ID: 996403740

View in Genome Browser
Species Human (GRCh38)
Location 5:123088076-123088098
Sequence CTTTCCCATCGCCGGGGTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996403740_996403744 -8 Left 996403740 5:123088076-123088098 CCAGAACCCCGGCGATGGGAAAG No data
Right 996403744 5:123088091-123088113 TGGGAAAGTACCTCCTGAGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996403740 Original CRISPR CTTTCCCATCGCCGGGGTTC TGG (reversed) Intergenic
No off target data available for this crispr