ID: 996406502 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 5:123110725-123110747 |
| Sequence | CTAAAAATACAGAATAAGCT GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 47143 | |||
| Summary | {0: 4, 1: 178, 2: 8834, 3: 22823, 4: 15304} |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 996406502_996406508 | 11 | Left | 996406502 | 5:123110725-123110747 | CCCAGCTTATTCTGTATTTTTAG | 0: 4 1: 178 2: 8834 3: 22823 4: 15304 |
||
| Right | 996406508 | 5:123110759-123110781 | TTTCTCCATGTTGGTCAGGATGG | 0: 187 1: 20543 2: 57548 3: 175730 4: 213913 |
||||
| 996406502_996406506 | 2 | Left | 996406502 | 5:123110725-123110747 | CCCAGCTTATTCTGTATTTTTAG | 0: 4 1: 178 2: 8834 3: 22823 4: 15304 |
||
| Right | 996406506 | 5:123110750-123110772 | GAGACTGGGTTTCTCCATGTTGG | 0: 244 1: 14155 2: 94945 3: 152603 4: 122170 |
||||
| 996406502_996406507 | 7 | Left | 996406502 | 5:123110725-123110747 | CCCAGCTTATTCTGTATTTTTAG | 0: 4 1: 178 2: 8834 3: 22823 4: 15304 |
||
| Right | 996406507 | 5:123110755-123110777 | TGGGTTTCTCCATGTTGGTCAGG | 0: 349 1: 18140 2: 39255 3: 147523 4: 194301 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 996406502 | Original CRISPR | CTAAAAATACAGAATAAGCT GGG (reversed) | Intronic | ||
| Too many off-targets to display for this crispr | |||||