ID: 996411456

View in Genome Browser
Species Human (GRCh38)
Location 5:123163682-123163704
Sequence ATCCCCCACTGGAAGCTTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 121}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996411456_996411462 28 Left 996411456 5:123163682-123163704 CCCCAAAGCTTCCAGTGGGGGAT 0: 1
1: 0
2: 0
3: 10
4: 121
Right 996411462 5:123163733-123163755 TGTATTCATATTCGTTTCAGAGG 0: 1
1: 0
2: 1
3: 8
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996411456 Original CRISPR ATCCCCCACTGGAAGCTTTG GGG (reversed) Intronic
900653432 1:3742690-3742712 CTCCCCCACTCCCAGCTTTGGGG - Intergenic
903973991 1:27137503-27137525 CTCCCCCACTTGCAACTTTGTGG - Intronic
906324061 1:44833269-44833291 ATCTACCTCTGGAGGCTTTGCGG + Intronic
907592184 1:55685809-55685831 ATCCAGCACTGGAACCTTTCAGG + Intergenic
908558801 1:65284550-65284572 ACTCCCCACTGGAGGCCTTGAGG - Intronic
912450291 1:109764101-109764123 TTCCCCCACTGCTAGCCTTGGGG + Intronic
912695245 1:111836656-111836678 CTGCCCCTCTGGAAGCTATGAGG - Intronic
918029397 1:180789928-180789950 AGGACCCACAGGAAGCTTTGAGG - Intronic
921534187 1:216325133-216325155 ATCCTCCTCTGGAATCTTTAAGG + Intronic
924248375 1:242107011-242107033 ATCCCCCTCTGGAGACCTTGAGG - Intronic
1064338026 10:14461165-14461187 CTCCCCCACGGGATGTTTTGTGG + Intronic
1067490624 10:46697672-46697694 ATTCCCCAGTGGTTGCTTTGTGG - Intergenic
1067604037 10:47642695-47642717 ATTCCCCAGTGGTTGCTTTGTGG + Intergenic
1069029985 10:63585522-63585544 ATCCCCCCATGAAAGCTTTGTGG + Intronic
1070887606 10:79918821-79918843 ATTCCCCAGTGGTTGCTTTGTGG - Intergenic
1074547454 10:114412339-114412361 ATCCTCCTCTGGAGGCTCTGTGG + Intergenic
1076291875 10:129351760-129351782 TGCTCCCACTGGAGGCTTTGGGG - Intergenic
1079666898 11:23117185-23117207 ATCCCACCCTGGAAAATTTGAGG - Intergenic
1083221715 11:61257146-61257168 AGCCCCCTCTGGGAGCTCTGGGG - Intergenic
1084436259 11:69142769-69142791 GTCCCCAACTGGAGGCTCTGAGG + Intergenic
1085725713 11:78952912-78952934 ATGCCCCAGTGGAACCTTGGGGG - Intronic
1089491059 11:118884525-118884547 ATCACTCACTGGAAGCTATTAGG + Intronic
1090367339 11:126217937-126217959 CTCCCCTTCTGGAAGCTTTGAGG + Intronic
1090604915 11:128411614-128411636 AGGCCCCACAGGAAGCCTTGAGG - Intergenic
1094091203 12:26652181-26652203 AGCTCCCATTGCAAGCTTTGAGG - Intronic
1097199113 12:57263336-57263358 ATACCCCACTGGAAATTTTAAGG + Intronic
1104965803 12:132508363-132508385 CTCCCCGACCGGAAGCTCTGCGG + Intronic
1106949591 13:34868280-34868302 GCCGCCCACAGGAAGCTTTGGGG + Intergenic
1110500649 13:76224083-76224105 ATCACATACAGGAAGCTTTGTGG - Intergenic
1112293567 13:98166467-98166489 CTCCCCTACAGGTAGCTTTGGGG - Intronic
1113778806 13:112963976-112963998 AGCCCCCACTGGAAGGGCTGTGG + Intronic
1118907567 14:70033673-70033695 GTCCCTCACTGGGAGGTTTGGGG + Intergenic
1120155585 14:81089460-81089482 ATCCCCCACTATATGCTCTGTGG + Intronic
1120175660 14:81290600-81290622 ATCACCCACAGGAAGGTTAGGGG + Intronic
1121489065 14:94344897-94344919 ATCCTCCCCTGGGACCTTTGAGG - Intergenic
1121576756 14:94995236-94995258 ATCTCCAAGGGGAAGCTTTGTGG + Intergenic
1122482728 14:102057912-102057934 AGCCTCCAGTGGAAGCTTTGTGG - Intergenic
1128005637 15:64237910-64237932 TTCACCCACTGAAACCTTTGTGG - Intronic
1128742336 15:70092560-70092582 ATCCACCACTGGCAGCTGAGAGG + Intronic
1129953010 15:79608501-79608523 GTCACCCACTGGGAGCTGTGTGG + Intergenic
1131777291 15:95816152-95816174 ATCCACCTCTTGAGGCTTTGAGG + Intergenic
1133557630 16:6920621-6920643 AGCTCCTTCTGGAAGCTTTGAGG + Intronic
1136117352 16:28102926-28102948 ATCCTCCTCTGGTAGCTTAGGGG - Intronic
1138377412 16:56575059-56575081 ATTTCTCACTGGAAGCTTTTGGG + Intergenic
1139391127 16:66606546-66606568 ATGCCCCACAGGAAGCACTGTGG - Intronic
1142697156 17:1640006-1640028 CTGCCCCACTGGTACCTTTGGGG - Exonic
1143540095 17:7563509-7563531 ACATTCCACTGGAAGCTTTGGGG + Exonic
1147334631 17:39719875-39719897 CTCCCCCACTGGATGCTGGGTGG + Intronic
1150150206 17:62802903-62802925 TTCCCAGACTGGAAGCTTTCAGG - Intronic
1151994064 17:77597581-77597603 ATCCCCGCCAGGAAGCTTTCAGG - Intergenic
1152142483 17:78544997-78545019 ATCCCCCACTGGAAACATGAGGG + Intronic
1155150170 18:23116785-23116807 ACCACCCACAGGAAGCTTTGTGG + Intergenic
1159022146 18:63152038-63152060 ATCCCCTACTCGAAGTTCTGAGG - Intronic
1160210782 18:76876799-76876821 ATGCCTCACTGGAACCTTAGAGG + Intronic
1161628060 19:5338481-5338503 ATGCCCCACGGAAGGCTTTGTGG + Intronic
1162343370 19:10105738-10105760 TTCCCCCACTGCAAGGTTTTGGG + Intergenic
1165170245 19:33887367-33887389 AGGCCCCACTGGGAGGTTTGGGG - Intergenic
926321131 2:11749004-11749026 ATCACCCACTAGCAGCTTTGGGG + Intronic
928759851 2:34569219-34569241 ATCACCTATTGAAAGCTTTGTGG - Intergenic
932449583 2:71800853-71800875 CATCCCCACTGGAGGCTTTGGGG - Intergenic
935325454 2:101931866-101931888 ATCTTTCCCTGGAAGCTTTGAGG + Intergenic
939204581 2:139084027-139084049 AGCCCCCTCTGGCAGTTTTGTGG + Intergenic
941826687 2:169906517-169906539 AACAACCACTGGAAGGTTTGTGG - Intronic
946331685 2:219013147-219013169 ATGGCCCTCTGGAAGCATTGAGG - Intronic
1168955588 20:1832295-1832317 ACCCCCTACTGGAAGGTTTTTGG + Intergenic
1171342463 20:24441214-24441236 ATCCCTCACTGGAAACATTCAGG + Intergenic
1174036959 20:47674368-47674390 CTCCACCACTTGAAGCTGTGAGG + Intronic
1174181450 20:48677435-48677457 ATCCACAACTGTGAGCTTTGTGG + Intronic
1179441841 21:41400246-41400268 CTCCCCCTCTGGAAGGTCTGGGG + Intronic
1180867163 22:19126250-19126272 AACCCCCACTGGCAGCCTTGTGG - Intergenic
1181161317 22:20961641-20961663 AGCACCCACTGGATTCTTTGGGG - Intergenic
1185231595 22:49687022-49687044 ATCCCCTACTGGAAACTTGAGGG + Intergenic
949782550 3:7706426-7706448 ATCCCCAACTGCAAGTTTGGAGG + Intronic
951061776 3:18216903-18216925 ATCTCACACTGAAAGCTGTGAGG - Intronic
951999952 3:28773540-28773562 ATACCCTACTGGAAGCCATGTGG - Intergenic
960046557 3:113204285-113204307 AGCTGCCACTGCAAGCTTTGAGG - Intergenic
965837810 3:172870415-172870437 ATTCCCTTCTGGAAGCTATGGGG + Intergenic
967563747 3:190948898-190948920 AACCCCCATTGTAAGCTTAGGGG - Intergenic
969344415 4:6562363-6562385 CTCTCCCACTGGCAGCTGTGTGG + Intronic
969617101 4:8260069-8260091 ATCCTCCCCCGGAGGCTTTGGGG - Intergenic
969947845 4:10802664-10802686 ATCCACCCCTGGAAGCTCTGTGG + Intergenic
971602899 4:28618292-28618314 TTCCCACACTTGAAGTTTTGGGG + Intergenic
971911236 4:32799605-32799627 AACCACCACTGGATGCTCTGAGG + Intergenic
974080552 4:57207968-57207990 TTCTCCCACTGGAAGGCTTGGGG + Intergenic
974976028 4:68893079-68893101 GCCCTCAACTGGAAGCTTTGGGG + Intergenic
976886735 4:89994300-89994322 ATACAAAACTGGAAGCTTTGAGG + Intergenic
977491375 4:97716678-97716700 ATCACACACTGGAGGCTGTGGGG + Intronic
982206667 4:153001782-153001804 AGCCCCCAAAGGAAGCTGTGTGG - Intergenic
983079759 4:163370801-163370823 ATCACACACTGGAGCCTTTGAGG + Intergenic
986236668 5:5916868-5916890 CTTCCCCACTGGAAGTTGTGAGG + Intergenic
990217046 5:53545861-53545883 ACCCCCAACAGGAAGCATTGGGG - Intergenic
996411456 5:123163682-123163704 ATCCCCCACTGGAAGCTTTGGGG - Intronic
997250968 5:132388210-132388232 AAGCCCCACTGGCATCTTTGAGG + Intronic
999189130 5:149733112-149733134 ATCTCCCTTTGGGAGCTTTGGGG + Intronic
1000209547 5:159097234-159097256 AGCGCCCACTGGATGTTTTGGGG - Intronic
1001130201 5:169057509-169057531 ATCCCCCTCTGGGAGCTTATGGG - Intronic
1002702927 5:181138756-181138778 CTCCACCACTGGCAGCTGTGTGG + Intergenic
1006342805 6:33455876-33455898 CTCACCCTCTGGAAGCTTTCGGG - Exonic
1006944234 6:37774081-37774103 TCCCCCCTCTGGAAGCTTTTAGG - Intergenic
1015187568 6:130435767-130435789 ATCCTTCACTTGAATCTTTGAGG + Intronic
1019764861 7:2843210-2843232 ATTTCCCACTGGAAGATTTGTGG - Intronic
1022130108 7:27397166-27397188 GTCCCCCATTGGAATCGTTGTGG - Intergenic
1022412884 7:30152929-30152951 ATAGCTCACAGGAAGCTTTGTGG + Intronic
1022537319 7:31106335-31106357 AGCCCCCACTGGAGACCTTGAGG + Intronic
1022979716 7:35593260-35593282 ACTCAGCACTGGAAGCTTTGTGG - Intergenic
1023505645 7:40897638-40897660 ATCCCCCACTGAAGGCTCTTGGG - Intergenic
1024051205 7:45624549-45624571 ATTCCCCACAGGAATTTTTGTGG + Intronic
1025135035 7:56404268-56404290 ATCCTATACTGGAAGCTTTTAGG - Intergenic
1027528665 7:79302450-79302472 ATCCCCTACTGGAATCTTCAGGG - Intronic
1028576940 7:92362645-92362667 ATCCTTCATTGGAAGCTTTCAGG - Intronic
1032995344 7:137439863-137439885 ATGCCCCACTGGAACATCTGAGG - Intronic
1033027698 7:137792289-137792311 ATCCCCCAATGGAGGATTGGGGG - Intronic
1033133099 7:138762077-138762099 CTCCCCCATTGGAAGCTGTGGGG - Intronic
1033671848 7:143500602-143500624 ATTCCCCACTTTAAGCTTTTGGG + Intergenic
1041021523 8:53643143-53643165 ATCCCCCACTGCAGGCTTGTGGG - Intergenic
1044475511 8:92620827-92620849 TTCCCCCACTTGAAACCTTGTGG + Intergenic
1044645740 8:94441351-94441373 AACCCCAACTTGAAGCTTTTTGG - Intronic
1047357429 8:124136814-124136836 ATCCCCCCCTCGAATCTTAGAGG + Intergenic
1048800043 8:138186830-138186852 ATCTCCCACTAGAACCATTGTGG + Intronic
1049581652 8:143414294-143414316 TTCCCCCTCTGGAAGTTTTTTGG - Intergenic
1050415189 9:5409131-5409153 GTGCCCCAGTGGAATCTTTGTGG - Intronic
1051453646 9:17227190-17227212 AGCCCCCACTTTCAGCTTTGGGG + Intronic
1051491392 9:17670237-17670259 ATCCCCCAGTGCAAGCTTCCAGG + Intronic
1052799532 9:32955495-32955517 CAGCCCCACTAGAAGCTTTGAGG - Intergenic
1054734118 9:68733161-68733183 ATTTCCCACTGGAAATTTTGTGG - Intronic
1057242236 9:93421533-93421555 TTCCTCCACTGCAAACTTTGAGG - Intergenic
1060400814 9:123348599-123348621 TTCCCCCTCTGGATGCTCTGAGG + Intergenic
1188299191 X:28486726-28486748 ATCCCCCTCTGGTATATTTGTGG + Intergenic
1194278745 X:91921049-91921071 AACCATCACTGGAAGCTTTGTGG - Intronic
1195322273 X:103729435-103729457 ATAACACACTGGAACCTTTGAGG - Intergenic
1200596228 Y:5144551-5144573 AACCATCATTGGAAGCTTTGTGG - Intronic
1201984771 Y:19953951-19953973 ATACACCACTGGATGCTCTGTGG - Intergenic