ID: 996403744

View in Genome Browser
Species Human (GRCh38)
Location 5:123088091-123088113
Sequence TGGGAAAGTACCTCCTGAGT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996403740_996403744 -8 Left 996403740 5:123088076-123088098 CCAGAACCCCGGCGATGGGAAAG No data
Right 996403744 5:123088091-123088113 TGGGAAAGTACCTCCTGAGTCGG No data
996403735_996403744 16 Left 996403735 5:123088052-123088074 CCGTTTCTTCTCTTTACGGTATG No data
Right 996403744 5:123088091-123088113 TGGGAAAGTACCTCCTGAGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996403744 Original CRISPR TGGGAAAGTACCTCCTGAGT CGG Intergenic
No off target data available for this crispr