ID: 996401630

View in Genome Browser
Species Human (GRCh38)
Location 5:123069229-123069251
Sequence CCAGGGAGTAAACGGGTGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996401622_996401630 -5 Left 996401622 5:123069211-123069233 CCTGGATGCAGTGAGGCCCCAGG No data
Right 996401630 5:123069229-123069251 CCAGGGAGTAAACGGGTGTGTGG No data
996401616_996401630 29 Left 996401616 5:123069177-123069199 CCAAAAGGGGCCTTCACCATGCT No data
Right 996401630 5:123069229-123069251 CCAGGGAGTAAACGGGTGTGTGG No data
996401618_996401630 13 Left 996401618 5:123069193-123069215 CCATGCTTTCCAGTAGATCCTGG No data
Right 996401630 5:123069229-123069251 CCAGGGAGTAAACGGGTGTGTGG No data
996401617_996401630 19 Left 996401617 5:123069187-123069209 CCTTCACCATGCTTTCCAGTAGA No data
Right 996401630 5:123069229-123069251 CCAGGGAGTAAACGGGTGTGTGG No data
996401620_996401630 4 Left 996401620 5:123069202-123069224 CCAGTAGATCCTGGATGCAGTGA No data
Right 996401630 5:123069229-123069251 CCAGGGAGTAAACGGGTGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996401630 Original CRISPR CCAGGGAGTAAACGGGTGTG TGG Intergenic
No off target data available for this crispr