ID: 996410229

View in Genome Browser
Species Human (GRCh38)
Location 5:123151139-123151161
Sequence CTCAGCTGCTTGGCGAAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 79}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996410224_996410229 17 Left 996410224 5:123151099-123151121 CCCTGTATTAGATGTATGGGCAT 0: 1
1: 0
2: 0
3: 4
4: 101
Right 996410229 5:123151139-123151161 CTCAGCTGCTTGGCGAAAACTGG 0: 1
1: 0
2: 0
3: 7
4: 79
996410225_996410229 16 Left 996410225 5:123151100-123151122 CCTGTATTAGATGTATGGGCATA 0: 1
1: 0
2: 0
3: 1
4: 109
Right 996410229 5:123151139-123151161 CTCAGCTGCTTGGCGAAAACTGG 0: 1
1: 0
2: 0
3: 7
4: 79

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996410229 Original CRISPR CTCAGCTGCTTGGCGAAAAC TGG Intronic
901049730 1:6420113-6420135 CGCAGGTGCTCGGGGAAAACTGG - Intronic
901977871 1:13009766-13009788 CTCAGCTACTTGGCTGACACAGG - Intronic
902004215 1:13219170-13219192 CTCAGCTACTTGGCTGACACAGG + Intergenic
902023438 1:13364905-13364927 CTCAGCTACTTGGCTGACACAGG + Intergenic
902489731 1:16772576-16772598 CCCAGTTGCTTGGTGAGAACTGG - Intronic
903742991 1:25569051-25569073 CCCAGCTGCTGGGTGAAAAGGGG - Intergenic
906036601 1:42754328-42754350 CCCAGCAGCTTGCAGAAAACGGG + Intronic
910099270 1:83559279-83559301 CTCAGCTGCATGGGGGAAAGAGG + Intergenic
912275000 1:108246995-108247017 TTGAGCAGCTTGGAGAAAACTGG + Intergenic
912293222 1:108447356-108447378 TTGAGCAGCTTGGAGAAAACTGG - Intronic
913539894 1:119808714-119808736 CTGAGCTGCCTGGCCAAAACAGG - Exonic
914920595 1:151844734-151844756 CCCAGCTGCTGGTAGAAAACAGG - Intergenic
915073984 1:153294052-153294074 CGCAGCTGCCTGGGGAAAATTGG - Intergenic
915075559 1:153305923-153305945 GTCAGCTGCATTGCAAAAACTGG + Intronic
917488989 1:175481495-175481517 CTCTGCTGCTTGGAGAGGACAGG + Intronic
919769845 1:201150826-201150848 CTCATCTGCTTTGAGAAAGCAGG + Intronic
921300219 1:213744880-213744902 CTCAGCTGCCTGGGGGGAACAGG + Intergenic
1062819348 10:522575-522597 CCCAGCAGCCTGGCCAAAACTGG - Intronic
1073511875 10:104047534-104047556 CTGAGCTGCTGGAGGAAAACGGG + Intronic
1081535393 11:43992504-43992526 CTCAGCTGCTGGGCAGGAACGGG + Intergenic
1083563047 11:63689632-63689654 ATCAGTTGATTGGAGAAAACAGG - Intronic
1083563114 11:63690077-63690099 ATCAGTTGATTGGAGAAAACAGG - Intronic
1083712297 11:64556693-64556715 CTCAGCTGCAGGGGGAAATCAGG + Intronic
1083994181 11:66264064-66264086 CTGAGCTGCTTGGCCACATCTGG - Exonic
1086887896 11:92225248-92225270 CTCAGCTGCTGGGTGCAAATGGG + Intergenic
1090873440 11:130768200-130768222 ATCAGCTGCTTGGAGAAAATGGG - Intergenic
1100654252 12:96623461-96623483 CTCAGCTGCTTTGAGAATGCAGG + Intronic
1102715974 12:114973008-114973030 CTCGGCTGATTGGAGCAAACAGG - Intergenic
1106695455 13:32167885-32167907 CTCAGCTGCTTGGCGAGTGAAGG + Intronic
1109607433 13:64714671-64714693 CTCAGCTGCTTGGAGGACTCAGG - Intergenic
1113462935 13:110494294-110494316 CTCAGCTTCTTGGGGAGGACAGG - Intronic
1118537885 14:66789581-66789603 CTCAGCTGGAAGGCAAAAACAGG + Intronic
1122388664 14:101365507-101365529 ATAAGCTGCTTGGAGAAAATGGG + Intergenic
1129853157 15:78806580-78806602 CTCATCTGCTTGGAGAATCCAGG + Intronic
1134887538 16:17807052-17807074 CTGAGATGCTTGGAGACAACTGG - Intergenic
1141095125 16:81157779-81157801 CTCAGCTTCTTGGGGGACACAGG - Intergenic
1141482854 16:84318407-84318429 CTCAGCTGCTTCCAGAAAGCTGG + Intronic
1146173792 17:30651944-30651966 CCCATCTGCTTGGAGAAAGCTGG - Intergenic
1146347248 17:32067965-32067987 CCCATCTGCTTGGAGAAAGCTGG - Intergenic
1151009805 17:70481656-70481678 CTCAGCCTCTTAGAGAAAACAGG + Intergenic
1152519414 17:80846479-80846501 GTCAGCTGCTCGGCGAAGAACGG - Exonic
1153142889 18:1995163-1995185 CCCAGCTGCCTGGCTAAATCAGG - Intergenic
1160244612 18:77146984-77147006 CTGTGCTGTTTGGAGAAAACTGG + Intergenic
1162988624 19:14288096-14288118 CCCATCTGCTTGGAGAAAGCTGG + Intergenic
1165360009 19:35330528-35330550 CTAAGCTGCTTGCCGACAGCAGG - Intronic
1167506925 19:49875895-49875917 CTCAGCTCCTTGGAGGAAACAGG - Intronic
928772819 2:34722212-34722234 CTAAACTGCTTGATGAAAACTGG - Intergenic
937433043 2:121856516-121856538 CACAGCTGCTTGAAGAAACCAGG + Intergenic
939617819 2:144380188-144380210 CACAGCTGTTTGGAGCAAACTGG + Intergenic
946390779 2:219415822-219415844 CTCAGTTCCTTGGTGAAAAGAGG - Intergenic
1169045113 20:2528805-2528827 CTCAGCAGTTTCTCGAAAACAGG + Intergenic
1175523244 20:59616421-59616443 CTGAGCTGCTGGGTGAAATCAGG + Intronic
1176236384 20:64055707-64055729 CTCAGCTGCTACGTGAAGACGGG + Intronic
1182913904 22:34010345-34010367 TTCAGGTGCTTGGGGACAACAGG + Intergenic
950183423 3:10930706-10930728 ATCAGCTGCTTGGAGAAGGCAGG + Intronic
955671126 3:61404453-61404475 CTGAGCTGATTGGGGAAAAGGGG - Intergenic
956037760 3:65113729-65113751 ATCAGCTGCTTGGAGAAGAATGG + Intergenic
960698524 3:120418738-120418760 CTCAGCTTCCTCGTGAAAACTGG + Intronic
961785091 3:129342853-129342875 CTCAGCTTCTTCAAGAAAACTGG - Intergenic
962290981 3:134136145-134136167 CTACGCTGCCTGGCAAAAACTGG + Intronic
963025154 3:140912052-140912074 CTTAGCTGCTTAGTGATAACAGG + Intergenic
964569264 3:158094683-158094705 CTCCGCTGCTTGGGGCAGACTGG + Intergenic
968627601 4:1634208-1634230 CTAAGCTGCTTCGTGCAAACAGG + Intronic
976690019 4:87858950-87858972 CCCAGCTGCTGGGTGAAAACTGG + Intergenic
981026895 4:140085613-140085635 CAGAGCTGCTTGGCCAAAACGGG + Intronic
982365149 4:154569718-154569740 CTCAGCTGATGGGAGAAAACAGG + Exonic
988833568 5:35009953-35009975 CTCAGCTGCTTGGAGCCAGCAGG - Intronic
990730432 5:58802927-58802949 ATCATCTGCATGGCGAAAGCTGG + Intronic
992149732 5:73891158-73891180 CTCATCTGCTTGGTGAGAAGAGG + Intronic
996410229 5:123151139-123151161 CTCAGCTGCTTGGCGAAAACTGG + Intronic
1000259335 5:159571692-159571714 CATAGCTGCTTTGCAAAAACTGG - Intergenic
1001276916 5:170357990-170358012 CTCGGATGCTTGGTGAAATCAGG + Intronic
1001557738 5:172647852-172647874 CTCATCTGCCTGGTAAAAACTGG + Intronic
1005169241 6:22963005-22963027 CACAGCTACTTTGCGAAAAAAGG + Intergenic
1007491498 6:42226483-42226505 CACAACTGCTTGGATAAAACAGG + Exonic
1023588597 7:41757621-41757643 CTGAGCTCCTTGGGAAAAACAGG - Intergenic
1032193787 7:129778812-129778834 CTCAGGAGCTTTGCGAAGACGGG + Intergenic
1034956205 7:155336874-155336896 CAAAGGTGCTTGGTGAAAACTGG + Intergenic
1039752633 8:40492341-40492363 CCCACCTGCTTGGCCAACACTGG - Intergenic
1039766508 8:40633880-40633902 CTAAGCTGCTTTCCGAAAACGGG - Intronic
1047947854 8:129900429-129900451 GTCAGCTGCTGGGCAAACACTGG + Intronic
1048509842 8:135052340-135052362 CTCAGTTGCTTGTGGGAAACTGG + Intergenic
1048593463 8:135843030-135843052 CAGAGCTGCTGGGTGAAAACCGG - Intergenic
1053490832 9:38500523-38500545 CTCAGCTGCTTGCCTGACACTGG - Intergenic
1057144633 9:92749585-92749607 CTAAGCTGCTTTTAGAAAACTGG + Intronic
1057671147 9:97089736-97089758 CTCAGCTGCTTGCCTGACACTGG - Intergenic
1191934469 X:66411482-66411504 CTGAGCTGCTTGGGGTAAAGTGG + Intergenic