ID: 996406714

View in Genome Browser
Species Human (GRCh38)
Location 5:123112329-123112351
Sequence CAGTGCAGTCCTATATCATA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 68}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996406707_996406714 4 Left 996406707 5:123112302-123112324 CCTTTCCACTTCTCCTGCCAGCC 0: 1
1: 0
2: 5
3: 51
4: 555
Right 996406714 5:123112329-123112351 CAGTGCAGTCCTATATCATATGG 0: 1
1: 0
2: 0
3: 7
4: 68
996406709_996406714 -9 Left 996406709 5:123112315-123112337 CCTGCCAGCCCCTTCAGTGCAGT 0: 1
1: 0
2: 1
3: 27
4: 228
Right 996406714 5:123112329-123112351 CAGTGCAGTCCTATATCATATGG 0: 1
1: 0
2: 0
3: 7
4: 68
996406708_996406714 -1 Left 996406708 5:123112307-123112329 CCACTTCTCCTGCCAGCCCCTTC 0: 1
1: 0
2: 8
3: 134
4: 1027
Right 996406714 5:123112329-123112351 CAGTGCAGTCCTATATCATATGG 0: 1
1: 0
2: 0
3: 7
4: 68
996406706_996406714 17 Left 996406706 5:123112289-123112311 CCAGCGACACTGGCCTTTCCACT 0: 1
1: 0
2: 1
3: 36
4: 250
Right 996406714 5:123112329-123112351 CAGTGCAGTCCTATATCATATGG 0: 1
1: 0
2: 0
3: 7
4: 68

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996406714 Original CRISPR CAGTGCAGTCCTATATCATA TGG Intronic
900836934 1:5012021-5012043 CAGTGCAGACATATCTCATACGG - Intergenic
905216342 1:36410898-36410920 CAGAGCAGTCCTCAATCAGAAGG + Intergenic
909887835 1:80964617-80964639 CAGTTCAGTCCTAAATCAATTGG - Intergenic
911245739 1:95514866-95514888 AAGTACAGTCCTGTGTCATAAGG + Intergenic
920084755 1:203407059-203407081 CAGAGCAGTTCTATATCTAAGGG + Intergenic
1072904881 10:99443743-99443765 CAGTGCAGTATTGCATCATATGG - Intergenic
1077395773 11:2320438-2320460 CAGTGAAGTCCTATAGGATATGG - Intergenic
1081076399 11:38679339-38679361 CAGAGCAGTGGTATATCATGTGG - Intergenic
1085937194 11:81161880-81161902 GAGAGCATTCCTATAACATAGGG - Intergenic
1086614467 11:88799521-88799543 CAGTGGAGTTATATATAATATGG + Intronic
1096626945 12:52901745-52901767 AAGTGCAGTCCTATCTAATTAGG - Intronic
1096908821 12:54961907-54961929 CAGACCTGTCCTATACCATAAGG - Intronic
1098138606 12:67428975-67428997 CACTGCACTCCTCTACCATAAGG + Intergenic
1099392163 12:82095118-82095140 CAGAGCAGAGCTATATCAAATGG - Intergenic
1101536291 12:105619873-105619895 CAGTGAATTCCTGGATCATATGG + Intergenic
1117467048 14:56004158-56004180 CAGAGCAGTTCTCTCTCATATGG + Intergenic
1124572446 15:30877290-30877312 TGGTGCAGTCCTATATCCTCAGG - Intergenic
1125272353 15:37953043-37953065 CAGTACAGTACAATATCAGATGG + Intronic
1128928119 15:71677534-71677556 CAGAGCTGTCCTAAATCAAAGGG - Intronic
1153033766 18:739149-739171 CAGTGGTGTCCTGTATCATACGG - Intronic
1153596795 18:6733963-6733985 CAGTGCATTTCTAGATCATGGGG + Intronic
1158147926 18:54336592-54336614 CAATGCAGACATATACCATAAGG - Intronic
1159027388 18:63196671-63196693 CCGTGCGGCCCTTTATCATACGG + Intronic
925786033 2:7431882-7431904 CTGTGAAGTCCTCTTTCATATGG + Intergenic
926271203 2:11367725-11367747 CAATGCAGTCCTATTTCCTTTGG - Intergenic
927358405 2:22202677-22202699 CTGTGGAGTCCTTCATCATAGGG - Intergenic
928126122 2:28617901-28617923 CAGTGCAGACCTAGATCCTGCGG + Intronic
930704160 2:54487695-54487717 CAGTGAAGTCATGTATCATTAGG + Intronic
932422805 2:71611553-71611575 CGGTGCAGTCCTGTGTCATCAGG + Exonic
933972049 2:87477866-87477888 CAGTGGAATCCTAAATGATAAGG - Intergenic
935957978 2:108397725-108397747 CAGTGCAGTCCCATAGCTAAGGG - Intergenic
936321679 2:111472331-111472353 CAGTGGAATCCTAAATGATAAGG + Intergenic
945410265 2:209498772-209498794 CAGTGCAGTACAGTATCCTAAGG + Intronic
945802680 2:214452611-214452633 GAGTGGAATCCTAGATCATATGG + Intronic
1170640741 20:18150457-18150479 CAGTGTAGTCCTAAATCAAGGGG - Intronic
1173465641 20:43278985-43279007 TAGTTCAGTCCCATATCATCTGG - Intergenic
1174776505 20:53347527-53347549 CAGTGTAGTCATATATGATTTGG - Intronic
1176203608 20:63876125-63876147 CAGTGCAGGCCTCTTACATAAGG - Intronic
1181742413 22:24931956-24931978 CAGTGCAAACCTGTCTCATATGG - Intergenic
953377051 3:42437410-42437432 CCATGCAGTCTTATGTCATATGG - Intergenic
958726879 3:97916702-97916724 CAATGTAGTCCTATTTCACAAGG + Intronic
958806218 3:98813850-98813872 CTGTGCCCTCCTATTTCATAGGG - Intronic
960789741 3:121415456-121415478 CAAAGCTGTCCTATTTCATAGGG + Intronic
962959350 3:140295812-140295834 CAGTAAAGTCCTATTTCTTAAGG + Intronic
970497568 4:16642186-16642208 CATAGCAGTCCTAGATAATATGG + Intronic
971059890 4:22955781-22955803 CAGTGAAGTGCTATATAACAAGG + Intergenic
975166601 4:71185482-71185504 CAGTGCAGTGATATATCACTGGG - Intergenic
975555323 4:75658160-75658182 CTGTGCATTCCTATAGCATAGGG + Intronic
979475416 4:121151313-121151335 CACTGCATTACTATATAATATGG + Intronic
980024055 4:127743994-127744016 TAGGGCAGCTCTATATCATAAGG + Intronic
982351876 4:154424830-154424852 CTGTGCACTCCTCTATCACAAGG + Intronic
988392365 5:30651591-30651613 CAGTGCAGTTCTAACGCATATGG + Intergenic
990543140 5:56794359-56794381 CAGTGGAATCATATATCATGTGG + Intergenic
990956979 5:61351432-61351454 TAGTGCAGTCATATGACATAAGG - Intronic
992098787 5:73386110-73386132 CAGTTCAGTCCTATTTAGTATGG - Intergenic
996406714 5:123112329-123112351 CAGTGCAGTCCTATATCATATGG + Intronic
999283216 5:150378724-150378746 CAGTTCAGTCCTCTATCAAATGG - Intronic
999437785 5:151577585-151577607 CAGGGAAGTCCTATATGACAAGG + Intergenic
1005596799 6:27387326-27387348 CATTGAATTGCTATATCATATGG - Intronic
1008336988 6:50318745-50318767 CAGTGCTGTCATATATCACAAGG - Intergenic
1008613236 6:53203258-53203280 CAGGTCAGTCCTATATGATTAGG + Intergenic
1016521596 6:144952639-144952661 CTGTACAGTCAAATATCATATGG + Intergenic
1026559817 7:71439284-71439306 AAGTGCACTCCCATTTCATAAGG - Intronic
1028074124 7:86490080-86490102 CTGTGCAGTGCTATATTAAATGG + Intergenic
1031263257 7:119549565-119549587 CAGTGCAGTTCTAAGTCACAAGG + Intergenic
1039743627 8:40404460-40404482 CAGTTCAGTTCTATAACACAAGG - Intergenic
1040096363 8:43447480-43447502 AAGTGCTGTCATATGTCATATGG - Intergenic
1041965784 8:63674618-63674640 CAGTGCAGCGCTATAGCATGTGG + Intergenic
1046357989 8:113112940-113112962 CAGTGCAATCCCATAACATGGGG + Intronic
1055568376 9:77591626-77591648 CAGTACAGTAGTATGTCATATGG + Intronic
1056299954 9:85230511-85230533 CAGAGCAGTCCTATATCCCTGGG + Intergenic
1187697511 X:21936958-21936980 CAGTGCAGGCCAATAGCCTATGG + Intergenic
1195265620 X:103176562-103176584 CAGTGCAGGCCTATGTCACGAGG - Intergenic
1196981906 X:121223682-121223704 GAGTGCAATCCTAAATCATAAGG + Intergenic
1198798678 X:140427274-140427296 CATTGAAGTCCCCTATCATAAGG + Intergenic
1202625059 Y:56848632-56848654 CAGTGCAGAGATATATCACAAGG - Intergenic