ID: 996411096

View in Genome Browser
Species Human (GRCh38)
Location 5:123160105-123160127
Sequence CATGCAAATGACTATGTAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 116}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996411096_996411098 -3 Left 996411096 5:123160105-123160127 CCTCCTACATAGTCATTTGCATG 0: 1
1: 0
2: 1
3: 9
4: 116
Right 996411098 5:123160125-123160147 ATGAGAAATAATATTTAAAATGG No data
996411096_996411099 14 Left 996411096 5:123160105-123160127 CCTCCTACATAGTCATTTGCATG 0: 1
1: 0
2: 1
3: 9
4: 116
Right 996411099 5:123160142-123160164 AAATGGTAGATATGTGACTGAGG 0: 1
1: 0
2: 2
3: 24
4: 224

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996411096 Original CRISPR CATGCAAATGACTATGTAGG AGG (reversed) Intronic
906377512 1:45307577-45307599 CATGCAAAGAAAAATGTAGGCGG - Intergenic
908243296 1:62206312-62206334 CATTCAAATCACTATGTAAAGGG + Intronic
909896155 1:81071857-81071879 GATGCAAATAATTGTGTAGGTGG - Intergenic
911507631 1:98773277-98773299 CAAGCAAATTAATATCTAGGAGG - Intergenic
916742277 1:167656674-167656696 AATGTAAATGACTATGTGGAAGG - Intronic
918929202 1:190832468-190832490 CATGCACATGACTATCAAGATGG + Intergenic
919523585 1:198619930-198619952 GATGCAAATGACCACGGAGGAGG + Intergenic
921912531 1:220565646-220565668 CAGGCTAAAGACTCTGTAGGAGG + Intronic
1066572661 10:36790317-36790339 AATGTAAATGTTTATGTAGGAGG + Intergenic
1067144444 10:43684022-43684044 CAAGCAAATGACTCAGTAGCAGG + Intergenic
1068852209 10:61756595-61756617 CATTCAAAGTACTATTTAGGGGG + Intronic
1073739967 10:106395211-106395233 CATGCAAATGACTAGATCTGTGG + Intergenic
1074931432 10:118130393-118130415 CATGCACATGTGTATGTAAGCGG - Intergenic
1083108242 11:60379384-60379406 CATGTTCATGACTATTTAGGTGG - Intronic
1088060122 11:105637851-105637873 GGTGCAAATGACCATGAAGGAGG + Intronic
1091694745 12:2620708-2620730 CATGCAGATGAGTGTGTAGTAGG - Intronic
1092829623 12:12431209-12431231 CATGAAAAATACTTTGTAGGTGG - Intronic
1093486728 12:19661004-19661026 CATGGAAATGACTATTATGGAGG + Intronic
1106798027 13:33227669-33227691 CTTGGACATGACTATGGAGGGGG + Intronic
1107094543 13:36520846-36520868 CATAGCAATCACTATGTAGGTGG + Intergenic
1110342022 13:74402877-74402899 TATGCAAATTTCTATATAGGCGG + Intergenic
1111268322 13:85849452-85849474 CATGGGAAGGACTGTGTAGGAGG - Intergenic
1112030842 13:95454805-95454827 AATGCAAATGAATATTTTGGGGG + Intronic
1112976461 13:105325236-105325258 CATACATATGACCATGTTGGTGG - Intergenic
1114293879 14:21311949-21311971 CTTGCAGATGACTCTGAAGGAGG + Exonic
1120436730 14:84491988-84492010 CATGGAAATTACTTTCTAGGAGG - Intergenic
1121997224 14:98612620-98612642 CATGGTAATCACTAGGTAGGAGG + Intergenic
1125381070 15:39087273-39087295 CATGCACGTGCCTATGTTGGTGG + Intergenic
1125418684 15:39480098-39480120 CATGCAATTGACTACGTAATAGG - Intergenic
1127642962 15:60932682-60932704 CCTGCAAATGACTCAGTAGGTGG + Intronic
1127890240 15:63243927-63243949 CATGCAGAAGAAAATGTAGGAGG + Intronic
1130578414 15:85114005-85114027 CATGCCAATGACCTTGTTGGGGG + Exonic
1131967365 15:97858683-97858705 CATCAAAATGACTTTGAAGGGGG - Intergenic
1132066295 15:98733590-98733612 CACTCAAATGACTATGCTGGGGG - Intronic
1133695494 16:8258733-8258755 AATGCAAATGAGTTTGGAGGGGG - Intergenic
1135887641 16:26326054-26326076 GATGCAAATGTCTATGTTGGTGG - Intergenic
1137536343 16:49329709-49329731 CATGGTAAGGACTATGTATGGGG - Intergenic
1139153136 16:64408696-64408718 GCTGCAAATGACTATGTAGGTGG - Intergenic
1145012102 17:19374634-19374656 CATCTAAATGTCTATCTAGGGGG + Intronic
1147007253 17:37413476-37413498 CATGCAAATGACAAAGCAGATGG - Intronic
1150923370 17:69506487-69506509 CATGCAGATGCCTTGGTAGGTGG - Intronic
1151011544 17:70503816-70503838 CATGCAAAGTACTAAGAAGGGGG - Intergenic
1157029229 18:43884785-43884807 CTTGAAGATGACTATGTAGCTGG + Intergenic
1157855620 18:51102312-51102334 CATGCGAATGAGTATGTAACAGG + Intergenic
1161799242 19:6406654-6406676 GATGCAAATGAGTATGTTAGTGG - Intergenic
925482735 2:4294273-4294295 CATGAAAATAAATATGTAGATGG + Intergenic
925618428 2:5766580-5766602 CATGCAAATGATGATTTATGAGG + Intergenic
926856878 2:17266458-17266480 CATTCAAATGAATGTGTAGTAGG + Intergenic
932709705 2:74053386-74053408 AATGCAAATGACTTTTTAGTGGG + Intronic
932734636 2:74246107-74246129 CATGATCATGACTATGGAGGAGG + Intronic
934902674 2:98172844-98172866 GACGCAATTGACTATGTAGGTGG + Intronic
937883155 2:126883293-126883315 CAGGCACCTGATTATGTAGGAGG - Intergenic
938925047 2:136031508-136031530 CGTGGAAATGATTATGTAGGTGG - Intergenic
940788038 2:158002950-158002972 CATGCAAATGACTAGCTAAATGG + Intronic
942212879 2:173689168-173689190 CATGCAAAAGACTCTGTACCTGG - Intergenic
945571841 2:211477915-211477937 CATTTAAATGACTATTCAGGTGG + Intronic
945683236 2:212938186-212938208 TATGCAAATGACTATGCACGAGG + Intergenic
945809471 2:214530997-214531019 CATTCAAATTACTGTGTGGGTGG - Intronic
1168834238 20:866748-866770 CATGCACATGTCAATGTACGTGG + Intergenic
1174342279 20:49905500-49905522 CCTGCACTTGACCATGTAGGTGG - Exonic
1175000649 20:55626102-55626124 CATGAAACTGACTATGCAGGTGG + Intergenic
1175532946 20:59686435-59686457 CATGGAAATTACTATGTGGTGGG - Intronic
1184837071 22:47030037-47030059 CATGCAAATGAGAAAGGAGGTGG + Intronic
1185076449 22:48685780-48685802 CATGCAAAGGACTCTGAATGGGG - Intronic
957932949 3:86906099-86906121 CATGAAATTGACTATGTCAGGGG - Intergenic
958176205 3:89998949-89998971 CATTCAAAGGAGTATGTAGAGGG + Intergenic
963156983 3:142109626-142109648 CATTCAAAACACTATGTAGCTGG - Intronic
967329728 3:188278369-188278391 TCTGCCAAAGACTATGTAGGTGG + Intronic
974388453 4:61233242-61233264 CATTCAAATGCCTACGTAGATGG - Intronic
974840338 4:67292107-67292129 CATGCAAATGACTAAGATGGAGG + Intergenic
978393617 4:108254110-108254132 CATGCAGAGGACTATCTCGGTGG - Intergenic
980685958 4:136228733-136228755 CATACATATGTCTATGGAGGTGG - Intergenic
984103152 4:175511776-175511798 GAGGCAAATGACTCTGTAGAGGG - Intergenic
985024875 4:185731019-185731041 CATGCAAATGACTATTTTCTAGG + Intronic
986063419 5:4212908-4212930 CATACAAACGAATATGTAGTAGG + Intergenic
988223024 5:28374277-28374299 CATGCAAATATTTATGTAAGTGG + Intergenic
989172082 5:38481896-38481918 CAAGAAAATGACCCTGTAGGAGG - Exonic
989301568 5:39901016-39901038 TATGCAAGTGACTATGTTTGGGG - Intergenic
989311411 5:40023413-40023435 CATGCAACTGGCTACTTAGGAGG - Intergenic
990858423 5:60298313-60298335 CTTCCAAATGGCTATGAAGGTGG - Intronic
992742398 5:79787032-79787054 CATGCAGTTGACTATATATGTGG + Intronic
994163203 5:96580034-96580056 CATGAAAATATCTATGTATGTGG - Intronic
995629015 5:114112701-114112723 AATGCAAATAAGTATGTGGGTGG + Intergenic
995659759 5:114467990-114468012 CAAGCAAATCACTATAAAGGAGG + Intronic
996411096 5:123160105-123160127 CATGCAAATGACTATGTAGGAGG - Intronic
998531425 5:142888845-142888867 CATGGAAATTACAATCTAGGAGG + Intronic
999682584 5:154073899-154073921 TATGCATATGAATATGTAGATGG - Intronic
1000076390 5:157791507-157791529 AATGCAAATGACTATGCTAGGGG + Intronic
1000368744 5:160515171-160515193 CATGAAAATGACAGTCTAGGAGG + Intergenic
1002975126 6:2067254-2067276 CATGCAAAGCAGTATGTAGAGGG + Intronic
1005794065 6:29338794-29338816 CAAACAAAAGACTATGAAGGTGG + Intergenic
1006176986 6:32128357-32128379 GATGCGGATGACTGTGTAGGCGG + Intergenic
1011379205 6:86724495-86724517 CATGTAAGTGACCATGTGGGTGG + Intergenic
1012656216 6:101824637-101824659 CATACAAATGACTATGCATTTGG + Intronic
1018156376 6:160989215-160989237 CATGCATATGAATATGTAACTGG + Intergenic
1019079733 6:169422164-169422186 CATGCAGAGGAATAGGTAGGAGG - Intergenic
1020815419 7:12899739-12899761 CATGTAGATGACTATGTGGGTGG + Intergenic
1020929369 7:14373906-14373928 CATGCACTTGACTATGTCAGCGG - Intronic
1021503625 7:21356671-21356693 TATGCAAATAACTATTTAAGTGG - Intergenic
1022358599 7:29638929-29638951 CATGCCAATGACTCTAAAGGTGG - Intergenic
1022599035 7:31739008-31739030 CATGCATATGTATATGTGGGGGG - Intergenic
1022680045 7:32536225-32536247 CATGTAAATGACAATGTCTGTGG + Intronic
1024239576 7:47423960-47423982 CATGCCAAAGACTGTGAAGGTGG - Intronic
1027510606 7:79075086-79075108 CATGGAAAGAACTATGTAGCAGG + Intronic
1027682296 7:81235978-81236000 AATGGAAATGATTATGTAGATGG - Intergenic
1030319300 7:108147107-108147129 GATGCAAATCACCATGGAGGAGG + Intergenic
1031633557 7:124073891-124073913 AATGCAAATGAATAAGAAGGAGG - Intergenic
1038733213 8:30146036-30146058 CATGCAAGTGACTTTGGAGAGGG - Intronic
1040069052 8:43174404-43174426 AATGCTAATAAATATGTAGGTGG + Intronic
1040673000 8:49715064-49715086 GAAGCAATTGACTACGTAGGTGG + Intergenic
1042664800 8:71193292-71193314 AATTCAAATGACTATAAAGGAGG - Intergenic
1044349874 8:91151237-91151259 CATGCAAAGCACTGTGTAGAGGG - Intronic
1044353591 8:91194995-91195017 CATGCAAAGCACTGTGTAGAGGG - Intronic
1047597287 8:126391763-126391785 CATGCTGATGATTAAGTAGGAGG + Intergenic
1052415180 9:28168689-28168711 CATGCAAATGATTATATGGATGG + Intronic
1055831388 9:80383088-80383110 CAAGAAAATGACTTTTTAGGAGG - Intergenic
1057721812 9:97537701-97537723 CTTGAAAATGACTATAGAGGTGG - Intronic
1186741414 X:12522277-12522299 AGTGCAAATGGCTATGCAGGGGG - Intronic
1192322765 X:70105340-70105362 CATGGAAATGACTAGGGAGAGGG + Intergenic
1194936393 X:99954680-99954702 GATGCAGATGACTAGGTAGTTGG - Intergenic
1195129309 X:101838577-101838599 CATGCAAATGTGTGTGTGGGGGG + Intronic
1195165365 X:102214844-102214866 CATTTAAATAACTATTTAGGGGG - Intergenic
1195193493 X:102472247-102472269 CATTTAAATAACTATTTAGGGGG + Intergenic
1195736127 X:108014385-108014407 CATGCAAAGCAGTATGTAGAGGG + Intergenic
1196140745 X:112260655-112260677 CATGCAAATGACTATCTGCAAGG + Intergenic
1198977475 X:142352944-142352966 CATGCAATTGACTATTCAGAAGG - Intergenic
1201418140 Y:13768928-13768950 CATGGAAATGACCATGTAGTGGG - Intergenic