ID: 996410954

View in Genome Browser
Species Human (GRCh38)
Location 5:123158353-123158375
Sequence TTGGAGATGCAGAGGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1121
Summary {0: 2, 1: 0, 2: 13, 3: 97, 4: 1009}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996410954 Original CRISPR TTGGAGATGCAGAGGGAGGA AGG Intronic
900482072 1:2904267-2904289 GTGGAGATGCAGACAGAGGCAGG + Intergenic
900741729 1:4334254-4334276 TTGGAGAGGTAGGGGGAGAAGGG + Intergenic
900756060 1:4435685-4435707 TGGCAAATGCAGGGGGAGGAGGG - Intergenic
900790002 1:4673605-4673627 TTGGAGGTGTGGAGGGAGCAGGG + Intronic
900875522 1:5340035-5340057 AAGGAGATTCAGAGGGAGCAGGG + Intergenic
901188481 1:7389781-7389803 GTGGTGAGGCCGAGGGAGGAGGG + Intronic
901468991 1:9442559-9442581 TTTGAGATGCACAGGCAGAATGG + Intergenic
901609427 1:10485559-10485581 TTTGGGAGGCAGAGGTAGGAGGG - Intronic
902388153 1:16087952-16087974 GTGGGGAGGCACAGGGAGGAGGG - Intergenic
902465824 1:16617926-16617948 TTGGGGATGGGGAGGGAGGGAGG + Intergenic
902549177 1:17209010-17209032 TTGGAGGGGCATAGGGAGAAGGG + Intronic
902595839 1:17508933-17508955 ATGGAGAGGTAGGGGGAGGAAGG - Intergenic
902691538 1:18112937-18112959 AAGGAGGTGGAGAGGGAGGATGG - Intronic
902718438 1:18288740-18288762 TCCGAGAGGCTGAGGGAGGAAGG + Intronic
902974480 1:20079000-20079022 CTCGAGAGGCAGAGGCAGGAGGG + Intronic
903045845 1:20563606-20563628 GTGGGGATGCAGAGAGGGGAGGG + Intergenic
903049600 1:20590816-20590838 TTGGAGAAGCAGAAGGAAGAGGG + Intronic
903054997 1:20629722-20629744 TTTGGGAAGCTGAGGGAGGAAGG + Intergenic
903224168 1:21885492-21885514 CTGGGGATGCCCAGGGAGGATGG - Intronic
903260083 1:22126923-22126945 CTGGTGAGGCAGATGGAGGAAGG - Intronic
903733480 1:25515146-25515168 TTGGAGAGGCAGGTGGAGAATGG - Intergenic
903751949 1:25628749-25628771 TTGGAGACTCAGAAGGGGGAGGG - Intronic
903848201 1:26290830-26290852 TCAGAGATGCAGAGGGTGGGGGG + Intronic
903963767 1:27073287-27073309 TTGGAAGTGCAGAGGGAGGATGG - Intergenic
904010052 1:27384075-27384097 TAGGAGAAGCAGATGGGGGAAGG - Intergenic
904813291 1:33178146-33178168 CAGGAGAGGGAGAGGGAGGAAGG - Intronic
904824495 1:33265612-33265634 TTGGAGTGGCAGAGGGCAGAGGG + Intronic
905013110 1:34760228-34760250 TTGGGGATGGGGAAGGAGGAGGG + Intronic
905032123 1:34892389-34892411 TGGGAGTTCCAGAAGGAGGAGGG + Intronic
905651633 1:39660801-39660823 TTTGAGCTGCAGAGGGGGGATGG + Intronic
905722795 1:40220881-40220903 TTTGAGAGGCTGAGGGAGGAGGG + Intronic
906324925 1:44839608-44839630 TGGGGAATGGAGAGGGAGGAAGG + Intronic
906357294 1:45117565-45117587 TGGGAGATGAGGTGGGAGGATGG + Intronic
906653712 1:47533150-47533172 TGGGGGAAGAAGAGGGAGGATGG - Intergenic
907221427 1:52909826-52909848 CTGCAGATGCAGAGGGCTGACGG + Intronic
907509489 1:54947580-54947602 ATTGAGATGCAGAGAGGGGAAGG + Intergenic
907937645 1:59057199-59057221 TGGGAGGTGCAGAGTGAAGAGGG + Intergenic
908331478 1:63074970-63074992 TTGAGGATGGGGAGGGAGGAGGG - Intergenic
908496053 1:64696075-64696097 GTGGAAATCCAGAGGTAGGATGG - Intergenic
908744914 1:67367148-67367170 TTTGAGAGGCCGAGGCAGGAGGG + Intronic
908890274 1:68838921-68838943 TTGGAGAAGCACAGAGAAGAGGG + Intergenic
909183019 1:72449499-72449521 TTGGAGATGCAGAGGCTGTTAGG - Intergenic
909415252 1:75399088-75399110 TAGGAGATGGAGGTGGAGGAGGG + Intronic
909626559 1:77723426-77723448 TTGGAGATGCAGACTGAGCTAGG + Exonic
910160283 1:84265024-84265046 GTGGAGATGAGGAGGAAGGATGG + Intergenic
910285184 1:85545775-85545797 GAGGAGATGCAGAGGGAGGAGGG + Intronic
910738487 1:90489193-90489215 TTGGAGACTTGGAGGGAGGAGGG - Intergenic
911411650 1:97516835-97516857 TTGGAGATAGAGAGAGAGAAGGG - Intronic
911525162 1:98975413-98975435 TTGGAGATGTACAGGAAGCAGGG + Intronic
911647697 1:100353188-100353210 AGGGAGCTGCAGAGGGAGCAAGG - Intronic
911795329 1:102068738-102068760 TTAGAGATTCAGAAGGGGGAGGG + Intergenic
912202093 1:107469694-107469716 TTTGAGAGGCCGAGGCAGGAGGG - Intronic
912395390 1:109338813-109338835 TGGGTGATGCCGGGGGAGGAGGG - Intronic
912939985 1:114036336-114036358 TTGGAGATTTGGAGGAAGGAGGG + Intergenic
913532066 1:119740533-119740555 TTGCAGAGGGAGGGGGAGGAGGG + Intronic
914227153 1:145730078-145730100 TTTGGGAGGCAGAGGCAGGAGGG + Intronic
914802526 1:150971995-150972017 CTGGAGTCGCAGAGGGAGGGTGG + Intronic
915043977 1:152995645-152995667 TTCGAGATACAGGGGGAGAAGGG + Intergenic
915109850 1:153556419-153556441 TTGGCTAAGTAGAGGGAGGAAGG + Intergenic
915136657 1:153736686-153736708 TTTGGGAGGCAGAGGGAGGGTGG - Intronic
915145593 1:153794304-153794326 TTGGGGAAGCAGAGGGATGGAGG + Intergenic
915249646 1:154579000-154579022 GTGGCGTTGCAGTGGGAGGAAGG + Exonic
915580653 1:156811081-156811103 AAGGAGATGCTGAGAGAGGAGGG - Intronic
915636882 1:157193793-157193815 TTGGAAATGCAGAGCCACGAGGG + Intergenic
915694891 1:157729888-157729910 TTGGAGACTCAGAAGAAGGAGGG + Intergenic
915731754 1:158058957-158058979 TTGGAGATGCAGAGAGGGAGTGG + Intronic
915891216 1:159775639-159775661 CTGGAGATGGGGAGGGAGGTGGG - Intergenic
915940619 1:160116184-160116206 CGGGAGATGCAGTGAGAGGAGGG - Intronic
915983804 1:160442925-160442947 TTGGAGACTCAGAAGCAGGAAGG - Intergenic
916080443 1:161228856-161228878 TGGGGGATGCAGAGGAGGGAGGG + Intronic
916488251 1:165278574-165278596 CTGCAGGTGAAGAGGGAGGATGG - Intronic
917002759 1:170377996-170378018 TTGGAGATGGATAGTGATGATGG - Intergenic
917353469 1:174102383-174102405 TTTGGGAGGCAGAGGCAGGAGGG + Intergenic
917526746 1:175795066-175795088 GTGTAGATGAAGAGGAAGGAAGG + Intergenic
918326220 1:183413228-183413250 TGGAAGATGTAAAGGGAGGAGGG + Intronic
918352887 1:183675901-183675923 TTTGAGAGGCTGAGGCAGGAGGG + Intronic
918703829 1:187637389-187637411 TTGGGGATGGAGAAGGAGGAGGG - Intergenic
919055572 1:192565762-192565784 GAGGAGGTGGAGAGGGAGGAAGG + Intergenic
919211611 1:194494144-194494166 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
920006304 1:202836014-202836036 CTGGAGATGGAGAGAGGGGAAGG - Intergenic
920241108 1:204551286-204551308 TTTGAGAGGCTGAGGCAGGAGGG - Exonic
920245726 1:204585941-204585963 TTGGGGGTTCAGAGGGAGGGCGG + Intergenic
920611143 1:207438966-207438988 TTGGAGACTCAGAAGGGGGAAGG + Intergenic
921188807 1:212692163-212692185 TTGGAGATGGAGAACAAGGAGGG + Intronic
921305395 1:213791585-213791607 TGGGAGGTAAAGAGGGAGGAAGG + Intergenic
921315431 1:213886008-213886030 TCAGAGATGCAGAGAGAGGAAGG - Intergenic
921590115 1:216993295-216993317 AGGGAGATGGTGAGGGAGGAGGG - Intronic
921606986 1:217167398-217167420 TAGGAGATGCAAAGGCAGGCAGG - Intergenic
922079074 1:222277063-222277085 GTGGGGATGCTGAGGCAGGAGGG + Intergenic
922593322 1:226795416-226795438 CTGGAGAGGGAGAGGCAGGAAGG - Intergenic
922651339 1:227341601-227341623 AAGGAGAAGCAGAGGGATGAGGG + Intergenic
922664387 1:227456188-227456210 TTGGAAATTCTGAAGGAGGATGG - Intergenic
922944042 1:229495144-229495166 TTTGGGATGCTGAGGCAGGAGGG + Intronic
923249345 1:232165764-232165786 TTGGAGACTCAGAGTGGGGAGGG + Intergenic
923384471 1:233452996-233453018 GGGGAGATGGAGAGGGGGGAGGG - Intergenic
924327661 1:242911875-242911897 TTGTATCTGCAGATGGAGGAAGG - Intergenic
924594083 1:245430149-245430171 TGGGGGCTGAAGAGGGAGGATGG + Intronic
1062812582 10:477583-477605 TGGGAGATGGGGAGGGAGGAAGG + Intronic
1062922844 10:1293036-1293058 GAAGAGATGCAGAGGGAGGGAGG + Intronic
1063255577 10:4323689-4323711 TTGAAGATACTGAGGGAGAAGGG + Intergenic
1063425045 10:5944138-5944160 TTTGGGAGGCTGAGGGAGGAGGG + Intronic
1063593422 10:7412246-7412268 TTAGGGATGCAGGGCGAGGAAGG - Intergenic
1064065840 10:12180861-12180883 TTGGTGAACTAGAGGGAGGAAGG - Intronic
1064640906 10:17415071-17415093 TGGGAGATGGAGAGGGATTATGG - Intronic
1064689219 10:17896686-17896708 TTTGAGAGGCTGAGGCAGGAGGG + Intronic
1065540705 10:26763925-26763947 GTGGAGCTCCAGAAGGAGGAGGG + Exonic
1065741524 10:28801431-28801453 TTGGAGAGGCCAAGGCAGGAGGG - Intergenic
1065857984 10:29845892-29845914 CTGGGGAGGCAGAGGCAGGAGGG - Intergenic
1066045277 10:31589273-31589295 TGGGAGAGGGAGAGGCAGGAAGG - Intergenic
1066051090 10:31636284-31636306 ATGGAGGTGCAGAGGGTTGAAGG + Intergenic
1066073469 10:31846822-31846844 TTGGAGTTCCAGAAGGAGAAAGG - Intronic
1066233908 10:33467193-33467215 TTTTAGAGTCAGAGGGAGGAGGG + Intergenic
1066654053 10:37682941-37682963 TTGGACATGCAGTGGTAGGTTGG + Intergenic
1067027657 10:42858423-42858445 TAGGAGATGGAGAGGAAGAAAGG - Intergenic
1067188505 10:44050383-44050405 TTAGAGAGGCTGAGGCAGGAGGG - Intergenic
1068414276 10:56697382-56697404 TTTGGGAGGCAGAGGCAGGAGGG + Intergenic
1068946091 10:62730238-62730260 TGGGACAGCCAGAGGGAGGATGG - Intergenic
1069243127 10:66166942-66166964 TTGGAGATACAATGGGAGGTTGG + Intronic
1069510204 10:69036464-69036486 TTGGGGATGCAGATGGATTAAGG - Intergenic
1069524255 10:69153594-69153616 TTTGGGAGGCAGAGGCAGGAAGG - Intronic
1069540952 10:69293407-69293429 TTGGAGATACTGGAGGAGGAAGG + Intronic
1069761570 10:70815300-70815322 TTGGGGATGCTGAGGCGGGAGGG - Intergenic
1069855686 10:71439738-71439760 CTGGAGCTGCAGAGGTGGGAGGG + Intronic
1069905193 10:71728087-71728109 TTGGACAAGCAGATTGAGGAAGG + Intronic
1070210774 10:74318271-74318293 ATGGAGGTGGAGATGGAGGAAGG - Intronic
1070211225 10:74324270-74324292 TTTGGGAGGCAGAGGCAGGAGGG - Intronic
1070276064 10:75008147-75008169 ATGGTGATGCAGAGTGAGGATGG + Intronic
1070282461 10:75059662-75059684 TGGGAGGTGCAGTGTGAGGAGGG + Intergenic
1070325300 10:75384886-75384908 TTGGAGAGGCAGAGGGATGAAGG - Intergenic
1070394441 10:76000165-76000187 TTGGTGATGGAGGTGGAGGACGG + Intronic
1070751077 10:78964242-78964264 TTGGAGATGCAAGGGGCTGAAGG - Intergenic
1070829507 10:79409850-79409872 TTGGAGGAGCAGGGGGAGGACGG + Intronic
1070868667 10:79727981-79728003 TTTGGGGTGCAGAGGAAGGATGG + Intergenic
1071499435 10:86193050-86193072 TAGGAGATGCTGAGGCTGGATGG - Intronic
1071604352 10:86974502-86974524 ATGAAGAAGAAGAGGGAGGAAGG - Intronic
1071785215 10:88892084-88892106 TTTGAGATGCAGGGTGAGGGAGG + Intronic
1072223104 10:93344405-93344427 TTGGAGACTCAGAAGGGGGAGGG - Intronic
1072279335 10:93851856-93851878 TTTGGGAGGCAGAGGCAGGAGGG - Intergenic
1073063813 10:100746876-100746898 CTGGAGATGCTGAGAGATGAGGG - Intronic
1073070182 10:100788371-100788393 CTGGAGGGGCAGTGGGAGGAGGG + Intronic
1074532185 10:114305411-114305433 AAGGAGATGCAGATGCAGGAGGG + Intronic
1074532235 10:114305603-114305625 AAGGAGATGCAGATGCAGGAGGG + Intronic
1074532241 10:114305639-114305661 GAGGAGATGCAGATGCAGGAGGG + Intronic
1074532268 10:114305726-114305748 GAGGAGATGCAGATGCAGGAGGG + Intronic
1074532366 10:114306085-114306107 AAGGAGATGCAGATGCAGGAAGG + Intronic
1074532403 10:114306211-114306233 GAGGAGATGCAGATGCAGGAGGG + Intronic
1074618289 10:115092855-115092877 TTGCAGCTGCAGACGGCGGACGG + Intergenic
1074784666 10:116828422-116828444 AAGGAGATGGAGAGGTAGGAAGG - Intergenic
1075020505 10:118948718-118948740 CTGGATTTGCAGAGGGAGGGAGG - Intergenic
1075173562 10:120138448-120138470 TTGGCTTTGAAGAGGGAGGAAGG + Intergenic
1075275443 10:121088971-121088993 ATTGAGATGCAGAGGGTGGATGG + Intergenic
1075337208 10:121617153-121617175 TTGGAAAAGGAGAAGGAGGAAGG + Intergenic
1075470270 10:122683641-122683663 TTGGAGTTGCAGAGGGAGAGGGG - Intergenic
1075809645 10:125215633-125215655 CTGGAGGAGCAGAGGGAAGAAGG + Intergenic
1076302750 10:129440434-129440456 TGGGTGAGGTAGAGGGAGGATGG - Intergenic
1076316517 10:129545628-129545650 TTGCAAAAGCAGAGGGAGGCTGG - Intronic
1076607644 10:131700010-131700032 TTTGAGCTGCAGAGGGAGCATGG - Intergenic
1076700574 10:132270695-132270717 TTACAGACGCAGAGGGAGGGAGG - Intronic
1076890122 10:133279235-133279257 TTGGAGCAGCAGCAGGAGGAGGG + Exonic
1077003980 11:342189-342211 TTTGGGAGGCTGAGGGAGGAGGG - Intergenic
1077155486 11:1089148-1089170 CTGGGGAGGCAGAGGGAGGCCGG - Intergenic
1077177257 11:1196528-1196550 TGGGAGATGCAGCGGGAGGCTGG - Intronic
1077285027 11:1761799-1761821 GCGCAGGTGCAGAGGGAGGACGG - Intronic
1077329613 11:1978277-1978299 CTTGAGGTGCAGAGAGAGGATGG + Intronic
1077453779 11:2665948-2665970 TTGGGGATGCAGTGTGAGGGAGG - Intronic
1077742471 11:4861936-4861958 TTGGTGCTGCAGAGGTAGGTAGG - Intronic
1078003364 11:7514418-7514440 CTGGAGATGCGCAGGGAGGTGGG + Intronic
1078059224 11:8032666-8032688 CGGGAGGTGCAAAGGGAGGAGGG - Intronic
1078064970 11:8072281-8072303 TTGGAGATGCAGAGGGGGAAGGG + Intronic
1078092648 11:8276856-8276878 GTGGACATGCAGAGAGAGGATGG - Intergenic
1078172491 11:8939045-8939067 TTGGAGAGGCTGAGGCAGGCGGG - Intergenic
1079149590 11:17885564-17885586 TTTGAGAGGCCGAGGGAGGAGGG - Intronic
1079414068 11:20216504-20216526 TTGGCTGTGAAGAGGGAGGAAGG - Intergenic
1079505136 11:21144791-21144813 TTGGAGATCCAGGGAGAGAAAGG + Intronic
1079712723 11:23707408-23707430 TTGCAGATGCTGAGGGTGGGGGG - Intergenic
1080181455 11:29431175-29431197 TTTGGGAGGCAGAGGGAGCAAGG - Intergenic
1080326935 11:31085973-31085995 TTTGGGAGGCTGAGGGAGGAGGG - Intronic
1080536837 11:33230244-33230266 GTGGAGACTCAGAGGGATGAAGG + Intergenic
1081083248 11:38768954-38768976 TTGGAGGTACAGTGGGAAGAGGG - Intergenic
1081716798 11:45256232-45256254 GTGGAGAAGAGGAGGGAGGAAGG - Intronic
1082788394 11:57330347-57330369 TTGGAGAGGATGAAGGAGGAAGG - Exonic
1082809178 11:57468197-57468219 ATGGAGATGCTGAGGCAGGAAGG - Intronic
1083160369 11:60850567-60850589 TTGGAGAAGGAGAGGAAGGAGGG - Exonic
1083489201 11:63002648-63002670 GTGGAGTAGGAGAGGGAGGAAGG - Intronic
1083538392 11:63492291-63492313 TTGGGCGTGCAGAGGGAGAAGGG - Intergenic
1083711821 11:64554393-64554415 CTGGAGAGGCCGAGGAAGGAAGG + Intergenic
1084165478 11:67373131-67373153 TGGGAGAGGAAGAGGGAGGGAGG - Intronic
1084177082 11:67428564-67428586 TTGGATTTGGAGACGGAGGAAGG + Exonic
1085071193 11:73547552-73547574 CTTGGGATGCAGAGGCAGGAGGG + Intronic
1085633155 11:78136427-78136449 TTCGGGAGGCTGAGGGAGGAAGG + Intronic
1085639252 11:78181701-78181723 TTTGAGAGGCCGAGGCAGGAGGG + Intronic
1085916848 11:80900461-80900483 ATGGAGTTGCAGAGAGAGCAGGG + Intergenic
1088503821 11:110510061-110510083 TTTGAGATGCAAAGAGAAGATGG - Intergenic
1088663519 11:112072300-112072322 TTTGAGAGGCTGAGGTAGGAGGG + Intronic
1088843765 11:113648122-113648144 TCAGAGATTCAGAGAGAGGAAGG + Intergenic
1089138697 11:116269737-116269759 TTGGAGAGGCAGAGGGGAGGAGG - Intergenic
1089346219 11:117793416-117793438 TTGTAGATGAAGAGAGGGGAGGG - Intronic
1089422490 11:118342276-118342298 TTTGAGAGGCTGAGGCAGGAGGG - Intronic
1089466999 11:118691897-118691919 TTGGAGGAGGAGAGGGAGGGAGG + Intergenic
1090097456 11:123756929-123756951 TGTGAGATGCAGAGGGAGGTGGG + Intergenic
1090130943 11:124141623-124141645 GCTGAGATGCAGAAGGAGGACGG - Exonic
1090231446 11:125109368-125109390 TTGCCTCTGCAGAGGGAGGAAGG + Intronic
1090386954 11:126362972-126362994 CTGGAGAGGCAGAGAGAGAAGGG - Intronic
1090483906 11:127094781-127094803 TTTGGGAGGCAGAGGCAGGAGGG + Intergenic
1090599811 11:128358562-128358584 ATGTAGATGCAGGGAGAGGATGG - Intergenic
1090613429 11:128492720-128492742 TTGGAGGTGTAGAGTGGGGATGG - Intronic
1091004089 11:131936478-131936500 TTGGAGACTCAGAAGGAGGGTGG + Intronic
1091095955 11:132822244-132822266 TGGGAGAGGGAGAGTGAGGAGGG - Intronic
1091275011 11:134344188-134344210 TTGTTGATGCAGAGGGAAGAGGG + Intronic
1202812592 11_KI270721v1_random:33456-33478 CTTGAGGTGCAGAGAGAGGATGG + Intergenic
1091395053 12:149306-149328 TTGCATGTGCAGTGGGAGGAAGG + Intronic
1091624994 12:2115054-2115076 TGTGAGATGCTGAGGGAAGAGGG - Intronic
1091637234 12:2206230-2206252 AAGGAGATCCAGAGGGAAGAAGG + Intronic
1092027761 12:5257380-5257402 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
1092139423 12:6172506-6172528 CTGAAGTTCCAGAGGGAGGAAGG + Intergenic
1092216628 12:6688534-6688556 TTAGAGATGGAGGAGGAGGAGGG + Intronic
1092629267 12:10361072-10361094 TTGTAGAGACAGAGGGAGGAGGG + Intergenic
1092906771 12:13107460-13107482 TATGAGAAGCTGAGGGAGGATGG + Intronic
1093152011 12:15632995-15633017 TGGTAGATGCTGAGGGAAGAAGG + Intronic
1093185865 12:16019539-16019561 TTGGAGGTGAGGTGGGAGGAGGG - Intronic
1093977971 12:25443907-25443929 TTGGAGACTCAGAAGGGGGAAGG - Intronic
1094363696 12:29657861-29657883 TTGGAGAGGCTGAGGCAGGTGGG + Intronic
1094696833 12:32827990-32828012 TAGGAGAAGTAGAGTGAGGAAGG + Intronic
1096007045 12:48182172-48182194 TTGGTGATGAAGAGTGAGGCTGG - Intergenic
1096016365 12:48279516-48279538 AAAGAGAGGCAGAGGGAGGATGG - Intergenic
1096078296 12:48818270-48818292 AGAGAGAGGCAGAGGGAGGACGG - Intronic
1096239974 12:49954613-49954635 ATGGATCTGCAGTGGGAGGAGGG - Exonic
1096276336 12:50211398-50211420 TTTGGGAGGCAGAGGCAGGAGGG + Intronic
1096478033 12:51920665-51920687 AGAGAGATGCAGAGGGAGGTGGG - Intronic
1096556832 12:52409023-52409045 AGGGAGAGGGAGAGGGAGGAGGG - Intergenic
1096609122 12:52789592-52789614 TGGGAGAGGCAGAGGCAGGGAGG + Intergenic
1096613856 12:52820524-52820546 GTGGAGATGAAGAGGAAAGAAGG + Intergenic
1096693834 12:53336434-53336456 TTAGAGATCCAGGGGGGGGATGG + Intronic
1096863114 12:54544323-54544345 ATGCAGATGCAGATGGAGGAGGG - Exonic
1096992526 12:55816983-55817005 TTGGAGATGGTGTGTGAGGAAGG + Intronic
1097206190 12:57323267-57323289 TTGGAGAAGGACAGGAAGGAAGG + Intronic
1097507498 12:60494290-60494312 ATGGAGAAGCAGAGGAAGCAGGG + Intergenic
1097620952 12:61938893-61938915 TTGGAGACTCAGAAGGAGGAGGG + Intronic
1098467277 12:70801778-70801800 TGGGAGATAGAGAGGGAGGGAGG - Intronic
1098596713 12:72280624-72280646 TGGGAGATGGAGAGGGTTGAGGG + Intronic
1099058445 12:77874451-77874473 TTTGAGAGGCTGAGGCAGGAAGG - Intronic
1099103618 12:78474001-78474023 TTGTAGTTACACAGGGAGGATGG - Intergenic
1099825317 12:87769520-87769542 TTAGAGATGCTGATGGAGAAAGG - Intergenic
1100404309 12:94260158-94260180 TTGGGGAGGCTGAGGCAGGAGGG - Intronic
1101323493 12:103694371-103694393 TTGGAGCTGAAGGGGGAGGAGGG - Intronic
1101515606 12:105432204-105432226 TTGGGGATGTAGAGGGACAATGG + Intergenic
1101577013 12:106007057-106007079 TGGGGGATGCAAAGGGAAGAGGG - Intergenic
1101640514 12:106583237-106583259 CTAGAGATGCCCAGGGAGGAAGG - Intronic
1101727025 12:107396160-107396182 GTGGAGAGGCAGAGGAAGGCTGG - Intronic
1101946738 12:109143129-109143151 TTGGAGACTCAGAGAGGGGAAGG - Intronic
1102024153 12:109703979-109704001 CTGGAGCTGCAGTGGGAAGATGG - Intergenic
1102198083 12:111038537-111038559 TTGGAGAGGCAGAGGGAATGGGG - Intronic
1102598741 12:114012875-114012897 AGGGAGAGGGAGAGGGAGGAGGG + Intergenic
1102655804 12:114481333-114481355 CTGGCGCTGCAGAGGGAGGAAGG + Intergenic
1102670486 12:114614838-114614860 TTGGAGATGCTGAGCCAGGCTGG - Intergenic
1102682231 12:114698626-114698648 AGGGAGATGGAGAGAGAGGAGGG - Intergenic
1102919996 12:116784766-116784788 GTGGAGATATAGAAGGAGGATGG - Intronic
1103147156 12:118604791-118604813 TTGGAGAGGCAGTGAGAGGAGGG + Intergenic
1103244699 12:119446599-119446621 AGGGAGAGGGAGAGGGAGGACGG + Intronic
1103367687 12:120394957-120394979 TTGGGGATGCAGAGGCAGGAAGG + Intergenic
1103719020 12:122963694-122963716 TCTGAGATGCAGAGGGGGAATGG + Intronic
1104097121 12:125567948-125567970 TGGTAGAGGCAAAGGGAGGAAGG + Intronic
1104650038 12:130524871-130524893 TTGGGGCTGCAGAGGCAGGGAGG + Intronic
1104715821 12:131015552-131015574 TTGGAGATGGAGATGGAGATGGG + Intronic
1105265322 13:18809839-18809861 CTGGGGATGCAGACAGAGGAGGG + Intergenic
1105607665 13:21940133-21940155 TTGGGGATACAGAGGGGGCATGG + Intergenic
1105892723 13:24693355-24693377 ATGGAGAGGAAAAGGGAGGAAGG - Intronic
1106006440 13:25774406-25774428 TTGGGGAGGCAGGGGGAGGGAGG + Intronic
1106033740 13:26025524-26025546 CTGGTGATGCAGAGGGAAGCAGG + Exonic
1106099205 13:26679989-26680011 TTGGGGGTGCTGAGGGAGCAGGG - Intronic
1106559730 13:30837912-30837934 TTGGAGATGGAGCAGTAGGAGGG + Intergenic
1107562514 13:41571306-41571328 CGGGAGAGGGAGAGGGAGGAGGG - Intronic
1107581119 13:41787545-41787567 TGGAGGATGAAGAGGGAGGAAGG + Intronic
1107846592 13:44520492-44520514 TTGGGTATGCAGAGGAAGCATGG + Intronic
1107848813 13:44549656-44549678 TTGGAGAGGCTGAGGTGGGAGGG + Intronic
1107950455 13:45456838-45456860 TTGGAGGTGGAGAGAGAAGATGG + Intergenic
1108008025 13:45972429-45972451 TTGGAGACTCAGAAGGGGGAGGG + Intronic
1108344100 13:49527362-49527384 GTGGAAATGCAGAGTGTGGAGGG - Intronic
1108373427 13:49792567-49792589 TTGGAGCGGGAGGGGGAGGAGGG + Exonic
1108962449 13:56251679-56251701 TTGGGGATGGGTAGGGAGGATGG - Intergenic
1109250574 13:60015237-60015259 TTTGGGATGCCGAGGCAGGAGGG - Intronic
1110050974 13:70898583-70898605 TTGGAAATGGTGGGGGAGGAGGG - Intergenic
1110637552 13:77783395-77783417 GAGGAGAAGGAGAGGGAGGAGGG + Intergenic
1110795929 13:79638335-79638357 TTGGAGATGCACATGGAAGTTGG - Intergenic
1111475097 13:88735490-88735512 TTTGGGAGGCAGAGGCAGGAGGG + Intergenic
1111863469 13:93738657-93738679 TTGGAGTAGGAGAGAGAGGAGGG + Intronic
1111899105 13:94179327-94179349 TTTGAGATAGAGAGGGTGGATGG + Intronic
1112332094 13:98484576-98484598 TTGGAAGTGCAGAAGGACGAGGG - Intronic
1112497532 13:99916534-99916556 TGGGGGATGAAGAGGGAGGAAGG - Intergenic
1112772765 13:102809741-102809763 TTGGAGATGAATAGTGATGATGG - Intronic
1113050290 13:106203835-106203857 TTGGAGACTCAGAGGGGGAAGGG - Intergenic
1113405142 13:110031931-110031953 CTGGAAATTAAGAGGGAGGAAGG + Intergenic
1113509467 13:110841489-110841511 TAGAAGCTGCAGAGGGAAGATGG - Intergenic
1113775528 13:112943037-112943059 ATGGAAATGCAGAGCCAGGAAGG + Intronic
1113842989 13:113371010-113371032 TTGGAGATGGAGATGGAGTCTGG - Intergenic
1114643958 14:24243131-24243153 TTTGAGAGGCCGAGGCAGGAGGG + Intergenic
1114842573 14:26282465-26282487 ATGGAGACGGAGAGGGAGTAGGG + Intergenic
1114862666 14:26544437-26544459 TAGGTGATGCACAGTGAGGAGGG + Intronic
1114952514 14:27773645-27773667 TTGGAGACTCAGAGCGGGGAGGG - Intergenic
1115430315 14:33309898-33309920 CTGGCCCTGCAGAGGGAGGAGGG + Intronic
1115476083 14:33814155-33814177 TTGGATATGGAGAGAGATGATGG + Intergenic
1115762111 14:36584920-36584942 TTCGAGAACCTGAGGGAGGAGGG - Intergenic
1115947592 14:38679674-38679696 ATGGAGACTCAGAAGGAGGAGGG - Intergenic
1116848003 14:49882517-49882539 TTGTAGATGCGGAGGGTGGGAGG + Intergenic
1117555241 14:56877035-56877057 TGGGAGATGCAGGGGGTGGAAGG + Intergenic
1117803488 14:59467301-59467323 TTGGAGATGGGGAGTGAAGAAGG + Intronic
1118315444 14:64723094-64723116 TTGCAGGTGCAGAGGCAGGCAGG - Intronic
1118714176 14:68547656-68547678 TTGGAGTTTCAGAGCTAGGAGGG - Intronic
1118839142 14:69497942-69497964 TTTGAGAGGCCGAGGCAGGAGGG + Intronic
1119002742 14:70897768-70897790 GTACAGAAGCAGAGGGAGGAAGG + Intergenic
1119117920 14:72044491-72044513 AAGGAGAGGGAGAGGGAGGAAGG - Intronic
1119191714 14:72687552-72687574 TAGGGGATGCAGAGGAAAGATGG - Intronic
1119217608 14:72881106-72881128 TTGGAGCTGCAGGAGGATGATGG - Intronic
1119662095 14:76459410-76459432 CTGGAGAAACAGAGGGTGGAGGG + Intronic
1120005692 14:79355268-79355290 TTGGAGGGACAGAGGAAGGAGGG - Intronic
1120993160 14:90396645-90396667 TTGGAGATGTTGAGGTGGGAGGG + Intronic
1121102785 14:91261515-91261537 TTGGATAAGGACAGGGAGGAGGG + Intergenic
1121409268 14:93737969-93737991 CAGGGGATGCTGAGGGAGGAAGG + Intronic
1121564130 14:94895977-94895999 ATGGAGTTGCAGAGAGAGGCAGG + Intergenic
1121995804 14:98602083-98602105 ATGGAAATGCTGGGGGAGGAGGG - Intergenic
1122043627 14:99008159-99008181 GGGGAGAGGCAGAGGCAGGAGGG - Intergenic
1122151522 14:99728552-99728574 CTGGAAATGGAGAGGGTGGAGGG - Intergenic
1122153096 14:99735062-99735084 TAGGGGATGCGGAGGGACGAGGG + Intergenic
1122209831 14:100166879-100166901 TTTGAGATGCCGAGGCGGGAGGG + Intergenic
1122348281 14:101073636-101073658 CTGGGGCTGCAGAGGGAGGCCGG - Intergenic
1122877048 14:104672428-104672450 TTTGGGAAGCAGAGGAAGGAGGG + Intergenic
1122915906 14:104858889-104858911 GTGGAGATGGAGATGGAGGGTGG - Intergenic
1122969536 14:105146920-105146942 CTGCAGAAGCAGACGGAGGAGGG - Intronic
1202833170 14_GL000009v2_random:58277-58299 CTGGGGATGCAGACAGAGGAGGG - Intergenic
1123430589 15:20212297-20212319 TTGGAGCTGAGGTGGGAGGATGG - Intergenic
1123468172 15:20531234-20531256 GTGGGGGTGCTGAGGGAGGAGGG + Intergenic
1123649943 15:22469830-22469852 GTGGGGGTGCTGAGGGAGGAGGG - Intergenic
1123728488 15:23126444-23126466 GTGGGGGTGCTGAGGGAGGAGGG + Intergenic
1123740346 15:23278649-23278671 GTGGGGGTGCTGAGGGAGGAGGG - Intergenic
1123746652 15:23323909-23323931 GTGGGGGTGCTGAGGGAGGAGGG + Intergenic
1123815187 15:23971085-23971107 GTGGAGATGCAGAGAGTGAAAGG + Intergenic
1124278920 15:28347225-28347247 GTGGGGGTGCTGAGGGAGGAGGG + Intergenic
1124303779 15:28564383-28564405 GTGGGGGTGCTGAGGGAGGAGGG - Intergenic
1124493790 15:30174181-30174203 TTGCCGCTGCAGAGGGAGGGTGG - Intergenic
1124749778 15:32364468-32364490 TTGCCGCTGCAGAGGGAGGGTGG + Intergenic
1125400722 15:39299779-39299801 TTGGGGAAGCAGAGGGTGGGGGG + Intergenic
1125540750 15:40468595-40468617 TTTGGGAGGCAGAGGCAGGAGGG + Intergenic
1125720269 15:41841991-41842013 GAGGAGGTGCAGAGGGAGGGAGG - Intronic
1126045460 15:44635496-44635518 CTGGGGATGCTGAGGCAGGAGGG + Intronic
1126475250 15:49058954-49058976 ATGGAGACTCAGAAGGAGGAAGG + Intergenic
1126551084 15:49930238-49930260 TTAGGGATGAAGAGGGAGGATGG + Intronic
1126696101 15:51327014-51327036 TTGGAAATGTAGTGGGAGTAGGG - Intronic
1126763567 15:51991765-51991787 GTGGAGATGCAGTGGGAGGATGG + Intronic
1126775285 15:52094979-52095001 TGTAAGAGGCAGAGGGAGGATGG + Intergenic
1127599618 15:60522465-60522487 TTTGAGAGGCTGAGGCAGGAAGG + Intronic
1127877677 15:63124708-63124730 TTTGAGAGGCAGAGGCAGGTGGG + Intronic
1127997489 15:64162113-64162135 TTGGAGATGAAGATGTAGGCCGG - Exonic
1128266268 15:66269237-66269259 TTGGAGATGGAGGTGGAGGTGGG - Intergenic
1128338411 15:66803143-66803165 ATGGGGAGGCAGGGGGAGGAGGG - Intergenic
1129059199 15:72847400-72847422 TTTGAGAGGCCGAGGCAGGAGGG - Intergenic
1129231392 15:74199037-74199059 TGGGAGAGCCAGAGGGAGGGTGG + Intronic
1129672838 15:77616617-77616639 TTGCAGGTGCAGGGGGAGGAGGG - Intronic
1129687192 15:77693479-77693501 ATGAAGCTGCAGAGGGAGGCTGG + Intronic
1129893884 15:79089923-79089945 CTGGAGATGCAGAGGAAGATGGG - Intronic
1130182849 15:81648805-81648827 TTGGAGACTCAGAAGAAGGAAGG - Intergenic
1131069486 15:89456817-89456839 TTGGAGCAGCAAAGGAAGGAGGG + Intergenic
1131355451 15:91742038-91742060 GTGGAGATGCAGGTGGAGAATGG + Intergenic
1131465597 15:92652796-92652818 AAGGAGTTGCAGAGGGAGAAAGG + Intronic
1131520285 15:93109405-93109427 TTGGAGGCGGGGAGGGAGGACGG - Intergenic
1131620077 15:94058909-94058931 TTTGAGACCCAGAGTGAGGAAGG - Intergenic
1131866686 15:96718566-96718588 TTGGGGATGCAGGGGGAGGGGGG - Intergenic
1131948969 15:97660050-97660072 TGAGAGATGCAAAGTGAGGAGGG - Intergenic
1132318148 15:100905412-100905434 AAGAACATGCAGAGGGAGGATGG + Intronic
1132420238 15:101659592-101659614 TAGGAGATGGAGAGGGAGACAGG - Intronic
1132793413 16:1706343-1706365 ATGGAGATCCAGATGGACGAGGG + Exonic
1132833478 16:1941171-1941193 TGGGGCAAGCAGAGGGAGGAAGG + Intronic
1132850247 16:2021780-2021802 TTGAAGAGGCAGCGGGAGGGAGG - Intergenic
1132984620 16:2758259-2758281 TTGGAGAGGTGGAGGCAGGAGGG + Intronic
1133346966 16:5077671-5077693 TTGGGGAAGCTGGGGGAGGAGGG + Intronic
1133469258 16:6058341-6058363 TCTGAGAAGGAGAGGGAGGAAGG - Intronic
1133602374 16:7351965-7351987 TTGGAGCTGAAAAGGAAGGAGGG + Intronic
1133696258 16:8265838-8265860 TTGGAGACTCAGAAGGGGGAAGG - Intergenic
1133720364 16:8488966-8488988 GGGGGGAGGCAGAGGGAGGAAGG + Intergenic
1133978639 16:10617833-10617855 CTGGAGAGGGAGAGGGAGCAAGG + Intergenic
1134449355 16:14354095-14354117 GGGGAGGGGCAGAGGGAGGAGGG + Intergenic
1135200129 16:20430030-20430052 TTGGAGACTCAGAAGGAAGAAGG + Intronic
1135218560 16:20593564-20593586 TTGGAGACTCAGAAGGAGGAAGG - Intergenic
1135227476 16:20674443-20674465 TTGGGGGTGGAGAGGGGGGAGGG - Intronic
1135304419 16:21356108-21356130 TGGGAGATGCAGTAGGAGGGTGG + Intergenic
1135694706 16:24575793-24575815 GAGGAGAGGGAGAGGGAGGAGGG + Intergenic
1135694758 16:24575915-24575937 GAGGAGAGGGAGAGGGAGGAGGG + Intergenic
1135759440 16:25125499-25125521 TTGGAGAGGGATAGGGAAGAGGG - Intronic
1135822467 16:25696222-25696244 TTGGAAAGGGAGAGGGAAGAGGG - Intronic
1135966190 16:27037185-27037207 TGGGAGATGCAGGGGGAAGGAGG - Intergenic
1136042140 16:27588132-27588154 TTTGGGAGGCAGAGGCAGGAGGG - Intronic
1136118618 16:28113045-28113067 TTGGACCTGCAGAGGGAAGAGGG + Exonic
1136854048 16:33638920-33638942 TTGGAGCTGAGGTGGGAGGATGG + Intergenic
1137368117 16:47878562-47878584 TTGGAGGTGCCAGGGGAGGAGGG - Intergenic
1137532445 16:49287949-49287971 CTGAAGATGGAGAAGGAGGAAGG - Intergenic
1138027267 16:53531764-53531786 TGGCAGATGCAGGAGGAGGAAGG - Intergenic
1138275278 16:55729811-55729833 TTGGGGATGCAGAGGCATAAAGG + Intergenic
1138441107 16:57035466-57035488 TTGGAGATTGAGTGGAAGGATGG - Intronic
1138931970 16:61669826-61669848 TGGGAGGTGCAGAGAGATGAAGG - Intronic
1138950681 16:61908666-61908688 TGGTAGATGGAGTGGGAGGAGGG + Intronic
1139342476 16:66277496-66277518 TTGGAGATGCTGAGAGAGAAAGG + Intergenic
1139354956 16:66362012-66362034 TTTGGGTTGCAGAAGGAGGAAGG + Intergenic
1139616463 16:68097179-68097201 TTGGAGGTGGGGAGGGAGAAAGG + Intronic
1139747206 16:69084132-69084154 TAGGAGATGCAGTTGGAGGTGGG + Exonic
1139800936 16:69522161-69522183 TAGGTGAAGAAGAGGGAGGAGGG + Intergenic
1140678313 16:77357007-77357029 TTAGGGATGCAGAGGACGGAAGG + Intronic
1140825708 16:78704019-78704041 TTGGAGATGGATAGGGGTGATGG - Intronic
1141030387 16:80582631-80582653 TTAGAGACTCAGAAGGAGGAAGG + Intergenic
1141492070 16:84380502-84380524 TGGGGGAGGCGGAGGGAGGAAGG + Intronic
1142417541 16:89950735-89950757 TTTGGGAGGCAGAGGCAGGAGGG + Intronic
1142546216 17:705344-705366 TCGGAGAGGCTGAGGCAGGAGGG + Intronic
1142614716 17:1127587-1127609 CTGGAGAGGAGGAGGGAGGAGGG - Intronic
1142923039 17:3207765-3207787 CTGGAGAAGCAGTGGCAGGATGG - Intergenic
1143095815 17:4477767-4477789 TTGGAGCAGCACAGGGAGGTGGG - Intronic
1143591008 17:7885680-7885702 TTGGACAGGCAGAGTGGGGACGG + Intronic
1143757060 17:9074912-9074934 TGGGAAACGCAGAGTGAGGACGG - Intronic
1143764050 17:9126046-9126068 TTGCAGAAGCAGAGTCAGGATGG + Intronic
1143894497 17:10125646-10125668 GGGGAGATGAGGAGGGAGGAGGG + Intronic
1143896575 17:10141205-10141227 TTTGAGAGGCCGAGGCAGGAGGG + Intronic
1143947426 17:10605466-10605488 TTGGAGAAAGAGAAGGAGGAGGG + Intergenic
1144051165 17:11498268-11498290 TTGGGGATGGAGGAGGAGGAAGG - Intronic
1144143219 17:12370491-12370513 GTGGAGAAGCAGAGAGAGGAAGG + Intergenic
1144146507 17:12404362-12404384 TTGGAGATGCCAAGGTGGGAAGG - Intergenic
1144838459 17:18171026-18171048 CTGGAGCTGCAGATGAAGGAAGG - Intronic
1146469111 17:33110394-33110416 TTCCAGATGCAGAGGGACGAAGG - Intronic
1146614567 17:34344618-34344640 TTGGAGATTCAGAAGGGGGAAGG + Intergenic
1146665428 17:34699500-34699522 CTGGAGAGGCAGAGGGAGAAAGG - Intergenic
1147260749 17:39208708-39208730 AGGGAGATGCAGAAAGAGGAGGG - Intergenic
1147277726 17:39333146-39333168 AGGGAGACGGAGAGGGAGGAGGG - Intronic
1147359289 17:39921163-39921185 TGGGAGATGCAGGGTCAGGAGGG + Intronic
1147909837 17:43848927-43848949 CAGGAGCTGCAGAGGGAAGAGGG + Intronic
1148188852 17:45664915-45664937 TTGGAGAGGCAGAGGCATGTGGG + Intergenic
1148227992 17:45912551-45912573 TTGGAGCTCCAGAGGGAGTGTGG + Intronic
1148249594 17:46064625-46064647 TTGGAGAGGGAGGAGGAGGAGGG - Intronic
1148382029 17:47206898-47206920 GTGGAGGTGGAGAAGGAGGAGGG + Intronic
1148387015 17:47241484-47241506 TTGGAGACTCAGAAGGGGGAAGG - Intergenic
1148648814 17:49234948-49234970 TGGGAGATGCAAAGGTGGGAGGG + Intergenic
1148682730 17:49484025-49484047 ATGGAGAAGAAGAGAGAGGAAGG - Intergenic
1148791222 17:50174074-50174096 TTTGGGAGGCAGAGGCAGGAGGG + Intronic
1149020235 17:51955195-51955217 TTCGAGATGCAGAAAGATGAAGG - Intronic
1149176305 17:53876082-53876104 TAGGGGGTGCAGGGGGAGGAAGG - Intergenic
1149275350 17:55027400-55027422 TTGGAGACTCAGAAGGGGGATGG + Intronic
1149671515 17:58416964-58416986 TTGCTGAGGCAGAGGGAGGGGGG + Exonic
1149864671 17:60144618-60144640 TTTGAGAGGCTGAGGCAGGAAGG - Intergenic
1150000694 17:61437134-61437156 AAGGAGAGGGAGAGGGAGGAAGG - Intergenic
1150417264 17:64997565-64997587 TTCAAGATGAAGAGTGAGGAGGG - Intergenic
1150634463 17:66903291-66903313 ATGGAGATGCAGTTGGAGCAGGG + Intergenic
1150639903 17:66942518-66942540 CTGGAGGGACAGAGGGAGGAGGG + Intergenic
1150827098 17:68486615-68486637 TAGGAGAAGGAGAAGGAGGAAGG - Intergenic
1150867435 17:68868222-68868244 TGGGAGCTGCAGAGGCAGCACGG - Intronic
1150998314 17:70344894-70344916 TTGAAGAGGCAGAGGGAAGAGGG - Intergenic
1151404117 17:73875847-73875869 TTGGAAACCCAGAGTGAGGAGGG - Intergenic
1151536587 17:74742309-74742331 CTGGAGTTGGGGAGGGAGGATGG + Intronic
1151628849 17:75296141-75296163 GTGGAGGTGCAGAGGCAGCAAGG - Intergenic
1151724787 17:75877681-75877703 ATGGAGATGGGAAGGGAGGAAGG - Intronic
1151779691 17:76236958-76236980 TGGGAGGTTTAGAGGGAGGAAGG + Intronic
1152031248 17:77844902-77844924 TTGGAGAAGCATGGGGAGGCAGG - Intergenic
1152063505 17:78096783-78096805 CTGGAGAAGAAGAGCGAGGATGG - Intronic
1152332270 17:79680119-79680141 TTCGAGACTCAGAGGCAGGAGGG - Intergenic
1152469606 17:80483354-80483376 CTGAGGGTGCAGAGGGAGGACGG + Intergenic
1152813013 17:82391096-82391118 GAGGAGGTGCTGAGGGAGGAGGG + Intronic
1153303686 18:3613576-3613598 TTAGAGAGGAAGTGGGAGGATGG - Intronic
1153410700 18:4789455-4789477 TGGAGGATGCAGTGGGAGGAGGG - Intergenic
1153810881 18:8750533-8750555 CTGGAGGTGCAGAGGAAGGAAGG + Intronic
1153924720 18:9825924-9825946 TGGGAGCTTCAGAGGCAGGAAGG + Intronic
1153987778 18:10368551-10368573 GAGGAGAGGGAGAGGGAGGAAGG + Intergenic
1154423073 18:14251690-14251712 CTGGGGATGCAGACAGAGGAGGG - Intergenic
1155044396 18:22091077-22091099 TTTGAGAGGCTGAGGCAGGAGGG + Intronic
1155577812 18:27267064-27267086 TTGGGGAAGGAGTGGGAGGAGGG + Intergenic
1156594248 18:38528641-38528663 TTCGGGATGCTGAGGCAGGAGGG + Intergenic
1157096478 18:44689773-44689795 TTGGGAATGTAGAGGGAGAAAGG + Intronic
1157127813 18:44973788-44973810 GTGGAGAGGCAGACAGAGGAGGG + Intronic
1157511174 18:48275987-48276009 CTCAAGATACAGAGGGAGGAGGG + Intronic
1157694536 18:49710398-49710420 TTCCAAATGCAGAGAGAGGAGGG - Intergenic
1158123898 18:54081465-54081487 ATGGGGATGGAAAGGGAGGAAGG - Intergenic
1158499487 18:57987313-57987335 TGGGAGGGGCAAAGGGAGGAGGG - Intergenic
1158665326 18:59427640-59427662 TAGGAGATGCAGAGGCAGGCAGG - Intergenic
1159122084 18:64182879-64182901 AGGGAGAGGCAGAGGGAGGGAGG - Intergenic
1160062093 18:75540103-75540125 TTGAATCTGCAGAAGGAGGAAGG + Intergenic
1160400314 18:78605964-78605986 CTTAGGATGCAGAGGGAGGATGG - Intergenic
1160705187 19:526252-526274 TTGGAGGTGAAGGGGGAGGAAGG - Intergenic
1160986332 19:1840682-1840704 TTGGAGTTGCAGGGAGTGGAGGG - Intronic
1161319291 19:3633576-3633598 CAAGAGAGGCAGAGGGAGGAAGG + Intronic
1161438646 19:4278777-4278799 TTGGAGCAGCAGAAGGAAGAGGG - Exonic
1161552581 19:4922508-4922530 TTGGGGAGGCCGAGGGCGGATGG - Intronic
1161613095 19:5254582-5254604 TTGGGGAGGCAGAGAGAGCAGGG + Intronic
1161636216 19:5390892-5390914 GGGGAGATGGAGAGGGGGGAGGG - Intergenic
1162186976 19:8913460-8913482 GTGGGGCTGGAGAGGGAGGATGG + Exonic
1162472647 19:10881663-10881685 GTGGAGCTGCAGAGAGAGCAGGG + Intronic
1162578477 19:11513307-11513329 TCAGAGATGGAGGGGGAGGAGGG + Intronic
1162894939 19:13759583-13759605 TTAGAGATGCTGGGGGAGGGGGG - Intronic
1162933474 19:13968766-13968788 TCGCAGAAGCAGAGGTAGGAAGG - Exonic
1163000564 19:14363994-14364016 TTTGCGATGGAGAGGCAGGAGGG - Intergenic
1163267782 19:16232020-16232042 TAGGAGATGCAGAGAGAGCCAGG - Intronic
1163779612 19:19239576-19239598 TGGGAGGAGGAGAGGGAGGAGGG - Intronic
1164072429 19:21780547-21780569 TTAGAGATGCAGAAGCAGCATGG - Intergenic
1164158690 19:22612296-22612318 TGGGGGATGCAGAGGGGGTAGGG - Intergenic
1164680415 19:30130788-30130810 AGGGAGAAGGAGAGGGAGGAAGG - Intergenic
1164790353 19:30972298-30972320 TTGGAGTGGGTGAGGGAGGAGGG - Intergenic
1164994373 19:32708884-32708906 TGGGAGATGCAGAGAGGGTAAGG - Intronic
1165374535 19:35432419-35432441 GTGGAGGTGGAGAGGGAGGGAGG + Intergenic
1165412877 19:35673209-35673231 CTGGGGAGACAGAGGGAGGACGG - Intronic
1165474613 19:36023354-36023376 ATGGAGACCCAGAGGCAGGAAGG - Intronic
1165854527 19:38871482-38871504 TTGTAGTCCCAGAGGGAGGAGGG - Intronic
1165877744 19:39021330-39021352 ATGGAGGTGGAGAGGGAGGCAGG - Intronic
1166015178 19:39974215-39974237 GTGGAGATTAGGAGGGAGGAAGG + Intronic
1166031275 19:40131916-40131938 TTTGGGAGGCAGAGGCAGGAGGG + Intergenic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166147399 19:40847052-40847074 CTGGGGTTGCAGAGAGAGGATGG + Intronic
1166151548 19:40878937-40878959 CTGGGGTTGCAGAGAGAGGATGG + Intronic
1166170420 19:41024441-41024463 CTGGGGTTGCAGAGAGAGGATGG + Intergenic
1166178639 19:41091709-41091731 CTGGGGTTGCAGAGAGAGGATGG - Intronic
1166184215 19:41128838-41128860 AGGGAGAGGGAGAGGGAGGAGGG + Intergenic
1166831826 19:45643823-45643845 CTGGACCTGCAGAGGGAGGTGGG + Intronic
1166886632 19:45965223-45965245 TTGAAGAAGCAGAGAGAGGACGG - Intronic
1167114076 19:47478877-47478899 TTGGAGATTCAGAAGCAGGAAGG + Intronic
1167127873 19:47563561-47563583 TGGGAGATGCAGGGGGAGATGGG - Intergenic
1167383167 19:49150021-49150043 CTGGAGAGGAACAGGGAGGAGGG + Intronic
1167398728 19:49250116-49250138 TTGGAGTTTCAGAGGGAGAGGGG - Intergenic
1167477515 19:49709468-49709490 TTGGGGATGGGGATGGAGGAGGG - Intronic
1167525818 19:49983194-49983216 TGGGACATGCAATGGGAGGAAGG - Intronic
1167608575 19:50494906-50494928 GTGGAGGAGCAGAGGGAGGAGGG + Intergenic
1167721714 19:51184339-51184361 TTGCAGCTGCTGAGGGAGGGAGG + Intergenic
1167723677 19:51196607-51196629 TTGGAGACTCAGAATGAGGAAGG - Intergenic
1202639497 1_KI270706v1_random:69433-69455 CTGGGGATGCAGACAGAGGAGGG + Intergenic
925421211 2:3713431-3713453 GTGGAGCAGCAGAGGGGGGAAGG - Intronic
925428493 2:3771132-3771154 CGGAGGATGCAGAGGGAGGACGG - Intronic
925733962 2:6944175-6944197 TTGGAGATGCGGGAGGAGGCCGG + Intronic
925770520 2:7278193-7278215 TTTGAGAAGCTGAGGTAGGAGGG + Intergenic
925837991 2:7964679-7964701 CTGGAGAAGCAGAGGTAGGGCGG - Intergenic
926028672 2:9566617-9566639 TTTGAGAGGCCGAGGCAGGAGGG + Intergenic
926175598 2:10588921-10588943 ATGGAGGTGCAGAGGGTGGAGGG - Intronic
926309155 2:11662083-11662105 CTGGAGCTGCTGAGTGAGGAGGG - Exonic
926624961 2:15083299-15083321 GTGGAGATGGAGAGGGAAGAAGG - Intergenic
926746338 2:16161435-16161457 CTGGAAATACACAGGGAGGATGG + Intergenic
926811012 2:16755427-16755449 ATGGAGCTGCAGAGAGAGGTGGG + Intergenic
926906942 2:17814827-17814849 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
927049808 2:19316193-19316215 TTGGAGAGTCAGAGGGAGGAGGG - Intergenic
927489397 2:23510703-23510725 TTAGAGCTCCAGAGGGAGGGCGG + Intronic
927499648 2:23574161-23574183 TTGGAGGAGGAGAGGGAAGAAGG + Intronic
927936256 2:27078511-27078533 TTGGAGAGGTGGGGGGAGGAAGG + Intergenic
928885349 2:36142183-36142205 TTGTACATGCATATGGAGGAAGG - Intergenic
928895087 2:36252276-36252298 TTAGGGATGGAGAGGGATGAAGG - Intergenic
929262750 2:39883884-39883906 TTTTAGATGCAGAGGAAGAAGGG + Intergenic
929626904 2:43418749-43418771 TTTGAGAGGCAGCGGGAGGAAGG + Intronic
929648911 2:43657906-43657928 TTGTAGATACAGAAGAAGGAGGG - Intronic
929902449 2:46017137-46017159 ATGGAGATGGAGAGGGGTGATGG - Intronic
930423814 2:51187982-51188004 TAGGAAATGGAGAGGGTGGAAGG - Intergenic
931744734 2:65282104-65282126 GTGGAGAGGGAGAGGGAGGGAGG - Intergenic
932741425 2:74293736-74293758 TTGGGGAAGCAGAGAGAGAAGGG - Intronic
932794544 2:74682989-74683011 GTTGGGATGCAGAGGGAGCAGGG - Intronic
932875062 2:75442793-75442815 TTGGAGATTCAGAAGTGGGAAGG + Intergenic
932959305 2:76394133-76394155 GTGAAGATGCAGAGGGAAGATGG - Intergenic
933270959 2:80232440-80232462 TGGGAGATGAAGAAGGAGAAGGG - Intronic
933537180 2:83590772-83590794 TTTGAAAGGCAGAGGGAAGAGGG + Intergenic
933614665 2:84471423-84471445 TAGGAGTTGCAGAAGGATGAAGG + Intergenic
933702236 2:85263719-85263741 TTGGAGATGAGGAGGAAGGCTGG + Intronic
933904903 2:86882292-86882314 TTGGAGACTCAGAAGGAGGAGGG + Intergenic
934484794 2:94695637-94695659 TTGGAGACTCAGAGCGGGGAGGG + Intergenic
934494982 2:94788883-94788905 CTGGGGATGCAGACAGAGGAGGG + Intergenic
934876232 2:97923512-97923534 CTTGAGAGGCTGAGGGAGGAGGG + Intronic
935033862 2:99348771-99348793 TTGGGGATGGGGACGGAGGAAGG + Intronic
935196595 2:100820059-100820081 GGGGAGGTGGAGAGGGAGGAGGG + Intergenic
936367325 2:111869870-111869892 TTGGAGACTCAGAAGGAGGAGGG - Intronic
936530265 2:113271421-113271443 TTGGAAAGGCAGAGGGAGGGAGG - Intronic
936816055 2:116462268-116462290 TTGGAAAGGCAGGGGGAGGAGGG + Intergenic
937673619 2:124564999-124565021 TTGGGGATGCAGAAAGAGCATGG + Intronic
938575638 2:132600947-132600969 CTGGAGATGCAGAGGAGGGAAGG - Intronic
938644766 2:133319161-133319183 TTGAAAATGCAGGGGGTGGAAGG - Intronic
939448304 2:142337888-142337910 TGGGAGATGAAGAGGGAAGCAGG - Intergenic
940007938 2:149026166-149026188 TGGGAAAGGCAGAGGGTGGAGGG + Exonic
940158485 2:150684631-150684653 TTGGGGAAGCTGAGGGAGAATGG - Intergenic
940886534 2:158994511-158994533 TTGGGGAAGCCAAGGGAGGAAGG - Intronic
941284869 2:163598231-163598253 TGGGGGAGGCAGAGTGAGGAAGG - Intronic
941435747 2:165469247-165469269 TTTGATATGCAGACAGAGGAGGG - Intergenic
941849427 2:170164421-170164443 CTGGAGAGGCAAAGGGAAGAGGG - Intergenic
941857045 2:170241921-170241943 TGTGAGATGCAGAGGCAGCAGGG + Intronic
941981612 2:171464451-171464473 TTGAAGACACAGAGGGAGAAAGG - Intronic
942604655 2:177677600-177677622 TTGAAGAAGGAGAGGGTGGAAGG + Intronic
945935985 2:215903160-215903182 TTGGAGAAGAAGAGGGTGAAGGG - Intergenic
945942668 2:215965470-215965492 CAGGGGATACAGAGGGAGGAAGG + Intronic
946156320 2:217809104-217809126 ATGGAGATACAGATGGATGAAGG + Intronic
946440297 2:219689396-219689418 TTGTGGAAGGAGAGGGAGGACGG - Intergenic
946859013 2:223982306-223982328 ATGGAGACTCAGAAGGAGGAGGG + Intronic
946875029 2:224120370-224120392 TTGGAGACTCAGATGGAGGGAGG + Intergenic
947029942 2:225782598-225782620 AGGGAGAAACAGAGGGAGGAAGG - Intergenic
947537309 2:230948299-230948321 CAGGAGATGGGGAGGGAGGAAGG - Intronic
947581254 2:231320272-231320294 TTGCTGATGCAGGGGGATGAGGG + Intronic
948062796 2:235053886-235053908 GCGGAGCTGAAGAGGGAGGAAGG + Exonic
948230997 2:236349220-236349242 ATGGAGCTGAAGAGTGAGGAGGG + Intronic
948456425 2:238106589-238106611 CTGGAGGGGCAAAGGGAGGATGG - Intronic
948553605 2:238792268-238792290 TGAGAGAGGGAGAGGGAGGAAGG - Intergenic
948653183 2:239461926-239461948 TTGGAGACACAGAGAGAGAATGG + Intergenic
1168977427 20:1978007-1978029 TAGAAAATGCAGAGTGAGGAAGG - Intergenic
1169083255 20:2810604-2810626 TTGGAGACTCAGAAGGAGGAGGG - Intergenic
1169084392 20:2817603-2817625 TTGGGGATGCAGACTGAGGCAGG - Intronic
1170852989 20:20020893-20020915 TTGAAGATGCAGATGCAGGAGGG + Intronic
1171230540 20:23480670-23480692 TTGGAGGGGCAGAGAGATGAGGG + Intergenic
1171885971 20:30652659-30652681 CTGGGGATGCAGACAGAGGAGGG + Intergenic
1171886165 20:30653789-30653811 CTGGGGATGCAGACAGAGGAGGG + Intergenic
1172230500 20:33332860-33332882 TCGCTGATGGAGAGGGAGGAAGG + Intergenic
1172344839 20:34189944-34189966 TAGGACATGCAGAGGCAGGCAGG + Intergenic
1172430109 20:34883208-34883230 TTGTAGTTGAAGAGGGAGAAAGG + Intronic
1172546517 20:35765994-35766016 GTGGAGAGCCAGAGGAAGGAAGG - Intergenic
1172984843 20:38976758-38976780 TAGGGGCTGCAGAGGGAAGAGGG - Intronic
1172998421 20:39088320-39088342 TTCCAGCTGCAGAGGGAGAAGGG - Intergenic
1173059618 20:39648747-39648769 TTGGAGATTCAGAATGGGGAGGG + Intergenic
1173313060 20:41917655-41917677 AAGGAGAGGCAGAGGGAGAAGGG + Intergenic
1173581768 20:44152030-44152052 TTGGTGGTGGAGAGGGAGGAAGG - Intronic
1173870496 20:46338978-46339000 GTGGAGATGGATGGGGAGGAGGG + Intergenic
1173910574 20:46666744-46666766 TTTGAGAGGCCGAGGCAGGAGGG - Intronic
1174865316 20:54130230-54130252 TTAGAAATGCAGAGGGAGGATGG + Intergenic
1175303749 20:57961474-57961496 TTGGAGATCAGCAGGGAGGAGGG - Intergenic
1175961427 20:62638695-62638717 TGGGAGATGCAGAGGGAGGGCGG + Intergenic
1176647827 21:9367032-9367054 CTGGGGATGCAGACAGAGGAGGG + Intergenic
1176850387 21:13908258-13908280 GTGGGGATGCAGACAGAGGAGGG + Intergenic
1177489472 21:21803885-21803907 TTTGAGAGGCTGAGGCAGGAGGG + Intergenic
1177845036 21:26279176-26279198 TTGGAGGTGCAGGGAGAGCAAGG + Intergenic
1178251167 21:31004611-31004633 TCCAAGATGCAGAGGGAGCAAGG + Intergenic
1178345940 21:31828065-31828087 GGGAAGATGCAGAGGAAGGAAGG + Intergenic
1178348321 21:31851155-31851177 TTGGAGGAGCAGAGGAGGGAGGG - Intergenic
1178946037 21:36948484-36948506 TTGGGGAGGCCGAGGCAGGAAGG + Intronic
1179072885 21:38089482-38089504 TTGAAGATGAAGATGGAGGAAGG + Intronic
1179137541 21:38693413-38693435 ATGGAGATGAAGAGGATGGATGG - Intergenic
1179146514 21:38773212-38773234 TTCGAGATGCAGATGGAGCGTGG + Intergenic
1179164525 21:38925193-38925215 TTGCAGCTGCAGGGGAAGGAAGG + Intergenic
1179311366 21:40198742-40198764 CTGGAGAGGCAGTGGGAGGTGGG + Intronic
1179471664 21:41614424-41614446 TTGGCTTTGAAGAGGGAGGAAGG + Intergenic
1179958691 21:44756047-44756069 ATGGAGAAGAAGAGGGAGGAGGG + Intergenic
1180149256 21:45939362-45939384 TTGAAGCAGCTGAGGGAGGAGGG - Intronic
1180362445 22:11912437-11912459 CTGGGGATGCAGACAGAGGAGGG - Intergenic
1180785130 22:18542912-18542934 TTAGAAATGCAGAGAGAGGCCGG + Intergenic
1181128712 22:20716947-20716969 TTAGAAATGCAGAGAGAGGCCGG + Intronic
1181242033 22:21482266-21482288 TTAGAAATGCAGAGAGAGGCCGG + Intergenic
1181396998 22:22629812-22629834 TGGGCGGGGCAGAGGGAGGAGGG + Intergenic
1181413982 22:22746343-22746365 AAGGAAAGGCAGAGGGAGGAGGG - Intronic
1181422333 22:22810645-22810667 AAGGAGAGGCAGAGGGAGGAGGG - Intronic
1181499743 22:23309171-23309193 TGGGCGGGGCAGAGGGAGGAGGG + Intronic
1181654491 22:24284987-24285009 TTGAAGAGGAAGATGGAGGAAGG + Intronic
1181704968 22:24644489-24644511 TGGGAGGGGCAGAGGGAGGAGGG + Intergenic
1181787654 22:25238447-25238469 TTGGAGATACAGCGGGAGGGAGG + Intergenic
1181819390 22:25463485-25463507 TTGGAGATACAGCGGGAGGGAGG + Intergenic
1181930538 22:26397194-26397216 TGGGAGGGGCAAAGGGAGGAAGG + Intergenic
1182474218 22:30567519-30567541 TTGGGGAGGCTGAGGCAGGAGGG - Intronic
1182536642 22:31008669-31008691 TTAGAGATACACAGAGAGGAAGG + Intergenic
1183481165 22:38066333-38066355 GAGGAGATGCGGAGGGGGGAAGG - Intronic
1183522039 22:38301034-38301056 GTGGAAAGGCAGAGGGAGAAAGG + Intronic
1183615707 22:38944075-38944097 GAGGAGAAGGAGAGGGAGGAAGG - Intergenic
1183954542 22:41371492-41371514 CTGGAGATGGAGAGAGAGGGGGG - Intronic
1184377403 22:44123372-44123394 TTTGAGAGGGAGAGAGAGGAAGG + Intronic
1184791899 22:46705232-46705254 TGGAAGATGCAGAGAGAGTATGG + Intronic
1185157564 22:49203356-49203378 CTCAAGATGCAGAGGAAGGAAGG + Intergenic
949125259 3:439456-439478 TGGAGGGTGCAGAGGGAGGAGGG + Intergenic
949494856 3:4621846-4621868 TTGGAGTTGCAGGAGGAGAAAGG - Intronic
949877262 3:8634441-8634463 ATGAAGATGCAAGGGGAGGAAGG - Intronic
949942407 3:9165040-9165062 TGGGGGATGCAGAGGCAGGCTGG + Intronic
950101582 3:10360118-10360140 TGGGGGCTGCAGAGAGAGGAAGG + Exonic
950149623 3:10676495-10676517 ATGGGGATGGGGAGGGAGGAGGG + Intronic
950229718 3:11265942-11265964 TTTGGGATGCAGAGGTGGGAGGG + Intergenic
950403755 3:12791437-12791459 TTGGAGATACAGATGGGGGAAGG - Intergenic
950634325 3:14304244-14304266 TTGCAGAGTCACAGGGAGGACGG - Intergenic
950773796 3:15332709-15332731 TTGGAGATGTGGAGGGAGCTGGG - Intronic
951504458 3:23427320-23427342 TTTGGGAGGCAGAGGCAGGAAGG + Intronic
951553994 3:23902602-23902624 TTGGAGAGGCAGGTGGAGGTGGG - Intronic
951778051 3:26332136-26332158 CTGGAGATACTGAGAGAGGAGGG + Intergenic
951891603 3:27572872-27572894 TAGGAGGTAGAGAGGGAGGAAGG - Intergenic
952132862 3:30384808-30384830 CTTGAGATGAGGAGGGAGGAGGG - Intergenic
952419579 3:33118973-33118995 TGGGAGAAGAAGAGGGAGAAAGG - Intronic
952501923 3:33971019-33971041 TTGGAGAGTCAGAGGTAGGTTGG + Intergenic
952732125 3:36649599-36649621 GAAGAGATGAAGAGGGAGGATGG - Intergenic
953023297 3:39129708-39129730 GTGGGGATGCTGAGGGAGTAGGG + Intronic
953064355 3:39455728-39455750 CTGGAGATGGAGATGGAGGGTGG + Intergenic
953418215 3:42735046-42735068 TTGGGGATGCATAGGGAGTTAGG + Intronic
953978210 3:47398668-47398690 TGGGGGCTGCAGTGGGAGGATGG - Intronic
954430841 3:50470183-50470205 GTAGAGATGCAGTGGCAGGAAGG - Intronic
954431923 3:50475464-50475486 GTGGAGATGCAGAGGCTGGGAGG - Intronic
954623550 3:52009682-52009704 TGGGAGATTGAGAGGGGGGAAGG - Intergenic
954794225 3:53153345-53153367 GTGGGGAGGCAGAGGGAGGAAGG + Intergenic
955275047 3:57539331-57539353 GTGAAGATGGAGAGGGAGGTGGG - Intronic
956377372 3:68629237-68629259 TTGGAGATTCAGAGGATGGGAGG - Intergenic
956697089 3:71927810-71927832 TTGGAGAAGCAAAGTGAAGATGG - Intergenic
956858626 3:73300745-73300767 TTTGAGAGGCTGAGGGAGGGGGG - Intergenic
957227178 3:77464534-77464556 TTAGAGTTACAGGGGGAGGAAGG + Intronic
957272618 3:78051345-78051367 GTGGGGAGGCAGAGGCAGGAGGG - Intergenic
957663255 3:83188486-83188508 GTGGAGATGCACATGGATGAGGG + Intergenic
958513869 3:95086881-95086903 ATGGAGGTGAAGTGGGAGGAAGG - Intergenic
959989647 3:112616761-112616783 ATGGAGAAGCAGAAGAAGGAGGG - Exonic
960076204 3:113488586-113488608 TTGGAGACTCAGAAGGGGGAGGG + Intronic
960168472 3:114431037-114431059 ATGGAGGGGCACAGGGAGGAGGG - Intronic
960356812 3:116663814-116663836 ATAGAAATGCAGAGGGAAGAAGG + Intronic
960446508 3:117756077-117756099 TTTGAGCTGAAGAGGAAGGATGG - Intergenic
960885345 3:122388215-122388237 TTGGAGATACTGAGTAAGGAAGG + Intronic
961168304 3:124778798-124778820 GTAGAGATGGAGTGGGAGGAAGG + Intronic
961345475 3:126260747-126260769 TGGGAGAAGAACAGGGAGGAAGG - Intergenic
961745152 3:129059760-129059782 TTGGCCATGCAGGAGGAGGAAGG + Intergenic
961748027 3:129078330-129078352 TTGGGGAGGCTGAGGAAGGAGGG - Intergenic
961993907 3:131220749-131220771 TTAGATATGCAGAGAGAGGCAGG + Intronic
962273797 3:133997233-133997255 TTGCAGAGGCAGAGGGAGTAGGG - Intronic
962747363 3:138406897-138406919 TTGGAGTTACAGAGGAGGGATGG - Intergenic
963057929 3:141202389-141202411 TAGGACATGCAGGAGGAGGAAGG + Intergenic
963249760 3:143092276-143092298 TGGCAGCTGCAGAGGGAGAAAGG + Intergenic
963490619 3:145995553-145995575 CTGGATATGAAGATGGAGGAAGG - Intergenic
963868107 3:150384853-150384875 TTGGAAGTGCAGAGAGAGAAGGG + Intergenic
964389815 3:156185330-156185352 TTGGAGATGGTGAGGCTGGAAGG - Intronic
965317052 3:167205246-167205268 TGGGAGATGCAGAGGGAGAAGGG + Intergenic
965499460 3:169440539-169440561 TTGGGGATGGGGTGGGAGGAGGG + Intronic
965621344 3:170644950-170644972 GTGAAGCTGTAGAGGGAGGAGGG - Intronic
965624092 3:170669854-170669876 TTGCAGATCCAGAGGCAGCATGG - Intronic
965960421 3:174422723-174422745 TTGGGGCTGAGGAGGGAGGAAGG + Intergenic
966225297 3:177591317-177591339 TTGGAGGAGCAAAGAGAGGAGGG - Intergenic
966646605 3:182252512-182252534 CTGGAGAGGTGGAGGGAGGAAGG + Intergenic
967081026 3:186049597-186049619 CTGGAGACGCAGAGGGGGAAGGG + Intronic
967210199 3:187161764-187161786 TAGGGGAAGCAGAGGTAGGAAGG - Intronic
967228403 3:187314625-187314647 TGGGAGGTGCAGTGGGAAGATGG + Intergenic
968020812 3:195387104-195387126 TTGGCAATGAAGAGGGAGGGAGG + Intronic
968036583 3:195553055-195553077 CTGGAGTCTCAGAGGGAGGATGG - Intergenic
1202739057 3_GL000221v1_random:37955-37977 CTGGGGATGCAGACAGAGGAGGG - Intergenic
968837837 4:2978700-2978722 TTTGAGAGGCTGAGGCAGGAGGG + Intronic
968994149 4:3935213-3935235 TTGGAGAAGCCGGGAGAGGAGGG + Intergenic
969291326 4:6241805-6241827 TTGGAAATGCAGAGGAAGGGAGG + Intergenic
969425972 4:7124035-7124057 TTGGAGATGGGGATGGAGTACGG - Intergenic
969525443 4:7701793-7701815 ATGGAGGGGCAGAGGGAAGACGG + Intronic
969537363 4:7764857-7764879 TTGGAGAGGCTGAGTGAGGTGGG + Intronic
969571386 4:8010741-8010763 ATGGAGAGGCAGAGGGGGCAGGG + Intronic
969651256 4:8469604-8469626 CTGGAGATGGAGAGCGGGGATGG + Intronic
970382932 4:15526101-15526123 TGGGATGTGCAGAGGGAGGTAGG - Intronic
971378836 4:26078128-26078150 TTGGAGAGGCACAGGCAGGCTGG - Intergenic
971424489 4:26502720-26502742 CTGGAAACGCAGAGGGATGAAGG - Intergenic
971447547 4:26767060-26767082 TTTGAGAGGCTGAGGCAGGAGGG + Intergenic
971455061 4:26836415-26836437 TTGGAGGGGCAGAGGGAGGTGGG + Intergenic
971533858 4:27722991-27723013 GTGCACATGCAGAGGGAGAAAGG + Intergenic
971713464 4:30146705-30146727 TTTGAGAAGCTGAGGCAGGAGGG + Intergenic
972446615 4:39150415-39150437 CAGGGGATGGAGAGGGAGGAAGG + Intergenic
972569019 4:40294193-40294215 ATGGAGATGGAGATGGAGGTGGG - Intergenic
972569066 4:40294447-40294469 GTGGAGATGGAGATGGAGGTGGG - Intergenic
972639391 4:40911886-40911908 GTGTAGGGGCAGAGGGAGGAGGG - Intronic
972753284 4:42014915-42014937 TGGGAGGTGGAGAGTGAGGATGG + Intronic
973800700 4:54474933-54474955 TTGGCTATGCTGAGGGTGGATGG + Intergenic
973802507 4:54493200-54493222 TTGGGGAGGCAGAGGCAGGCTGG - Intergenic
974439590 4:61899088-61899110 ATGGAGCTGCAGAGGTAGAAAGG - Intronic
974593844 4:63991133-63991155 CTGGAGATCCAGAGGAGGGAGGG + Intergenic
974841307 4:67302680-67302702 ATGGAGGTGGAGAGAGAGGAAGG + Intergenic
975160944 4:71122744-71122766 AAGGAGATGCCGAGGGGGGATGG - Intergenic
975891368 4:79032631-79032653 ATGGAGAGGCAGAGGTGGGAGGG + Intergenic
975927119 4:79470536-79470558 CTGGAGATGCATGGTGAGGATGG - Intergenic
978035137 4:103983901-103983923 TTGGAGATGGAGAGGGAAGAGGG + Intergenic
978192722 4:105933798-105933820 TGGGAGAAGGAGAGGGAGAAGGG - Intronic
978854667 4:113380828-113380850 ATGGAGATGGTGGGGGAGGAAGG - Intronic
979932068 4:126643210-126643232 ATGGAGGAGCAGAGGGATGAGGG + Intergenic
980848136 4:138348774-138348796 TTAGAGACACAGAAGGAGGAAGG + Intergenic
980868834 4:138586811-138586833 TAGGAGATGAAGAGGAATGAAGG + Intergenic
981361589 4:143852065-143852087 TTGGAGACTCAGAAGGGGGAGGG - Intergenic
981730553 4:147892670-147892692 TTGGAGACTCAGAGGAAGGGGGG + Intronic
982452604 4:155570796-155570818 CTGGAGGTGGGGAGGGAGGATGG + Intergenic
982558280 4:156897125-156897147 TTGGGGATGAAGAGGCAGTAAGG + Intronic
984321770 4:178206677-178206699 TTGGAGACTCAGAAGGGGGAAGG + Intergenic
984388758 4:179100070-179100092 TGGGAGAAGGAAAGGGAGGAAGG + Intergenic
984709996 4:182876798-182876820 TTGTAGATTCAGAGTGAGGTGGG + Intergenic
984736478 4:183113268-183113290 ATGTAGAAACAGAGGGAGGAGGG + Intronic
984822837 4:183898160-183898182 CTGGAGAAGGAGAGGGAGGGCGG - Intronic
984836566 4:184027955-184027977 TGTGAGGTTCAGAGGGAGGAGGG + Intergenic
985344281 4:188986630-188986652 ATGGGCATGCAGAGGGAGGCAGG - Intergenic
1202766857 4_GL000008v2_random:155288-155310 CTGGGGATGCAGACAGAGGAGGG + Intergenic
985487236 5:158510-158532 TGGGATGGGCAGAGGGAGGAGGG - Intronic
985487301 5:158679-158701 CAGGACAGGCAGAGGGAGGAAGG - Intronic
985884313 5:2664796-2664818 TTTGAGATAGAGAGGGAGGAAGG + Intergenic
985976680 5:3424443-3424465 TTTGAGAGGCTGAGGCAGGAGGG + Intergenic
985987374 5:3527386-3527408 TGGCAGATGCAAAGAGAGGAGGG + Intergenic
986693273 5:10331364-10331386 TTGGAGATGGTGAGGGAAGGAGG - Intergenic
986797044 5:11222848-11222870 TTGGAGATGGGGAGGGGGAAAGG - Intronic
986958341 5:13183381-13183403 ATGGAGATTCAGAGGGTGGGAGG - Intergenic
987149095 5:15020849-15020871 AAGGAGAAGCAGAGAGAGGAGGG + Intergenic
988574638 5:32409646-32409668 TTGGAGAGGCCGAGGTAGGTGGG - Intronic
988574813 5:32411444-32411466 TTGGAGAGGCCGAGGTAGGTGGG + Intronic
988588858 5:32531486-32531508 TTTGGGATGCAGAGGTGGGAGGG - Intergenic
988785315 5:34561389-34561411 TCTTAGATCCAGAGGGAGGAAGG - Intergenic
989323539 5:40164860-40164882 CTGGGGTTGAAGAGGGAGGAAGG + Intergenic
990232870 5:53734048-53734070 CTGGAACTGCTGAGGGAGGATGG - Intergenic
990317858 5:54601077-54601099 ATGGACAGACAGAGGGAGGACGG - Intergenic
990517820 5:56546951-56546973 TAGGAGAGGCAAAGGGAAGAGGG - Intronic
990553084 5:56903810-56903832 GTGGAGATGGAGAGGGTGGATGG - Intergenic
991047828 5:62241262-62241284 TTGGAGCTGAGGTGGGAGGATGG - Intergenic
991063706 5:62403983-62404005 TTGGAGTCACAGAGGGAGGAAGG + Intronic
991325173 5:65423154-65423176 CTGGAGATTCAGAAGGGGGAAGG + Intronic
991441842 5:66658912-66658934 CTTGAGAGGCAGAGGCAGGAGGG + Intronic
992254063 5:74904111-74904133 TTGGAGCTGCAGTGGGAACAGGG + Intergenic
992403615 5:76434347-76434369 TTGGAGACTCAGAAAGAGGAGGG - Intronic
992491796 5:77251627-77251649 TTGGAGTTCAAGAGGGAGAAGGG - Intronic
992794122 5:80240270-80240292 GTTGAGAAGCAGTGGGAGGAAGG - Intronic
992866827 5:80965235-80965257 TGGGAGATGGAGAGTGTGGATGG + Intronic
993191235 5:84684576-84684598 TTTGAGGGGTAGAGGGAGGAAGG + Intergenic
993223289 5:85131936-85131958 ATGCAGATGCAGGGGGAAGAAGG - Intergenic
994639563 5:102389984-102390006 TTGGGGAGGCTGAGTGAGGAGGG - Intronic
994956878 5:106544353-106544375 TGGGAGATCCAGAGGGAGGACGG - Intergenic
995448974 5:112279494-112279516 TTGGAGATGGACAGTGATGATGG + Intronic
995469968 5:112490955-112490977 ATAGAGACACAGAGGGAGGAAGG + Intergenic
995571326 5:113485577-113485599 TTGGGGATGAAGAGGGAGACAGG + Intronic
996410954 5:123158353-123158375 TTGGAGATGCAGAGGGAGGAAGG + Intronic
996487428 5:124053354-124053376 TTTGAGAGGCCGAGGCAGGAAGG + Intergenic
996487699 5:124056256-124056278 TTGGGGATGGAGTGGGAGGAAGG + Intergenic
996780538 5:127181930-127181952 TAGGAGATGTGGAGGGTGGAAGG - Intergenic
997513205 5:134466847-134466869 TTGGAGATGGAGACGGGGGTGGG - Intergenic
997569815 5:134917705-134917727 CTGGAGCTGCAGCGGGAGGGAGG + Intronic
997693502 5:135843831-135843853 TTGGAGAGGCCAAGGGAGAATGG + Intronic
997824002 5:137090402-137090424 TGTGATCTGCAGAGGGAGGAAGG - Intronic
998250720 5:140550419-140550441 TTGCAGATACACAGGGAGCAGGG + Exonic
998391087 5:141787357-141787379 TTTGGGAGGCAGAGGCAGGAGGG + Intergenic
998642342 5:144025273-144025295 TTGCACATGCACAGGGATGAGGG + Intergenic
998734474 5:145120067-145120089 TGGGAGAGGGATAGGGAGGATGG + Intergenic
999075712 5:148793405-148793427 TTGGAGATGGGGTGGTAGGAGGG - Intergenic
999131847 5:149289633-149289655 TTGTAAATTCAGAGGAAGGAAGG + Intronic
999575408 5:152971227-152971249 TTGGAAACTCAGAAGGAGGAGGG + Intergenic
999968545 5:156835622-156835644 ATGGAGTTGAAGAGGGAGAATGG - Intergenic
1000079639 5:157832765-157832787 TTGGATATTCAGTGGGAGGAAGG - Intronic
1000138718 5:158380756-158380778 TTGGCTATGCAGAGAAAGGAGGG + Intergenic
1000251188 5:159497331-159497353 AAGGGGAAGCAGAGGGAGGAGGG + Intergenic
1000373997 5:160562475-160562497 ATGGAGATGAAAAGAGAGGAAGG - Intergenic
1001214917 5:169846855-169846877 TTGGAGACTCAGAAGGGGGAGGG - Intronic
1001244829 5:170098251-170098273 TGGGGGGTGCAGAGGGTGGATGG + Intergenic
1001421322 5:171589428-171589450 TGTGAGAAGCAGAGGTAGGAGGG + Intergenic
1001483491 5:172104148-172104170 TTAGAGGTGCAGTGGCAGGAAGG - Intronic
1001895345 5:175374601-175374623 TTGGAGACTCAGAAGGAGGGAGG - Intergenic
1001972474 5:175967781-175967803 GTGGAGATGAGGAGGGAGTAGGG - Intronic
1002244965 5:177875999-177876021 GTGGAGATGAGGAGGGAGTAGGG + Intergenic
1002382669 5:178841380-178841402 TTGGAGAAGGAGAGGAAGAAGGG - Intergenic
1002430727 5:179202424-179202446 TAGGAGATGGAGAAGGAAGAAGG - Intronic
1002949782 6:1798609-1798631 TTGGAGATTCAGCGGGTGGCTGG - Intronic
1003460232 6:6321864-6321886 TTGGAGATGCAGAGGGAGGAGGG - Intergenic
1003497347 6:6675901-6675923 CTGGAAAGGCTGAGGGAGGAGGG + Intergenic
1003550934 6:7101461-7101483 CTGGAGCAGCAGAGGGAGGAGGG - Intergenic
1003598254 6:7494237-7494259 TTGCAGGTGCAGTGGGAGGTTGG - Intergenic
1003604411 6:7545989-7546011 TTGGATAGGCAGAGGGAAGCTGG + Intronic
1003751928 6:9068640-9068662 TGTGAGATGCAGGGGGATGATGG - Intergenic
1003845629 6:10171315-10171337 TTGGAAATGCAGAGAGAACAAGG + Intronic
1003890069 6:10556143-10556165 ACGGGGAGGCAGAGGGAGGAGGG + Intronic
1004144742 6:13054874-13054896 TTGAGGATGTAGAGGGAAGAAGG - Intronic
1004491885 6:16125508-16125530 TTTGGGAGGCAGAGGCAGGAGGG + Intergenic
1004632627 6:17436561-17436583 TTGGAGAGGAAGAGAGAGGGAGG + Intronic
1005211306 6:23467444-23467466 TTGAGGATGTAAAGGGAGGATGG + Intergenic
1005514408 6:26540169-26540191 TGGGAGATGCAGGGGTAGAAAGG - Intronic
1006018741 6:31104051-31104073 TTGGGGAAGCTGAGGCAGGAGGG - Intergenic
1006023464 6:31132001-31132023 TTTGAGAGGCGGAGGCAGGAGGG + Intronic
1006378967 6:33686982-33687004 GTGGAGGGGCAGAGGGAGGCAGG - Intronic
1006400046 6:33812542-33812564 TGGGAGATGCTGAGGGCAGAGGG - Intergenic
1006485269 6:34334696-34334718 TTTGGGAAGCTGAGGGAGGAGGG + Intronic
1006808331 6:36803349-36803371 TTAGAGATGCAGGAGGATGATGG - Intronic
1006936024 6:37718814-37718836 TTTGGGAAGCCGAGGGAGGAAGG + Intergenic
1006951085 6:37821059-37821081 TTGGAGACATAGAGGCAGGAAGG + Intronic
1007103931 6:39270415-39270437 TTGAATATTCAGAGGGAGAAAGG + Intergenic
1007474502 6:42109843-42109865 TGGAAGATACAGAGGTAGGAGGG + Intronic
1007707560 6:43799999-43800021 ATGGAGATGGTGAGAGAGGAAGG + Intergenic
1008246455 6:49179992-49180014 TTCTAAATGCATAGGGAGGAAGG - Intergenic
1008287326 6:49669968-49669990 TTAGAGAACTAGAGGGAGGAAGG - Intergenic
1008556304 6:52675999-52676021 TTGGAGGTGGACAGGGAGGGAGG + Intronic
1010073603 6:71773390-71773412 TTGGAGAAGCAGAAGGGGAAAGG - Intergenic
1010452037 6:76014331-76014353 TTTGAAACTCAGAGGGAGGAAGG + Intronic
1010828905 6:80507349-80507371 TTGTTGATGCCTAGGGAGGAAGG + Intergenic
1011140627 6:84151681-84151703 TTGGGGATGGAGAAGGAAGAAGG + Intronic
1011364234 6:86563189-86563211 TTGGAGATTCAGAGGGGGTCAGG - Intergenic
1011771285 6:90676225-90676247 TTGGGGAGGGAGAAGGAGGATGG + Intergenic
1012375749 6:98559857-98559879 TTAGAAAGGAAGAGGGAGGAAGG - Intergenic
1012398502 6:98825573-98825595 TTGCTGATGGAGAGGGAGCAGGG - Intergenic
1013394638 6:109722929-109722951 TGGGAGCTGGAGAGAGAGGAAGG + Intronic
1013496156 6:110699563-110699585 TTGGAGATTCAGAAGAAGGGAGG + Intronic
1013504738 6:110788268-110788290 TTTGAGAAGCTGAGGCAGGAGGG - Intronic
1013632888 6:112002064-112002086 TTGGAGAGGCAGACCGAGAATGG + Intergenic
1014088969 6:117381394-117381416 TTGGAGACTCAGAAGGAGGGAGG - Intronic
1014090898 6:117402451-117402473 TTGGAAATGAAGAGTGAAGAGGG - Intronic
1014092627 6:117421414-117421436 TTGGAGACTCAGAAGGGGGAGGG - Intronic
1014240415 6:119012015-119012037 TTAGACATGCATAGGGAGTACGG + Intronic
1014792260 6:125686758-125686780 TTGGGGATTCAGGGGGAAGAGGG - Intergenic
1015102670 6:129499923-129499945 TTGGAGAGACAGAGGGGGGCAGG + Intronic
1015261370 6:131241280-131241302 ATGGAGAAGGAGAAGGAGGAGGG + Intronic
1015494860 6:133869962-133869984 TTTGGGATGCTGAGGCAGGAGGG + Intergenic
1015600158 6:134903839-134903861 TGGGTGAGACAGAGGGAGGAGGG + Intergenic
1015636266 6:135277801-135277823 TTGGAGACTCAGAAGGGGGAAGG + Intergenic
1016193650 6:141303536-141303558 TTTGAGAGGCTGAGGTAGGAAGG - Intergenic
1016306669 6:142692186-142692208 TTGAGGTGGCAGAGGGAGGAAGG - Intergenic
1017148389 6:151255553-151255575 TTTGAGAAGCCGAGGCAGGAGGG + Intronic
1017193424 6:151676930-151676952 TTGGAGATGGAGACAGAGTATGG + Intronic
1017272315 6:152522213-152522235 TTGGAGACTCAGAAGGATGAGGG - Intronic
1017587342 6:155941571-155941593 GTGGAGATGGAGAGGAATGAAGG - Intergenic
1018303264 6:162426553-162426575 TTGGGGATGAGGTGGGAGGATGG - Intronic
1018317458 6:162570809-162570831 TTGGGAAGGTAGAGGGAGGATGG + Intronic
1018342057 6:162861635-162861657 GTGGTGAGGCAGAGGGAGGTGGG - Intronic
1019057022 6:169231362-169231384 TGGGAGAAGCAGAGGGAGCACGG + Intronic
1019171656 6:170136420-170136442 TTAGAGAAGCAAAGGGTGGACGG - Intergenic
1019385198 7:751390-751412 TTTGAGAGGCCGAGGCAGGAGGG + Intronic
1019398035 7:834027-834049 TGGGAAATGCAGAGGGAAGGTGG + Intronic
1019407973 7:893824-893846 TTGGGGCTGGGGAGGGAGGAGGG + Intronic
1019454048 7:1115448-1115470 TTGGTGATGAGGAGGGTGGATGG - Intronic
1020011341 7:4807506-4807528 GGGGAGACGGAGAGGGAGGAGGG - Intronic
1020011402 7:4807704-4807726 GGGGAGAAGGAGAGGGAGGAGGG - Intronic
1020409959 7:7881127-7881149 TTGGAAATGCAGTTGAAGGATGG + Intronic
1020512338 7:9073411-9073433 TTGGAGAAGCTGAGGCAGGAGGG - Intergenic
1021058263 7:16077381-16077403 TTTGAGAGGCAAAGGTAGGAGGG + Intergenic
1021280259 7:18708282-18708304 ATGGAGAAAAAGAGGGAGGAAGG + Intronic
1021626778 7:22601399-22601421 TGGAAGATGGGGAGGGAGGATGG + Intronic
1021707746 7:23384646-23384668 TTGGGGAGGCAGAGGCAGGCAGG + Intronic
1022140735 7:27491423-27491445 TTGGAGAAGGAGAGGAAGGAGGG + Intergenic
1022243602 7:28535612-28535634 TAGGAGAGAAAGAGGGAGGAAGG + Intronic
1023032214 7:36100029-36100051 TTAGAGTTCCAGAGGGAGAAGGG + Intergenic
1024217119 7:47256928-47256950 ATGGAGACGGTGAGGGAGGAGGG + Intergenic
1025009334 7:55383263-55383285 TTACAGAGGCAGAGGGAGGGAGG + Intronic
1025212220 7:57026270-57026292 GGTGAGCTGCAGAGGGAGGATGG + Intergenic
1025227465 7:57177795-57177817 TTAGTGACGCAGAGGCAGGAGGG + Intergenic
1025659734 7:63550558-63550580 GGTGAGCTGCAGAGGGAGGATGG - Intergenic
1025724638 7:64045577-64045599 TGGGAGATCCATAGGGAAGAAGG + Intronic
1025753656 7:64314106-64314128 TGGGAGATCCATAGGGAGGACGG + Exonic
1026077309 7:67184059-67184081 TTTGAGAGGCCGAGGTAGGAAGG - Intronic
1026095046 7:67340292-67340314 TTGGACATGCAGTGAGAGGGAGG + Intergenic
1026098662 7:67367009-67367031 TTAGAGATGCAGAAGGTAGAAGG + Intergenic
1026109201 7:67445424-67445446 TTTGGGAGGCTGAGGGAGGAGGG + Intergenic
1026232863 7:68500400-68500422 TTTGAGAGGCTGAGGCAGGAGGG + Intergenic
1026602597 7:71789043-71789065 TTTGGGAGGCAGAGGCAGGAGGG - Intronic
1026837259 7:73647375-73647397 AGGGAGAGCCAGAGGGAGGAAGG + Intergenic
1026989454 7:74575369-74575391 ATGGAGATGGACAGGGAAGATGG + Intronic
1027052447 7:75028732-75028754 CTGGAGATGCCCATGGAGGAAGG - Intronic
1027528723 7:79303145-79303167 TTGGAGACTCAGAGGGTGGAAGG + Intronic
1027748310 7:82107427-82107449 AGGGAGAAGCAGAGAGAGGAAGG - Intronic
1028048120 7:86149485-86149507 TTACAGATCCAGAGGGAAGAGGG - Intergenic
1028396104 7:90369994-90370016 TTGGAGACTCAGAGGGAGGAAGG + Intronic
1028421946 7:90642957-90642979 CTGGAGATGCAAAGTGAGAAAGG + Intronic
1028532110 7:91849473-91849495 TTAGAGATGTTGAGGGAGGGAGG - Intronic
1028844419 7:95463273-95463295 TTTGGGAAGCAGAGGCAGGAGGG - Intergenic
1029218416 7:98969272-98969294 ATGGGGATGCAGAGAGAGGCAGG - Intronic
1029421557 7:100474518-100474540 GGGGAGGTGGAGAGGGAGGAAGG - Intronic
1029519244 7:101049671-101049693 TTGGATATGCAGAGACAGCAGGG - Intronic
1029675399 7:102065036-102065058 GGTGAGCTGCAGAGGGAGGATGG + Intronic
1029928469 7:104344418-104344440 TTGGAGATTCAGAAGGGGAAGGG - Intronic
1030301057 7:107975487-107975509 TGTGAGATTTAGAGGGAGGAAGG - Intronic
1031610642 7:123822714-123822736 TTTGAGAAGCTGAGGGATGAAGG + Intergenic
1031630166 7:124034298-124034320 AAGGAGATAAAGAGGGAGGAAGG - Intergenic
1031714870 7:125096541-125096563 CTGGAGATTCAGAAGGAGGAGGG - Intergenic
1031886107 7:127247585-127247607 TTGGTGGGGCAGAGTGAGGATGG + Intronic
1032327976 7:130950203-130950225 TGGGAGAGGCTGAGGAAGGATGG + Intergenic
1032863780 7:135905729-135905751 TTGGAGATGCAGATGGGGATTGG + Intergenic
1033345123 7:140520433-140520455 GTGGAGGTGTGGAGGGAGGATGG + Intronic
1033439655 7:141367147-141367169 GTGGACCAGCAGAGGGAGGAAGG + Intronic
1033754925 7:144390447-144390469 CTGGATAAGCAGAGGAAGGAAGG - Intergenic
1034273206 7:149813130-149813152 GTGGAGGTGCTGAGGGAGGTGGG + Intergenic
1034488975 7:151382798-151382820 TGGGAGATGGAAAGGGAGGGAGG + Intronic
1034554944 7:151844424-151844446 TTGGCGAGGCAGAGGTGGGAAGG + Intronic
1034696077 7:153055053-153055075 TTGGATATGGTGAAGGAGGAGGG + Intergenic
1034749008 7:153551228-153551250 TTGAAAATGCAGAAGGAGCAGGG - Intergenic
1035277222 7:157754800-157754822 CTGGAGCTGCAGAGAAAGGAAGG + Intronic
1035500350 8:87340-87362 AGGGAGATGGAGAGGGAGAAAGG - Intergenic
1035695321 8:1591531-1591553 GTGGAGGTGGAGTGGGAGGAGGG - Intronic
1037026155 8:14040619-14040641 GAGGAGAAGCAGAGGGAGCAGGG + Intergenic
1037172849 8:15914124-15914146 CTGGAAGTGAAGAGGGAGGAGGG + Intergenic
1037329570 8:17730878-17730900 CTGGAGATGGATATGGAGGATGG + Intronic
1038163229 8:25060482-25060504 TTTGAGAGGCTGAGGCAGGACGG - Intergenic
1038284697 8:26196501-26196523 CTGGAGATGGGGCGGGAGGAGGG - Intergenic
1038319636 8:26514693-26514715 TTGGGGGTGGAGACGGAGGACGG + Intronic
1038324819 8:26564927-26564949 TTGGAGACTCAGAAGAAGGAGGG - Intronic
1038687902 8:29735301-29735323 TTGGGGAGGGAGAGGGAGGGAGG - Intergenic
1038976345 8:32700930-32700952 TTGAAGACCCAGAGGCAGGAGGG - Intronic
1039174864 8:34792420-34792442 TTGGAGAAGCAGAGATAGCATGG - Intergenic
1039220084 8:35320718-35320740 CTGGACATCCAAAGGGAGGAGGG + Intronic
1039311883 8:36325224-36325246 TTGGATACACAGAGGCAGGATGG - Intergenic
1039507720 8:38064065-38064087 TGGGTGAGGTAGAGGGAGGAGGG + Intergenic
1039821779 8:41141398-41141420 TTTGAGAGGCTGAGGCAGGAGGG - Intergenic
1040087320 8:43358137-43358159 TTGGAGACTCAGAAGAAGGAAGG - Intergenic
1040388569 8:46931339-46931361 TTGCAGCTGCAGAGGCAGGCAGG - Intergenic
1040393889 8:46976123-46976145 ATGGAGACGCAGCGGGTGGAAGG + Intergenic
1041313514 8:56539478-56539500 TGGCAGTTGCAGAGGGAGGGAGG + Intergenic
1041628146 8:60054949-60054971 TTGGAGATGAAGGGAGGGGAGGG + Intergenic
1042358477 8:67855316-67855338 TGGGAGATGCAGTAGAAGGATGG + Intergenic
1042400379 8:68338464-68338486 CTGAAGATGCAGAAGGAGTAAGG - Intronic
1042784496 8:72533329-72533351 TTGGAGACTCAGAAGGGGGAAGG - Intergenic
1043510202 8:80943615-80943637 TTGGACATGAAGAGGGAGCAAGG - Intergenic
1044768509 8:95603853-95603875 TTAGGGATGGGGAGGGAGGAAGG - Intergenic
1044980036 8:97707508-97707530 TTTGAGAGGCTGAGGCAGGAGGG - Intronic
1045054901 8:98360381-98360403 ATGGAGACACAGAGGGAAGAAGG - Intergenic
1045065223 8:98438063-98438085 TTGGAGGCTCAGAAGGAGGATGG + Intronic
1045237036 8:100361261-100361283 GTGGTGATGGAGAGGGAGGCAGG + Intronic
1045564711 8:103301647-103301669 TTTGGGATGCTGAGGCAGGACGG - Intronic
1046155030 8:110277276-110277298 TTGGAGAGGCAGAGGTAAAATGG + Intergenic
1046439527 8:114239997-114240019 TTTGAGAAGCTGAGGCAGGAAGG + Intergenic
1046527903 8:115404861-115404883 TTGGAGCTGAAGAGGGAGTTGGG - Intergenic
1046534096 8:115486325-115486347 TTGGAGAGGGAGAGAGATGAGGG - Intronic
1046975836 8:120276345-120276367 TTGGAGACTCAGAGTGGGGAGGG + Intronic
1047106078 8:121731900-121731922 TTGGAGACTCAGAAGGAAGAGGG - Intergenic
1047197772 8:122736938-122736960 TTGGAGAGGCAGAGAGAGTAAGG + Intergenic
1047631015 8:126708583-126708605 TTGGGGATTGAGAGGGAAGATGG - Intergenic
1047746998 8:127852748-127852770 GTGTGGATGGAGAGGGAGGAGGG - Intergenic
1048072903 8:131040367-131040389 TTGGGGAGGCAGCCGGAGGAGGG + Exonic
1048082419 8:131143045-131143067 TTGTAGATGCAGAGAAGGGAAGG - Intergenic
1048291485 8:133184865-133184887 TTGGAAAAGCAGAGGGGGGTGGG - Intergenic
1048477094 8:134753262-134753284 TTGGGGGGGCAGAGGGAGGGTGG + Intergenic
1048643163 8:136387345-136387367 AAGGAGAAGCAGAGGGAGTATGG - Intergenic
1048787603 8:138066961-138066983 TTGGAGAAGCAGAAGCAGAAGGG + Intergenic
1048962371 8:139591169-139591191 TTGCAGATGCAGAGGTACAAAGG + Intergenic
1049343226 8:142124861-142124883 TGGGAGCTTCAGAGGGAGCAAGG + Intergenic
1049350631 8:142162638-142162660 AGGGAGATGGAGATGGAGGATGG + Intergenic
1049351653 8:142167847-142167869 GGGCAGGTGCAGAGGGAGGAAGG - Intergenic
1049437783 8:142595654-142595676 TTGGGGATGCACAGGGCTGAGGG - Intergenic
1049442893 8:142617267-142617289 TTGGGGATGCAGGTGGGGGAAGG + Intergenic
1049475258 8:142794313-142794335 AGGGAGAGGCAGAGGGAGGGTGG - Intergenic
1049512195 8:143034082-143034104 TTTGGGAGGCAGAGGTAGGAGGG + Intergenic
1049516151 8:143057957-143057979 AGAGAGATGCAGAGGGAGGGAGG - Intronic
1049554467 8:143275171-143275193 TAGGGGATGCAGGAGGAGGAGGG - Intronic
1050399411 9:5235356-5235378 TTGAAGATGAAGAGGGATCATGG + Intergenic
1050500619 9:6294298-6294320 TTGGAGATTCAGAAAGAGGAAGG - Intergenic
1050677162 9:8069318-8069340 TTTGAGAGGCTGAGGCAGGAGGG - Intergenic
1050683857 9:8145347-8145369 GTGGAGATGCAGAGAGAAGAGGG + Intergenic
1050857901 9:10385019-10385041 TGAGAGATACAGATGGAGGAAGG - Intronic
1052768674 9:32667751-32667773 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
1052947260 9:34178567-34178589 TTTGAGAGGCCGAGGCAGGAGGG - Intergenic
1052955442 9:34250201-34250223 TTGGAGAGGCAGAGAAAGGAGGG - Intronic
1053107380 9:35422982-35423004 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
1053196963 9:36127005-36127027 TTGTAGAGGCAGGGAGAGGAAGG - Intergenic
1053474458 9:38372066-38372088 TTTGAGACGCAGAGTGATGAAGG - Intergenic
1053499071 9:38569829-38569851 CTGGGGATGCAGACAGAGGAGGG + Intronic
1053532198 9:38893854-38893876 TTGGAGACTCAGAAGCAGGAAGG + Intergenic
1053662144 9:40291471-40291493 CTGGGGATGCAGAGAGAGGAGGG - Intronic
1053672999 9:40388733-40388755 TTGGAGACTCAGAGCGGGGAGGG - Intergenic
1053912590 9:42921639-42921661 CTGGGGATGCAGAGAGAGGAGGG - Intergenic
1053922809 9:43015102-43015124 TTGGAGACTCAGAGCGGGGAGGG - Intergenic
1054204421 9:62118263-62118285 TTGGAGACTCAGAAGCAGGAAGG + Intergenic
1054374270 9:64437712-64437734 CTGGGGATGCAGAGAGAGGAGGG - Intergenic
1054384108 9:64528799-64528821 TTGGAGACTCAGAGCGGGGAGGG - Intergenic
1054511626 9:65987550-65987572 TTGGAGACTCAGAGCGGGGAGGG + Intergenic
1054522466 9:66084813-66084835 CTGGGGATGCAGAGAGAGGAGGG + Intergenic
1054633940 9:67470101-67470123 TTGGAGACTCAGAAGCAGGAAGG - Intergenic
1055016955 9:71629056-71629078 TTGAAGATGGAGATGCAGGAAGG - Intergenic
1055019878 9:71658455-71658477 TTTGGGAGGCAGAGGAAGGAGGG - Intergenic
1055053379 9:72001290-72001312 AAGGGGATGCAGAAGGAGGATGG + Intergenic
1055297821 9:74852446-74852468 AGGGAGAGGGAGAGGGAGGAGGG - Intronic
1055518138 9:77053765-77053787 ATGGAGATGGAGAGGGAGTAGGG - Intergenic
1055672070 9:78617824-78617846 TGGGAGATTCAGAGGGTGGAAGG + Intergenic
1055892110 9:81134541-81134563 TTGGGGAAGCTGAGGGAGGAGGG - Intergenic
1055945083 9:81686845-81686867 TTGGTGATGGTGAGGGAGGTGGG - Intronic
1056545054 9:87606478-87606500 AGGGAGAGACAGAGGGAGGAAGG - Intronic
1056586644 9:87931785-87931807 CTGGGGATGCAGACAGAGGAGGG + Intergenic
1056610233 9:88121156-88121178 CTGGGGATGCAGACAGAGGAGGG - Intergenic
1056735022 9:89201994-89202016 TTGGGGTTGGAGAGGGTGGATGG - Intergenic
1057162119 9:92896171-92896193 CTGGGGATGCAGACAGAGGAGGG + Intergenic
1057637744 9:96786606-96786628 TTGGAGATGTAGAGGGCTGAAGG - Intergenic
1057678507 9:97154310-97154332 CTGGGGATGCAGACAGAGGAGGG + Intergenic
1057714470 9:97480048-97480070 TTAGAGCTCCTGAGGGAGGAAGG + Intronic
1057743612 9:97733972-97733994 TGGCAGAGGCAGAGGGAGGAGGG + Intergenic
1057995284 9:99817333-99817355 GTGGAGAAGAAGAGGAAGGAGGG + Intergenic
1058297443 9:103326890-103326912 CAGGAGAAGCAGAGGGAGCAGGG - Intergenic
1058472939 9:105299719-105299741 TAGGACAGGCAGAAGGAGGAAGG - Intronic
1058711524 9:107683468-107683490 AAGGGGATGCAGAGGGAGAAGGG - Intergenic
1058766416 9:108186826-108186848 GTGGAGATGCAGCTGGAGGCAGG - Intergenic
1059002518 9:110364978-110365000 TTGGGGAGGCTGAGGCAGGAGGG - Intergenic
1059016227 9:110518974-110518996 TTGCAGCTGCAGAGGTGGGAAGG - Intronic
1059714919 9:116904937-116904959 TTGGGGGTGCGGAGGGTGGAAGG - Intronic
1059752663 9:117262876-117262898 TTGGCTTTGCAGATGGAGGAAGG + Intronic
1060404091 9:123364556-123364578 GTGGGGATGGGGAGGGAGGAGGG + Intronic
1060406656 9:123376219-123376241 CTGGAGGTACAGAGGGAGGCTGG + Intronic
1060976856 9:127770179-127770201 ATGGGGATGAAGAGGAAGGAGGG - Intronic
1061098437 9:128473566-128473588 TTACAGATGCAGGGGGAGAAGGG - Intronic
1061275567 9:129568098-129568120 TTGGAGAGGAAGAGTGGGGAGGG - Intergenic
1061327199 9:129871105-129871127 CTGGAGATGAATGGGGAGGATGG - Intronic
1061488542 9:130932992-130933014 TGGGAGTTGCAGAGGGGAGACGG - Intronic
1061595005 9:131623219-131623241 TTTGGGAGGCTGAGGGAGGAGGG + Intronic
1062131589 9:134897185-134897207 CTGGAGATGGAGTGGGAGGCAGG - Intergenic
1062137586 9:134937973-134937995 TTGGAGAGGCAGAGGGGGAAAGG - Intergenic
1062218270 9:135400682-135400704 TTGTGGATGCAAAGGGAGGCCGG + Intergenic
1062668593 9:137693170-137693192 TTGGAGACGCACAGTGAGGCCGG + Intronic
1185998961 X:4987314-4987336 TTGGAGACTCAGAAGCAGGAAGG + Intergenic
1186368345 X:8919397-8919419 TTGAAGATGCAGTGAGAGAATGG - Intergenic
1186479020 X:9881716-9881738 TCGGGGAGGCAGAGGGAGGAAGG - Intronic
1186698622 X:12065526-12065548 ATGGAAGTGGAGAGGGAGGAAGG - Intergenic
1186927547 X:14351889-14351911 GTGGAAATGCAGAAGCAGGAGGG + Intergenic
1187424960 X:19168985-19169007 TTTGAGAGTCAGAGGGAAGAGGG - Intergenic
1188009536 X:25041592-25041614 ATGGAGACACAGAGAGAGGATGG - Intergenic
1188158113 X:26767124-26767146 TTGGAGATGCAGAAGCATGGGGG + Intergenic
1189230795 X:39451036-39451058 AAGGGGAAGCAGAGGGAGGAAGG - Intergenic
1189233975 X:39473736-39473758 TTGGAGATGGAAAAGGGGGAGGG + Intergenic
1189364992 X:40381193-40381215 TGGGAGAGGTGGAGGGAGGAGGG - Intergenic
1189837332 X:45039210-45039232 ATGGGGAGGCAGAGGGGGGATGG - Intronic
1190088226 X:47414821-47414843 TTGGGGCTGGAGAGGGAAGAAGG + Intergenic
1190773777 X:53536500-53536522 TTGGGGTTGCAGTGGGAAGATGG + Exonic
1192082287 X:68060072-68060094 TGGGTAATGAAGAGGGAGGAGGG - Intronic
1192568414 X:72182297-72182319 TTTGGGAGGCCGAGGGAGGATGG + Intronic
1192618739 X:72655163-72655185 TTTGAGAGGCTGAGGCAGGAGGG + Intronic
1193405491 X:81096014-81096036 TTGGAGATGCAGAAGGGGTAAGG + Intergenic
1193470943 X:81902571-81902593 TTGGAGACTCAGAAGGGGGAGGG - Intergenic
1193593863 X:83422202-83422224 TTGGAGAAGGAGAGAGAGAAGGG - Intergenic
1193617174 X:83703485-83703507 TTGGAGACTCAGAAGTAGGAGGG - Intergenic
1194145648 X:90258690-90258712 TTGGAGATTCAGGAGGGGGAAGG + Intergenic
1194182617 X:90732794-90732816 ATAGACATGCAGAGGGAGAATGG - Intergenic
1195800184 X:108700137-108700159 TTGGAGCTGCCTAGGGATGAAGG - Intergenic
1195902931 X:109817518-109817540 TTGGAGGTGCAGAGGGGACAAGG + Intergenic
1196008113 X:110856809-110856831 TGGGAGATGTAAAGGGAAGAAGG - Intergenic
1196276485 X:113771774-113771796 TTGGGGATACAGAGGTAGTATGG - Intergenic
1196302914 X:114066946-114066968 CTGGCGTTGAAGAGGGAGGAAGG + Intergenic
1196557934 X:117112704-117112726 TTGGAGACTCAGAAGCAGGAGGG + Intergenic
1196752821 X:119132876-119132898 TTTGGGAGGCAGAGGCAGGAGGG - Intronic
1197048661 X:122031291-122031313 TTAGAGACCCAGAAGGAGGAGGG - Intergenic
1197264055 X:124347269-124347291 GTCGAGATGCTGAGAGAGGAGGG + Intronic
1197571314 X:128154156-128154178 TTGGAGACTCAGAAGTAGGAGGG + Intergenic
1197618410 X:128719967-128719989 ATGGAGACTCAGAAGGAGGATGG - Intergenic
1197824677 X:130576071-130576093 GTGTAGATGCAGCGGGAAGAAGG - Intergenic
1197951714 X:131904711-131904733 TTGACGAGGCAGATGGAGGATGG - Intergenic
1198038327 X:132823431-132823453 TTAGAGACTCAGAAGGAGGAGGG - Intronic
1198105031 X:133453961-133453983 TTGGAGATGCAGAAGAGGGTAGG - Intergenic
1198166788 X:134065428-134065450 TTGGAGAGGCAGTGTGGGGAGGG - Intergenic
1198801548 X:140452773-140452795 TTGGAGATACAGAAGGAGCAGGG + Intergenic
1198952455 X:142087131-142087153 TTGGCGTTGAAGATGGAGGAGGG - Intergenic
1199010842 X:142756738-142756760 TTGGAGACACAGAGAGGGGAGGG - Intergenic
1199110821 X:143931843-143931865 TTGGAGATTCAGAAGGGGAAGGG - Intergenic
1199193840 X:145003745-145003767 CTGAAGATGGAGAAGGAGGAGGG + Intergenic
1199316528 X:146385254-146385276 ATGAAGATGGAGAGAGAGGAAGG + Intergenic
1199480326 X:148291454-148291476 TTGGAGAGGCAGGTGTAGGAAGG - Intergenic
1199600629 X:149539565-149539587 CTGGAGATGCAGGGTGAGCAGGG - Intergenic
1200414885 Y:2899354-2899376 TTTGAGAGGCTGAGGTAGGAGGG + Intronic
1200491400 Y:3827990-3828012 TTGGAGATTCAGAAGGGGGAAGG + Intergenic
1200529242 Y:4314747-4314769 ATAGACATGCAGAGGGAGAATGG - Intergenic
1201225074 Y:11810788-11810810 TTGTATCTGCAGATGGAGGAAGG - Intergenic
1201349669 Y:13025849-13025871 CTGGAGTTCCAGAGGAAGGAAGG - Intergenic
1201726122 Y:17153946-17153968 ATGGAGATGCAGAGAGTAGATGG + Intergenic
1201900461 Y:19042783-19042805 TTACAGAGACAGAGGGAGGAGGG - Intergenic
1201972427 Y:19812208-19812230 TTGGAGTTGCAGTAGGAGAAGGG + Intergenic
1202275733 Y:23117733-23117755 TTGCAGTTGCAGAGGGATGGGGG + Intergenic
1202290295 Y:23302958-23302980 TTGCAGTTGCAGAGGGATGGGGG - Intergenic
1202428725 Y:24751452-24751474 TTGCAGTTGCAGAGGGATGGGGG + Intergenic
1202442066 Y:24918637-24918659 TTGCAGTTGCAGAGGGATGGGGG - Intergenic