ID: 996406502

View in Genome Browser
Species Human (GRCh38)
Location 5:123110725-123110747
Sequence CTAAAAATACAGAATAAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 47143
Summary {0: 4, 1: 178, 2: 8834, 3: 22823, 4: 15304}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996406502_996406508 11 Left 996406502 5:123110725-123110747 CCCAGCTTATTCTGTATTTTTAG 0: 4
1: 178
2: 8834
3: 22823
4: 15304
Right 996406508 5:123110759-123110781 TTTCTCCATGTTGGTCAGGATGG 0: 187
1: 20543
2: 57548
3: 175730
4: 213913
996406502_996406506 2 Left 996406502 5:123110725-123110747 CCCAGCTTATTCTGTATTTTTAG 0: 4
1: 178
2: 8834
3: 22823
4: 15304
Right 996406506 5:123110750-123110772 GAGACTGGGTTTCTCCATGTTGG 0: 244
1: 14155
2: 94945
3: 152603
4: 122170
996406502_996406507 7 Left 996406502 5:123110725-123110747 CCCAGCTTATTCTGTATTTTTAG 0: 4
1: 178
2: 8834
3: 22823
4: 15304
Right 996406507 5:123110755-123110777 TGGGTTTCTCCATGTTGGTCAGG 0: 349
1: 18140
2: 39255
3: 147523
4: 194301

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996406502 Original CRISPR CTAAAAATACAGAATAAGCT GGG (reversed) Intronic
Too many off-targets to display for this crispr