986146 GAGAAGAAAGGGAAGAGGGAAGG - Intergenic
997834001 5:137177784-137177806 GAGAGAAATGAGGAGTGGGAGGG + Intronic
997913660 5:137901998-137902020 GAAAAAAAAAAAAAGTGGGAGGG + Intronic
998079161 5:139260404-139260426 AAGAAGCAAGAGAAGTGGGTGGG - Intronic
998189495 5:140011006-140011028 CAGGACAAACAGTAGTGGGAGGG - Intronic
998412376 5:141921358-141921380 CTGAAAGGAGAGAACTGGGAAGG + Intergenic
998495822 5:142588469-142588491 GAGAGAAGAGAGAAGAGGGAGGG - Intergenic
998701804 5:144711307-144711329 GTGAGAAAAGAGAAGTGGGAAGG - Intergenic
998752234 5:145335154-145335176 GAGAAAAAAGAAAAGAGTGAAGG - Intergenic
998947482 5:147355322-147355344 CAGACAAAGGAGAAGAGAGAAGG - Intronic
998993894 5:147849533-147849555 CAAAAGAAATAGAAGTTGGAAGG - Intergenic
999213982 5:149916159-149916181 AAGAAAAAAGAGAAGGTAGACGG - Intronic
999256321 5:150211674-150211696 CCAAACAAAGAGGAGTGGGAGGG - Intronic
999524491 5:152389176-152389198 GAGAAGAATGAGAAGAGGGAGGG - Intergenic
999530165 5:152454429-152454451 CAAAAAAATGAGAAGTAGCAAGG - Intergenic
1000116335 5:158157293-158157315 AAGAAAAAAGAAAGGTGGAATGG - Intergenic
1000451524 5:161394808-161394830 CAGAAAATAGAGAAGGAAGATGG + Intronic
1000628720 5:163567747-163567769 AAGAAAGAATAGAAGAGGGAGGG - Intergenic
1000964159 5:167635366-167635388 AAGAAAAAAGAAAGGTGGGCAGG - Intronic
1001220459 5:169895905-169895927 CAGAAAATAGGGAAGAAGGAAGG - Intronic
1001350576 5:170959476-170959498 CAGAAGAAAGAGAAGTGCAAAGG - Intronic
1001421436 5:171590201-171590223 GAGAAAAAAGGGAAGTAGGAAGG - Intergenic
1001506585 5:172284344-172284366 GTGAGAAAAGAGGAGTGGGAAGG + Intergenic
1001735337 5:173993651-173993673 AAGAAAAAAGAAAAGTGATAGGG + Intronic
1001798578 5:174523487-174523509 TAAAGAAAAGAGAAGAGGGAAGG + Intergenic
1001817322 5:174680900-174680922 CAGAAGAAAGAAAAATGAGACGG + Intergenic
1002153192 5:177253625-177253647 GAAAAAAAAGAAAAATGGGAGGG - Intronic
1003091970 6:3111929-3111951 AGGAAAGAAGAGAGGTGGGAAGG + Intronic
1003501764 6:6709043-6709065 CAGAAACAAGAAAAGTGTGATGG + Intergenic
1003543607 6:7039764-7039786 TAAAAAAAAGAGAAGTCGGCTGG - Intergenic
1003574047 6:7276588-7276610 CAAAAAACATAGAAGTGGGCCGG + Intronic
1003674893 6:8193854-8193876 TAGAACAAATAGAAGTGGGGAGG - Intergenic
1003838029 6:10092527-10092549 CAAAAAAAAGAAATGTGAGAAGG - Intronic
1003883597 6:10500403-10500425 AAAAAAAAAGAGAAACGGGAGGG + Intronic
1003999193 6:11579141-11579163 CAGGAAAATGAGAATTTGGAGGG - Exonic
1004080190 6:12384636-12384658 CAGAAAAAAAAAAAGTGGGCAGG - Intergenic
1004208076 6:13611028-13611050 TAGAAAAAAGAGAAAGAGGAAGG - Intronic
1004217027 6:13712095-13712117 CAAAAAGAAGTCAAGTGGGAGGG - Intergenic
1004329313 6:14707432-14707454 AAGAAATAAGGGAAGTTGGAAGG - Intergenic
1004333616 6:14743832-14743854 AAGAAAGGAGAGAAGGGGGAAGG + Intergenic
1004379369 6:15119017-15119039 AAAATAAAAGAGAAGTGGGGTGG - Intergenic
1004389480 6:15198059-15198081 CAGAAGAAGGAGAAGGGGCATGG + Intergenic
1004432934 6:15562649-15562671 AACAAAAAAGAGAAGTGTGCCGG + Intronic
1005164909 6:22908740-22908762 AAAAAAAAAAAGAATTGGGAGGG - Intergenic
1005402703 6:25450868-25450890 AAGAAAAAAGAGAAAAGAGAAGG - Intronic
1005726218 6:28651248-28651270 CAAAAAAAAAAGTAGGGGGATGG + Intergenic
1006101394 6:31688309-31688331 CAGAGAACAGAGCAGTGGGAAGG + Intronic
1006575030 6:35038779-35038801 CAGAAAAAGGAAAAGTGGCCAGG - Intronic
1006697478 6:35943474-35943496 CAGAATACAGAGAAGGGAGAAGG + Intergenic
1006901307 6:37503788-37503810 CAGAAACAAGAGAATGGGGTGGG + Intergenic
1007134499 6:39508015-39508037 AAGAAAAAAGAGAAGAGGGAGGG - Intronic
1007899443 6:45396700-45396722 CAGAAAGAAGATTAGTGGGATGG - Intronic
1007950272 6:45866023-45866045 CAGAAAAAGGAGAGAAGGGAAGG - Intergenic
1008101614 6:47397855-47397877 CAGAAGAAAAAGAAGATGGAGGG + Intergenic
1008225146 6:48905908-48905930 TAAAAAAAAAAAAAGTGGGAAGG - Intergenic
1008256673 6:49310380-49310402 AAGAAAAAAAAAACGTGGGATGG + Intergenic
1008258099 6:49329594-49329616 AGGAAAAAAGAGAAGTGAGAGGG - Intergenic
1008419974 6:51287125-51287147 AAGAAAAAAGAGAGGAAGGAAGG + Intergenic
1008546471 6:52588069-52588091 AAGTAAAAAGAGAAGAGGAAAGG + Intergenic
1008892015 6:56505484-56505506 AAAAAAAAAAAGAAGAGGGAGGG + Intronic
1009514533 6:64598163-64598185 AAGAAAAAAGAGAAGGGGCCAGG + Intronic
1009514935 6:64603265-64603287 AAGAAAGAAGAGAAGGAGGATGG - Intronic
1009519691 6:64665713-64665735 TGGAAAAAAGAAAAGCGGGAGGG - Intronic
1009968398 6:70601807-70601829 GAGAAAAACCAGCAGTGGGAAGG - Intergenic
1010084991 6:71906741-71906763 CACAAATAAGACAATTGGGAGGG - Intronic
1010098793 6:72078442-72078464 CAGAAAAAAGGGAACTTGCAAGG - Intronic
1010243539 6:73640749-73640771 AATACAAAAGAAAAGTGGGAAGG + Intronic
1010298681 6:74232175-74232197 AAGAAAAAAGAAAAGATGGATGG - Intergenic
1010489337 6:76454667-76454689 CTGAGAAAAGAGAACTGGCAGGG - Intergenic
1010749639 6:79603791-79603813 AAGAAAAAAGAAAAGTGGTCTGG - Intergenic
1010982307 6:82382100-82382122 CAAAAAAAAAAGAGGGGGGAGGG - Intergenic
1011445419 6:87434099-87434121 CAAAAAAAAAAGGAGTGGAAGGG + Intronic
1011527944 6:88286662-88286684 GAGAAAAAAGAGAAATGAGAAGG - Intergenic
1011791449 6:90903348-90903370 CAGAAGAATGAGATGTGAGAAGG + Intergenic
1011930510 6:92705400-92705422 CAGAGACGAGAGAAGTGGTATGG + Intergenic
1012140007 6:95614874-95614896 CAGGGAAAAGAGAAGGAGGAGGG - Intergenic
1012531120 6:100237681-100237703 AAGATAAAAGAGAATTGGGATGG + Intergenic
1012563532 6:100617353-100617375 CAGATAAAAGAACAGAGGGAAGG - Intronic
1012676386 6:102118286-102118308 CAGAAAGAAGAGAAGAGAAAAGG + Intergenic
1012957119 6:105583103-105583125 AAAAAAAAAAAAAAGTGGGAGGG - Intergenic
1013051278 6:106537979-106538001 AAGAAAAAAGCAAAGAGGGAGGG + Intronic
1013080601 6:106808659-106808681 CAGAAAAGATAGAAGGGGAAAGG - Intergenic
1013112481 6:107075085-107075107 AAAAAAAAAAAGAAGAGGGAAGG + Intronic
1013116166 6:107105384-107105406 AAAAAAAAAAAGAACTGGGATGG + Intronic
1013348236 6:109282957-109282979 AAGAGAAAAGAGAAGAGGGGAGG - Intergenic
1013497451 6:110712581-110712603 AAGACAAGAGTGAAGTGGGATGG - Intronic
1013541757 6:111117363-111117385 AAAAAAAAAAAAAAGTGGGAGGG + Intronic
1013627657 6:111953490-111953512 CAGAAAAAAAAAAAGTTGAAAGG - Intergenic
1013997244 6:116322817-116322839 GAGAAGAGAGAGAAGTGGCAGGG + Intronic
1014155174 6:118101584-118101606 AAAAATAATGAGAAGTGGGATGG + Intronic
1014203489 6:118629845-118629867 TAGAAAGGAGAGAAGTGGGTTGG - Intronic
1014642070 6:123924605-123924627 CAGTAGAAAGAGAACAGGGATGG + Intronic
1015041687 6:128728158-128728180 CAGAGAAAAGAGGAGAGAGATGG - Intergenic
1015111454 6:129596449-129596471 CAGAACAAGGGGAATTGGGAAGG - Intronic
1015429195 6:133110394-133110416 CACAAAGAAGAGGAGTGGGTAGG - Intergenic
1015486819 6:133781002-133781024 AAGAAGAAAGGGAAGTGGGTAGG + Intergenic
1015508996 6:134018889-134018911 GAGAAGATAGAGAAGTGGTAGGG - Intronic
1015530614 6:134217946-134217968 CATAAATAAGTGAAGTGGGTTGG - Intronic
1015532269 6:134232493-134232515 AAGAAAAGAAAGAAGAGGGAGGG + Intronic
1015654227 6:135498375-135498397 CAGAAATCAGAAAAGTGGGAGGG - Intergenic
1015828061 6:137336733-137336755 CAGTAAAAAGACCAGTGGGCTGG - Intergenic
1015882559 6:137883640-137883662 CAGGAAAGAGAGAAGTAGGCAGG + Intergenic
1015906304 6:138120821-138120843 CAAAAGAAATAGACGTGGGAGGG - Intergenic
1015957203 6:138611074-138611096 CAAAAAAAAAAAAAGTGGCAAGG + Intronic
1016430705 6:143982349-143982371 CAGAAACAAGAAAACTGGTATGG + Intronic
1016734412 6:147461022-147461044 CAAAAACAAGCAAAGTGGGAAGG + Intergenic
1016772805 6:147870784-147870806 AAGAAAAAAGGGAAGAGGGAAGG + Intergenic
1017081495 6:150673663-150673685 CTGAAAAAGGAGGAGAGGGAGGG - Intronic
1017084706 6:150703170-150703192 TAGGAAGGAGAGAAGTGGGAAGG - Intronic
1017398114 6:154027701-154027723 AAGAAAAAGGAAAAGTGGGAAGG - Intronic
1017726480 6:157279598-157279620 GAGAAAAAAGAAAAGAAGGAGGG + Intergenic
1017786074 6:157758241-157758263 AAGAAAAAAGAGAGGAAGGAAGG + Intronic
1017805414 6:157941438-157941460 CAAAAAAGCGAGATGTGGGATGG + Intronic
1018129035 6:160710601-160710623 CTGAAGAAATAGAAGTGGGTTGG + Intronic
1018204391 6:161423711-161423733 CAGGAACAAGAGCAGTGGAAGGG - Intronic
1018398788 6:163402004-163402026 GAGAAAAGAGACAGGTGGGAGGG + Intergenic
1018648204 6:165967653-165967675 CAGAAAATAGAGAAGTGTCTTGG + Intronic
1018704267 6:166450948-166450970 CAGAACAATGGGAAGTGTGAGGG + Intronic
1018719269 6:166560623-166560645 CAGAAAAAAGAGAAATGGGGTGG + Intronic
1019026267 6:168966125-168966147 CAGAGAAAAGAGGAGAGGGGAGG - Intergenic
1019041080 6:169106737-169106759 CAGAAGAAAGAAAAGAGGGGAGG - Intergenic
1019779294 7:2930105-2930127 CAGAGAAAGGAGAAGGGGGCCGG + Intronic
1019785205 7:2972408-2972430 CAGAAGAAAAAGAAGTAGGGTGG + Intronic
1020028473 7:4916363-4916385 AAAAAAAAAAAAAAGTGGGACGG - Intronic
1020376528 7:7493658-7493680 AAGAAAAAGGGGAAATGGGAAGG - Intronic
1020534147 7:9372999-9373021 CAGAAACAGGGGAAGTGGGAGGG - Intergenic
1020728202 7:11843736-11843758 TAGAAAAGAGAGAAGGGGGCAGG - Intergenic
1020812386 7:12863571-12863593 CAAAAAGAAGAGAAGAGAGAAGG - Intergenic
1020875166 7:13684499-13684521 CCAAACAAAGAGAAGTGGCAAGG - Intergenic
1020908585 7:14098365-14098387 CACAGAAAAGAGAGGTGGTAGGG - Intergenic
1021007833 7:15422046-15422068 CTGAAAAAAAATAAGTGAGATGG + Intronic
1021294120 7:18882645-18882667 CAAAAAAAAAAAAAGTGGGTGGG + Intronic
1021432425 7:20575770-20575792 CAGGAAATAGAAAAGTGAGAAGG - Intergenic
1021805490 7:24350505-24350527 CAGATAAGAGAGAAATGAGAAGG - Intergenic
1021961519 7:25877873-25877895 AAAAAAAAAGAGAGATGGGATGG - Intergenic
1022117478 7:27274944-27274966 GAGAAGGAAGAGAAGGGGGAAGG + Intergenic
1022227985 7:28383101-28383123 CAGAATGAAGCCAAGTGGGAGGG + Intronic
1022522226 7:31015790-31015812 AGAAAAACAGAGAAGTGGGAAGG - Intergenic
1022766797 7:33421929-33421951 CAGAAAATACAGAAAAGGGAAGG + Intronic
1023116566 7:36868642-36868664 CAGAATAAGGAGAAGCGGGCAGG - Intronic
1023138774 7:37080428-37080450 AAAAAAAAAAAAAAGTGGGATGG - Intronic
1023245363 7:38197754-38197776 TAGAGAAGAGAGATGTGGGAAGG - Intronic
1023250314 7:38253275-38253297 TAGAAAAAAGAGGAATTGGATGG - Intergenic
1023251622 7:38269386-38269408 TAGAAAAAAGAGGAATTGGATGG - Intergenic
1023517027 7:41011358-41011380 AAGACAAAAGGGAAGTGAGAAGG + Intergenic
1023520718 7:41047574-41047596 AAGAAAAGAAAGAAGTGGGGAGG + Intergenic
1023551949 7:41379323-41379345 TAGAAAAAAGTCAAATGGGAAGG - Intergenic
1023581615 7:41690125-41690147 AAGAAAGAAGAGGAGGGGGAAGG - Exonic
1024464236 7:49694065-49694087 GAGAAAAGAAAGAAGTGAGAAGG - Intergenic
1025035270 7:55589713-55589735 CACAGAAAAGAGAAGGGTGAGGG - Intergenic
1025234146 7:57222535-57222557 TAGAAAGAACAGGAGTGGGAGGG - Intergenic
1025838421 7:65119419-65119441 AAGTAAAAAGAGGAGGGGGAGGG - Intergenic
1025878856 7:65513677-65513699 AAGTAAAAAGAGGAGGGGGAGGG + Intergenic
1025884651 7:65576562-65576584 AAGTAAAAAGAGGAGGGGGAGGG + Intergenic
1026206234 7:68260278-68260300 GAGACAAAAGAGAAGGAGGAAGG - Intergenic
1026904082 7:74052811-74052833 AAGGAAAAAGAAAAGAGGGAGGG + Intronic
1027137052 7:75631915-75631937 CAGGAAATGGGGAAGTGGGAGGG + Intronic
1027230580 7:76269434-76269456 CAGAAAAGTGAGATGGGGGATGG + Intronic
1027900598 7:84109328-84109350 TATAAAAAAGAGAAGAAGGAAGG + Intronic
1027972634 7:85105024-85105046 AAGGAAAAAGAAAAGTGGGCAGG - Intronic
1028060790 7:86312337-86312359 CAGGAAAAAGAAAATTGGCAGGG - Intergenic
1028112333 7:86956783-86956805 CAGAAAAAAGACAATAGTGAAGG + Intronic
1028191776 7:87862148-87862170 CAGAAAAAAGATAAGTAGGTTGG - Intronic
1028638928 7:93021763-93021785 CAGGAAAAAGAGAAGGAGAAAGG + Intergenic
1029204906 7:98863778-98863800 AAGAAAAAAGAGAGGAGGGAGGG - Intronic
1029334816 7:99889616-99889638 CAGAAGGAAGAGAGGAGGGAAGG + Intronic
1029372999 7:100160977-100160999 CAGAAGAGAGAGAACTGGGCTGG + Intronic
1029423901 7:100485180-100485202 GAAAAAAAAGAAAGGTGGGATGG - Intronic
1029526623 7:101098605-101098627 TAGAAAAAATAGAAAAGGGAAGG - Intergenic
1030544450 7:110874438-110874460 CAAAAGAAAGAGCAGTGAGATGG + Intronic
1030605118 7:111632529-111632551 AAGAAAAAAGAAAAGAAGGAAGG - Intergenic
1030828478 7:114190698-114190720 AGGAAAAAAGAAAAGAGGGAGGG - Intronic
1031239277 7:119217664-119217686 CTGAACAATCAGAAGTGGGAAGG - Intergenic
1031260559 7:119513827-119513849 AAGAAAAAAGGAAGGTGGGAAGG + Intergenic
1031277916 7:119754715-119754737 CAAATAAAAAAGAAGTGGGGAGG + Intergenic
1031460015 7:122037274-122037296 CAGAAAAAAAAAAAATGTGAAGG + Intronic
1031531130 7:122878265-122878287 AAAAAAAAAAAAAAGTGGGAAGG + Intronic
1031903390 7:127434590-127434612 GAGAGAAAAGAGACGAGGGAAGG + Intergenic
1031957066 7:127953421-127953443 CAGGAAAAATAGAAGTAGGTGGG - Intronic
1032557792 7:132855880-132855902 AAGAAAAAAAAGAAGAGGGTGGG + Intronic
1032672665 7:134099511-134099533 AAAAAAAAAAAGAAGTGTGATGG - Intergenic
1032846939 7:135759132-135759154 CAGAAAAAAGAAAAGGGGATGGG - Intergenic
1032869959 7:135974540-135974562 CAAAAAAAAGAGGAGGAGGAGGG + Intronic
1032911774 7:136440513-136440535 CAGGAGACAGAGAAGAGGGAGGG - Intergenic
1032962040 7:137046859-137046881 CAGAAGAAGGAGGAGGGGGAAGG + Intergenic
1033007496 7:137583115-137583137 CAGAAAAAAGAAAATTGGATTGG + Intronic
1033046487 7:137967098-137967120 CAGGGCAAAGAGGAGTGGGAAGG - Intronic
1033112714 7:138596203-138596225 AAAAAGAAAGAAAAGTGGGAAGG + Intronic
1033309479 7:140250411-140250433 AAGAAAAAAGAAAAGTCAGAAGG - Intergenic
1033412209 7:141128307-141128329 AAGAGAAAAGAGACTTGGGAAGG - Intronic
1033496473 7:141902082-141902104 CAAAAAAAGGAGGTGTGGGAGGG - Intergenic
1034210336 7:149357677-149357699 CAAGAAAAAGAGAAGAGAGAAGG - Intergenic
1034419461 7:150981413-150981435 TAGAAAGAAGGGAAGTAGGAAGG + Intergenic
1034915733 7:155037333-155037355 AAAAAAAAAGAGAAGTGGATTGG - Intergenic
1036045408 8:5134795-5134817 AAAAAAAAAAAAAAGTGGGATGG - Intergenic
1036134395 8:6146529-6146551 CACAAAAAAGAGAAGTAAAAGGG + Intergenic
1036646593 8:10614683-10614705 AAGAAAAAAGAAAGGAGGGAAGG + Intronic
1036719100 8:11156152-11156174 CAGTAAAAGGTGAAGAGGGAAGG - Intronic
1036744137 8:11391948-11391970 CAGAAAGGAGAGAACTGAGATGG + Intronic
1037081654 8:14795106-14795128 CAGAATAAAGGTAAGTAGGAGGG + Intronic
1037196132 8:16192831-16192853 AAAAAAAAAGAGAAGTGAAAAGG + Intronic
1037464094 8:19142090-19142112 CAGAAAAGAGAAAATTGGGATGG + Intergenic
1037486313 8:19350643-19350665 CAGAAAATACAAAAGTGGGCTGG - Intronic
1037572996 8:20174207-20174229 CAGAAATAAGGGAATTGGGCTGG - Intronic
1037598527 8:20374260-20374282 CAGGAAACAGTGAAGAGGGAGGG + Intergenic
1037835218 8:22211567-22211589 CAGAGAAAAGAGATGGGGTAAGG - Intronic
1037932183 8:22888144-22888166 AAAAAAAAAAAGAAGTGGGTGGG - Intronic
1038038282 8:23704402-23704424 CAGACAGGAGAGAAGTGAGAAGG - Intronic
1038596431 8:28890497-28890519 CAGGAAGAGGAGAAGGGGGAGGG - Exonic
1038631762 8:29252026-29252048 AAGGAAAAAGGGAAGGGGGATGG + Intronic
1038761994 8:30392801-30392823 TAGAAAATAGAGATGTGGAAAGG + Intronic
1038779742 8:30559751-30559773 AAGAAAAATGAGAAGAGGGAGGG + Intronic
1038908869 8:31938571-31938593 CAGAAAAAAGAAAAATTGGAAGG + Intronic
1039089242 8:33810741-33810763 CAGAAAACAGAGAAAAGGAAAGG + Intergenic
1039164866 8:34666923-34666945 CAGCAAAGAAAAAAGTGGGAGGG - Intergenic
1039208634 8:35185862-35185884 GAGGAAAAAGAGAAGTGAAATGG - Intergenic
1039262585 8:35787987-35788009 AAGAAAAAAGAAAAGGAGGAAGG + Intronic
1039279662 8:35970144-35970166 ATTAAAAAAGAGAAGTGGGATGG + Intergenic
1039306042 8:36264159-36264181 CAGAAATTTGAGAAGCGGGAAGG + Intergenic
1039452793 8:37689030-37689052 AAGAAAAAAAAAAAGTGGGTGGG + Intergenic
1039608439 8:38901255-38901277 CGGAAAAAAGAGCCGAGGGACGG + Intronic
1039977590 8:42380515-42380537 AAGAAAAAAGAGAGGAAGGAAGG + Intergenic
1040487472 8:47887051-47887073 CAGAAGAAAGAAAGTTGGGATGG + Intronic
1040710484 8:50182811-50182833 AAGAAAAAAGAGGAGTGATATGG - Intronic
1040715264 8:50244139-50244161 GAGACAAGAGAGTAGTGGGAAGG + Intronic
1041242911 8:55863639-55863661 AAAAAGAAAGAGAAGAGGGAAGG + Intergenic
1041342753 8:56863399-56863421 GGGGAAAAAGAGAAGGGGGAGGG + Intergenic
1041539788 8:58970626-58970648 CAGTAGAAAGAGATGTGGGCTGG - Intronic
1041546801 8:59054940-59054962 AAGGAAAAAGAGAGGAGGGAGGG + Intronic
1042521243 8:69713457-69713479 CACAAAAAAGGGAGGAGGGAGGG - Intronic
1042978036 8:74492683-74492705 CAGAAATAAGAGAAGCAGGCAGG - Intergenic
1043194155 8:77269135-77269157 AAGAAAAGATAGAAATGGGAAGG + Intergenic
1043200911 8:77368382-77368404 CAAAAAAAAGAAACGTGGAAAGG + Intergenic
1043266582 8:78273709-78273731 AAGAAAAAAGAAGAGAGGGAAGG - Intergenic
1043385588 8:79744634-79744656 AAGTAAAAGGAGAAGGGGGATGG + Intergenic
1043417254 8:80063944-80063966 GAGAAAAAAGAGAAGCCAGAAGG + Intronic
1043829294 8:84968804-84968826 CAAGAAAAAAAGAAGTGGCAGGG + Intergenic
1044175149 8:89110868-89110890 AAAAAAAAAAAGAAGTGAGAAGG + Intergenic
1044362368 8:91302805-91302827 AAAAAAAAAGAGAAGGGGAAGGG - Intronic
1045193726 8:99908760-99908782 CAGAGAGAAGAGAAGGAGGAGGG + Intergenic
1045225581 8:100241776-100241798 CAGAAAACAAAAAAGGGGGAAGG - Exonic
1045855146 8:106756446-106756468 TAGAAAAAAGAGAATTCGGCCGG - Intergenic
1046057683 8:109098118-109098140 AAGAAAAAAGAAAAGAGGCAGGG - Intronic
1046425983 8:114050421-114050443 CAGAAAAAAGAGGCTTGGCATGG + Intergenic
1047080679 8:121456472-121456494 AAGAAAGAAGGGAACTGGGATGG - Intergenic
1047261309 8:123263004-123263026 GAGAAGGAAGAGAAGCGGGAAGG + Intronic
1047354887 8:124111179-124111201 AAGAGAAAAGAAAAGGGGGAAGG + Intronic
1047416958 8:124672497-124672519 AAAAAAAAAGAAAAATGGGAAGG + Intronic
1047830853 8:128628150-128628172 CAGAAAAGAGGGAAGGAGGATGG - Intergenic
1047914281 8:129565389-129565411 AAGTAAAGAGAGAAGTGGGAAGG + Intergenic
1048526698 8:135209275-135209297 CAGCAAAGTGAGAAGTTGGAGGG + Intergenic
1048827371 8:138441685-138441707 CAGAAAGCAGAGAATTGGAAGGG - Intronic
1049335939 8:142085330-142085352 AAGAGAAAAGAGAAGAGAGAGGG + Intergenic
1049335998 8:142085699-142085721 AAGAAAAAAGAAAGGAGGGAGGG + Intergenic
1049440404 8:142607105-142607127 CAGAAAGAAAAGAAAAGGGAAGG + Intergenic
1049650181 8:143762927-143762949 AAAAAAAAAGAAAAGAGGGAGGG - Intergenic
1049928873 9:436964-436986 CAGAAGAAACTGAAGTGTGAGGG + Intronic
1049950213 9:636401-636423 CAGGAAAAAGATAAAAGGGAAGG - Intronic
1050025753 9:1333033-1333055 CAGAAAAAAGGAAAGGGAGAAGG - Intergenic
1050181649 9:2929180-2929202 TTGAAAAAAGAGAAGAAGGAAGG + Intergenic
1050559182 9:6817200-6817222 CAAAAAAAAAAAAAGTGGGGGGG - Intronic
1050569987 9:6927812-6927834 GAGAAGAATGGGAAGTGGGAAGG - Intronic
1050602040 9:7262596-7262618 CAGAAAAAAGGGAAGTAGGCAGG + Intergenic
1050617913 9:7421784-7421806 CAAAAATAAGCGATGTGGGAAGG - Intergenic
1050630755 9:7555865-7555887 CTGTAAAAACTGAAGTGGGAGGG + Intergenic
1050656529 9:7834507-7834529 AAGAAAAGGGAGAATTGGGAGGG - Intronic
1050684000 9:8146920-8146942 CAGGAAGAAGAGAAGTAGGAAGG - Intergenic
1050747374 9:8892036-8892058 CAGAGAAAAGAAAAGCAGGAAGG - Intronic
1051409848 9:16778100-16778122 CAGAAAATAGAGAAAAGGGGAGG - Intronic
1051509458 9:17861306-17861328 CAGAAAAGAGAGATCTGGGCAGG + Intergenic
1051707671 9:19897926-19897948 CAGCAAAAGGAAAAGTGGGATGG - Intergenic
1051782135 9:20700967-20700989 AAGAAGAATCAGAAGTGGGAAGG - Intronic
1051950456 9:22624782-22624804 AAGAAAGAAGAGAATAGGGAGGG + Intergenic
1052379081 9:27750634-27750656 AGGATAAAAGAGAAGGGGGAGGG - Intergenic
1052790940 9:32875084-32875106 CAGAAAAAAAAAAAGGGGGATGG + Intergenic
1053157075 9:35788962-35788984 AAGACAAAAGGGAAGTGGGAAGG - Intergenic
1053346526 9:37382593-37382615 AAGAAAAAAGTGTAGGGGGAAGG - Intergenic
1053578971 9:39383267-39383289 AGGAAAAAAGAGATGGGGGATGG + Intergenic
1053843483 9:42211342-42211364 AGGAAAAAAGAGATGGGGGATGG + Intergenic
1054100554 9:60942071-60942093 AGGAAAAAAGAGATGGGGGATGG + Intergenic
1054121950 9:61217696-61217718 AGGAAAAAAGAGATGGGGGATGG + Intergenic
1054585792 9:66964815-66964837 AGGAAAAAAGAGATGGGGGATGG - Intergenic
1054991171 9:71328460-71328482 AAGATAAAAGAGAAGTCGGCCGG - Intronic
1055078875 9:72246940-72246962 CAGAAAAGAGGGATGAGGGAGGG - Intronic
1055093262 9:72384340-72384362 CAAGAGGAAGAGAAGTGGGAGGG - Intergenic
1055181304 9:73390000-73390022 CAGAAAAACAAGAAGTAGAAGGG - Intergenic
1055810610 9:80143678-80143700 TAGAAAAAAGAGAAGTTGGTCGG + Intergenic
1055916387 9:81405237-81405259 CAGAAAAAAGAAAATTTGGCTGG - Intergenic
1055966416 9:81869314-81869336 CAAAAAAAAGAAAAGAAGGAAGG - Intergenic
1056434715 9:86564711-86564733 CAAAAAAAAGAGAGTTGGTAAGG - Intergenic
1056521533 9:87406468-87406490 AAGAAAAAAGACAAGGGGAAAGG + Intergenic
1056528448 9:87465871-87465893 GAGGAAAGAGAGAATTGGGAGGG - Intergenic
1056888972 9:90471537-90471559 CTGAAGAAAGATAACTGGGAAGG + Intergenic
1057289284 9:93790849-93790871 CAGGAAAAAGTGAAGAGGGGAGG + Intergenic
1057517654 9:95735664-95735686 CAGAAAGAAAAGAAGGGAGATGG - Intergenic
1057719164 9:97518418-97518440 CAGAAACAACAGAAGTGTGTTGG - Intronic
1058523704 9:105836820-105836842 AAGACAAAAGAAAAGTGAGAGGG - Intergenic
1058828151 9:108793367-108793389 CAAAAGAAAGAGAGGTGGTAGGG - Intergenic
1058918000 9:109586122-109586144 CAGAAAAAAGTGGAATGGTAGGG - Intergenic
1059002792 9:110367562-110367584 CAGAAGAAAAGAAAGTGGGAGGG - Intronic
1059369555 9:113816272-113816294 AAGAAAAAAGAGAGGAGGGGAGG - Intergenic
1059575795 9:115486945-115486967 CAGAGGCAAAAGAAGTGGGATGG - Intergenic
1059731086 9:117057944-117057966 ATGAAGAAAGAGAGGTGGGAGGG - Intronic
1059815506 9:117908435-117908457 CAGAAAAATGAGAGGAGAGAAGG - Intergenic
1060232795 9:121838153-121838175 AAGGAAAAACAGAATTGGGAAGG - Intronic
1060285837 9:122251547-122251569 CAAACAAAAGAGAATAGGGAGGG + Intronic
1060763434 9:126275303-126275325 CAGAATAAAGAGAAGAGGAGAGG - Intergenic
1061294708 9:129670875-129670897 CAGGAAATAGAGAAAGGGGAAGG - Intronic
1061528393 9:131188331-131188353 CAGAAAAAAGTGATAGGGGATGG + Intronic
1061576048 9:131507082-131507104 AAGAAAAAAGAAAACAGGGAGGG + Intronic
1061920510 9:133779955-133779977 CAGAACACAGAGATGAGGGAAGG + Intronic
1062050606 9:134444641-134444663 GAAAAGAAAGAGAAGAGGGAAGG - Intergenic
1062226384 9:135454711-135454733 CAGAAAATGGAAAAGTGGCAAGG - Intergenic
1062411150 9:136425255-136425277 AAAAAAAAAGCGAAGTGGGGAGG - Intergenic
1203427414 Un_GL000195v1:54279-54301 CAGAATAAAAAGAAGAGGGTTGG - Intergenic
1203438793 Un_GL000195v1:168676-168698 CAGAATAAAAAGAAGAGGGTTGG + Intergenic
1185493873 X:539590-539612 CAGAAAAAAATGAGGTCGGAGGG - Intergenic
1185818128 X:3175397-3175419 AAGAAAAAAGAAAAGGGGGATGG + Intergenic
1186003665 X:5043272-5043294 AAATAAAAAGAGAGGTGGGATGG + Intergenic
1186607796 X:11110148-11110170 CAGAAAAATGAATTGTGGGAAGG + Intergenic
1186898044 X:14024517-14024539 AAAAAAAAAAAGAAGAGGGAGGG + Intronic
1186988422 X:15041081-15041103 GAGAAAAAAGAGAAAAAGGATGG - Intergenic
1187241870 X:17521358-17521380 CAAAAAAAAAAAAAGAGGGAAGG - Intronic
1187377914 X:18773686-18773708 CAGAAATGTCAGAAGTGGGAAGG - Intronic
1187649764 X:21389762-21389784 TACAAAAAAGAAAAGTGGTAAGG - Intronic
1187685007 X:21807337-21807359 CACAAGGAAGAGAAGTGGGAGGG - Intergenic
1187798938 X:23038084-23038106 CAGAAAAAAGAAAAGTTTTATGG + Intergenic
1188588891 X:31810343-31810365 GATAGAAAAGAAAAGTGGGAAGG + Intronic
1188677908 X:32965499-32965521 AAAAAAAAAAAGAAGTGGGGTGG + Intronic
1188919440 X:35954311-35954333 GAGAAAATAGAGAATTAGGAAGG + Intronic
1189088991 X:38058396-38058418 AAGAATAAAGAGCAGTGGAAAGG - Intronic
1189212429 X:39295294-39295316 CAGAAAAAAGTAAAGTTTGAAGG + Intergenic
1189468015 X:41292429-41292451 CAGAAAATAGAAAAGAGGGCTGG + Intergenic
1189538783 X:41964715-41964737 CACAAAGAAAAGAAGTGGGATGG + Intergenic
1189843109 X:45103341-45103363 CAGGAAAAAGAGTTGGGGGAAGG - Intronic
1190084486 X:47383388-47383410 AAAAAAAAAAAGAAATGGGATGG + Intronic
1190274175 X:48889874-48889896 AAGAAAAAAAAAAAGTGAGAAGG - Intergenic
1190451756 X:50589041-50589063 CAAAAATAAGAGAGATGGGAGGG - Intergenic
1190706350 X:53031325-53031347 AAAAAAAAAGAAAAGGGGGAAGG + Intergenic
1190743881 X:53309110-53309132 AAAAAAAAAAAAAAGTGGGAAGG + Intronic
1190748139 X:53338816-53338838 AAGAGGAAAGGGAAGTGGGAGGG - Intergenic
1190798815 X:53770024-53770046 AAGAGGAAAGGGAAGTGGGAGGG - Intergenic
1191905551 X:66084959-66084981 CAAAAAAATCAAAAGTGGGAAGG + Intergenic
1191909989 X:66140007-66140029 CACTGAAAAGAGAAGTGGAATGG - Intergenic
1192088401 X:68125789-68125811 CTGAAAAAATAGAGGGGGGAGGG + Intronic
1192184656 X:68938872-68938894 CAGGAAACTGAGAAGAGGGAGGG - Intergenic
1192343283 X:70281345-70281367 AAGGAAAAAGAAAAATGGGAAGG - Intronic
1192465248 X:71350395-71350417 CAGAATAAAGAAAAGTGAGCCGG - Intergenic
1192473041 X:71416087-71416109 CAGAATAAAGAAAAGTGAGCCGG + Intronic
1192576493 X:72247126-72247148 CAGAAATCAGGGAAGTGGGGAGG + Intronic
1192833826 X:74778428-74778450 AAGAAAAAAGAAAAGAAGGAAGG - Intronic
1192910973 X:75603897-75603919 CAGAAATTACAGAAATGGGAGGG - Intergenic
1193111728 X:77737046-77737068 GAAAGAAAAGAGAAGTGCGAGGG + Intronic
1193194978 X:78620659-78620681 CGGAAAAAATAAAACTGGGAAGG - Intergenic
1195031616 X:100932104-100932126 CTGAAAATAGAGAAGTTGGTGGG - Intergenic
1195106531 X:101607965-101607987 CAGAAGAAAGAATAGTGGAATGG - Intergenic
1195468537 X:105208566-105208588 CAGAGAAAAGCTAAGTGAGAGGG + Intronic
1195518530 X:105804952-105804974 GAGGAAGAAGAGAAGAGGGAGGG + Intergenic
1195742016 X:108074457-108074479 AAGAAAGAAGGGATGTGGGAGGG - Intronic
1195908828 X:109869698-109869720 CAGAAAAAAGAGTAGAGACACGG + Intergenic
1195923961 X:110007060-110007082 CAGGAAATAGATAAGTTGGAGGG + Intronic
1195950823 X:110270799-110270821 CAGGAAAAAATGAAGTGAGAAGG - Intronic
1196938296 X:120751203-120751225 AGGAAAAAGGAGAAGAGGGAGGG - Intergenic
1197094960 X:122582972-122582994 ATGAAAAAAAAAAAGTGGGAGGG + Intergenic
1197651590 X:129071503-129071525 CAGGAAAAAGAGAAAAGGGTGGG + Intergenic
1197816861 X:130506660-130506682 CACAAAAAAAAGGAGAGGGAAGG - Intergenic
1198000425 X:132429602-132429624 CAGAAACAATAAAAGAGGGAGGG + Intronic
1198426402 X:136525065-136525087 ATGAAAATAGAGATGTGGGAGGG + Intergenic
1198549260 X:137727342-137727364 CAAAAAGAAAAGAAATGGGAAGG + Intergenic
1198706172 X:139450819-139450841 AAGAAAAAGGAGGAGAGGGAAGG + Intergenic
1198874979 X:141214634-141214656 CAAAAATAAGGGAGGTGGGAGGG + Intergenic
1199036499 X:143056960-143056982 AAGAAAAGAGAAAAGGGGGAAGG - Intergenic
1199356893 X:146873261-146873283 CATAAAAGAGAGAACTGGGTTGG + Intergenic
1199471798 X:148203967-148203989 GAAAAAAGAGAGAAGAGGGAAGG + Intergenic
1199815540 X:151393911-151393933 CATAAAAAAGAGATATGGCAGGG + Intergenic
1200757525 Y:7003848-7003870 CAGAAAAAAAGGAGGAGGGATGG - Intronic
1200768222 Y:7099240-7099262 AAGAAACAAGAGAAGTCAGAAGG - Intergenic
1201360849 Y:13147227-13147249 CAGAAATAAGACAAGTGTGGTGG + Intergenic
1201511362 Y:14768155-14768177 CAGAAAAAGGAGATGAGTGATGG - Intronic
1201719122 Y:17077862-17077884 TAGAAAAAAAAAAAGTGGGCCGG - Intergenic
1202273665 Y:23094708-23094730 AAGAAAAAAGAGAAGAGAGAAGG + Intergenic
1202292362 Y:23325973-23325995 AAGAAAAAAGAGAAGAGAGAAGG - Intergenic
1202390675 Y:24367152-24367174 CAAAGAAAAGAGAAATGGAAAGG - Intergenic
1202426661 Y:24728453-24728475 AAGAAAAAAGAGAAGAGAGAAGG + Intergenic
1202444128 Y:24941633-24941655 AAGAAAAAAGAGAAGAGAGAAGG - Intergenic
1202480109 Y:25302964-25302986 CAAAGAAAAGAGAAATGGAAAGG + Intergenic