ID: 996403735

View in Genome Browser
Species Human (GRCh38)
Location 5:123088052-123088074
Sequence CATACCGTAAAGAGAAGAAA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996403735_996403737 -10 Left 996403735 5:123088052-123088074 CCGTTTCTTCTCTTTACGGTATG No data
Right 996403737 5:123088065-123088087 TTACGGTATGGCCAGAACCCCGG No data
996403735_996403744 16 Left 996403735 5:123088052-123088074 CCGTTTCTTCTCTTTACGGTATG No data
Right 996403744 5:123088091-123088113 TGGGAAAGTACCTCCTGAGTCGG No data
996403735_996403739 -3 Left 996403735 5:123088052-123088074 CCGTTTCTTCTCTTTACGGTATG No data
Right 996403739 5:123088072-123088094 ATGGCCAGAACCCCGGCGATGGG No data
996403735_996403738 -4 Left 996403735 5:123088052-123088074 CCGTTTCTTCTCTTTACGGTATG No data
Right 996403738 5:123088071-123088093 TATGGCCAGAACCCCGGCGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996403735 Original CRISPR CATACCGTAAAGAGAAGAAA CGG (reversed) Intergenic
No off target data available for this crispr