ID: 996413454

View in Genome Browser
Species Human (GRCh38)
Location 5:123183802-123183824
Sequence CTGTTTAGTAAGAAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 646
Summary {0: 1, 1: 1, 2: 0, 3: 28, 4: 293}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996413454_996413458 -3 Left 996413454 5:123183802-123183824 CCTTCCTCCTTCTTACTAAACAG 0: 1
1: 1
2: 0
3: 28
4: 293
Right 996413458 5:123183822-123183844 CAGTGTCTTGATATTTCAGTGGG 0: 1
1: 0
2: 0
3: 12
4: 212
996413454_996413457 -4 Left 996413454 5:123183802-123183824 CCTTCCTCCTTCTTACTAAACAG 0: 1
1: 1
2: 0
3: 28
4: 293
Right 996413457 5:123183821-123183843 ACAGTGTCTTGATATTTCAGTGG No data
996413454_996413459 19 Left 996413454 5:123183802-123183824 CCTTCCTCCTTCTTACTAAACAG 0: 1
1: 1
2: 0
3: 28
4: 293
Right 996413459 5:123183844-123183866 GCTGCCCTGCTGTGCCTGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996413454 Original CRISPR CTGTTTAGTAAGAAGGAGGA AGG (reversed) Intronic
901723569 1:11220606-11220628 ATGTTTAATAAGATGGAGGAAGG + Intronic
901723569 1:11220606-11220628 ATGTTTAATAAGATGGAGGAAGG + Intronic
902628584 1:17691101-17691123 CTGTCTGGTTAAAAGGAGGAGGG - Intronic
902628584 1:17691101-17691123 CTGTCTGGTTAAAAGGAGGAGGG - Intronic
905476999 1:38236025-38236047 CTCTAGAGTAAGAAGGAGAAGGG - Intergenic
905476999 1:38236025-38236047 CTCTAGAGTAAGAAGGAGAAGGG - Intergenic
905636551 1:39557701-39557723 GTGTATAGTAAGAATCAGGAGGG - Intergenic
905636551 1:39557701-39557723 GTGTATAGTAAGAATCAGGAGGG - Intergenic
909070566 1:70988531-70988553 CTGGTCAGTAGGAAGGAGGAAGG - Intronic
909070566 1:70988531-70988553 CTGGTCAGTAGGAAGGAGGAAGG - Intronic
910562264 1:88603350-88603372 CTGTTAAGGAAGCAGCAGGAAGG - Intergenic
910562264 1:88603350-88603372 CTGTTAAGGAAGCAGCAGGAAGG - Intergenic
911442225 1:97941143-97941165 CTCTTTAGTGATAAGAAGGAAGG - Intergenic
911442225 1:97941143-97941165 CTCTTTAGTGATAAGAAGGAAGG - Intergenic
912423628 1:109566148-109566170 CTGTTCAGAAAGAATGAGGAGGG + Intronic
912423628 1:109566148-109566170 CTGTTCAGAAAGAATGAGGAGGG + Intronic
913088493 1:115460072-115460094 CTGTGAAGTAAGTAGGGGGAAGG + Intergenic
913088493 1:115460072-115460094 CTGTGAAGTAAGTAGGGGGAAGG + Intergenic
914082975 1:144426538-144426560 CTGTTTAAAAAGAAAAAGGACGG + Intronic
914082975 1:144426538-144426560 CTGTTTAAAAAGAAAAAGGACGG + Intronic
914434209 1:147645957-147645979 ATTCTTAGTAAGAGGGAGGAAGG + Exonic
914434209 1:147645957-147645979 ATTCTTAGTAAGAGGGAGGAAGG + Exonic
915347211 1:155203593-155203615 CTGGTTGGTGAGAAGGAGGAAGG + Intronic
915347211 1:155203593-155203615 CTGGTTGGTGAGAAGGAGGAAGG + Intronic
917250428 1:173053639-173053661 CTGTTTAAGAAGAGAGAGGAGGG + Intergenic
917250428 1:173053639-173053661 CTGTTTAAGAAGAGAGAGGAGGG + Intergenic
918077796 1:181183538-181183560 CTGTGTCCTAAGAAGGAGGATGG + Intergenic
918077796 1:181183538-181183560 CTGTGTCCTAAGAAGGAGGATGG + Intergenic
919810019 1:201403090-201403112 TTGCTGAGTAGGAAGGAGGAGGG + Intergenic
919810019 1:201403090-201403112 TTGCTGAGTAGGAAGGAGGAGGG + Intergenic
920034470 1:203056887-203056909 CTGTTTGGGAAGAAGGAGAAGGG + Exonic
920034470 1:203056887-203056909 CTGTTTGGGAAGAAGGAGAAGGG + Exonic
920100075 1:203511783-203511805 CTGTTTACCAATAAGCAGGAAGG - Intergenic
920100075 1:203511783-203511805 CTGTTTACCAATAAGCAGGAAGG - Intergenic
921785085 1:219220346-219220368 CTGCTTAGTAAAAAAGAGGCAGG - Intergenic
921785085 1:219220346-219220368 CTGCTTAGTAAAAAAGAGGCAGG - Intergenic
922002753 1:221496517-221496539 GTGTTTAGTGAGAAGGAGCCTGG + Intergenic
922002753 1:221496517-221496539 GTGTTTAGTGAGAAGGAGCCTGG + Intergenic
922435046 1:225596505-225596527 CTTCTGATTAAGAAGGAGGAAGG + Intronic
922435046 1:225596505-225596527 CTTCTGATTAAGAAGGAGGAAGG + Intronic
922876225 1:228941841-228941863 CTCTTTTGGAAGAATGAGGATGG - Intergenic
922876225 1:228941841-228941863 CTCTTTTGGAAGAATGAGGATGG - Intergenic
923802256 1:237221717-237221739 CTATTTAGTAAGAAGGGACATGG + Intronic
923802256 1:237221717-237221739 CTATTTAGTAAGAAGGGACATGG + Intronic
924032459 1:239900153-239900175 CTGTTGAGTCAGGATGAGGAAGG + Intronic
924032459 1:239900153-239900175 CTGTTGAGTCAGGATGAGGAAGG + Intronic
924118849 1:240776159-240776181 CCGTTTAGTAAGACTGAGCAAGG + Exonic
924118849 1:240776159-240776181 CCGTTTAGTAAGACTGAGCAAGG + Exonic
924880834 1:248160476-248160498 CTGTTTAGTAGAAAGTAGCAAGG - Intergenic
924880834 1:248160476-248160498 CTGTTTAGTAGAAAGTAGCAAGG - Intergenic
1063498914 10:6535973-6535995 CTGCTCAGTAGGAAGGAAGAGGG - Intronic
1063498914 10:6535973-6535995 CTGCTCAGTAGGAAGGAAGAGGG - Intronic
1064080175 10:12301985-12302007 CTGCCCAGTAGGAAGGAGGAAGG + Intergenic
1064080175 10:12301985-12302007 CTGCCCAGTAGGAAGGAGGAAGG + Intergenic
1065261061 10:23923602-23923624 ATGTGTCGGAAGAAGGAGGAAGG + Intronic
1065261061 10:23923602-23923624 ATGTGTCGGAAGAAGGAGGAAGG + Intronic
1066156481 10:32683845-32683867 CTGCTTAGTAAGGAGTAGCAAGG + Intronic
1066156481 10:32683845-32683867 CTGCTTAGTAAGGAGTAGCAAGG + Intronic
1066461287 10:35614606-35614628 CTGTTTAGTAAACAGCTGGAAGG - Intergenic
1066461287 10:35614606-35614628 CTGTTTAGTAAACAGCTGGAAGG - Intergenic
1071126136 10:82337086-82337108 CAGTTTAGTAAGAAGTAAAAGGG - Intronic
1071126136 10:82337086-82337108 CAGTTTAGTAAGAAGTAAAAGGG - Intronic
1071168273 10:82832351-82832373 CTGATCAGCAACAAGGAGGAGGG - Intronic
1071168273 10:82832351-82832373 CTGATCAGCAACAAGGAGGAGGG - Intronic
1072022004 10:91411010-91411032 CTGTTTAATCTGAAGGGGGAAGG - Intronic
1072022004 10:91411010-91411032 CTGTTTAATCTGAAGGGGGAAGG - Intronic
1072335127 10:94391118-94391140 CTGTATAGCAAGAGTGAGGAAGG + Intergenic
1072335127 10:94391118-94391140 CTGTATAGCAAGAGTGAGGAAGG + Intergenic
1072995510 10:100240250-100240272 CAGATTAGTAAAAAGGGGGAAGG - Intronic
1072995510 10:100240250-100240272 CAGATTAGTAAAAAGGGGGAAGG - Intronic
1074372849 10:112914188-112914210 CTGAAAAGAAAGAAGGAGGAAGG - Intergenic
1074372849 10:112914188-112914210 CTGAAAAGAAAGAAGGAGGAAGG - Intergenic
1074600859 10:114911919-114911941 CTGTTGAGTAGGAAGTAGAAAGG - Intergenic
1074600859 10:114911919-114911941 CTGTTGAGTAGGAAGTAGAAAGG - Intergenic
1074827164 10:117222941-117222963 CTGTTGAGAAGGAAGGAGGGAGG - Intergenic
1074827164 10:117222941-117222963 CTGTTGAGAAGGAAGGAGGGAGG - Intergenic
1074866548 10:117547276-117547298 CTGTTTAGAAGGAGGGAAGAGGG + Intronic
1074866548 10:117547276-117547298 CTGTTTAGAAGGAGGGAAGAGGG + Intronic
1074887364 10:117704719-117704741 ATGTCTAGTAAGAAGCAGGCTGG - Intergenic
1074887364 10:117704719-117704741 ATGTCTAGTAAGAAGCAGGCTGG - Intergenic
1075877404 10:125819520-125819542 TTGTTTAGTAAGCAGGAGAGAGG - Intronic
1075877404 10:125819520-125819542 TTGTTTAGTAAGCAGGAGAGAGG - Intronic
1076980847 11:203943-203965 CTGTGTGGAAGGAAGGAGGAGGG + Exonic
1076980847 11:203943-203965 CTGTGTGGAAGGAAGGAGGAGGG + Exonic
1078490177 11:11761016-11761038 CTGTCTTGGAAGAAGGAGGAAGG - Intergenic
1078490177 11:11761016-11761038 CTGTCTTGGAAGAAGGAGGAAGG - Intergenic
1080017077 11:27518882-27518904 CTGTTCAGGAAGTAGGAGGGAGG + Intergenic
1080017077 11:27518882-27518904 CTGTTCAGGAAGTAGGAGGGAGG + Intergenic
1080342007 11:31275400-31275422 CAGTATAGTAAGGATGAGGATGG - Intronic
1080342007 11:31275400-31275422 CAGTATAGTAAGGATGAGGATGG - Intronic
1080741081 11:35064802-35064824 CTGTTCAGAAAGAAGGAAAAAGG - Intergenic
1080741081 11:35064802-35064824 CTGTTCAGAAAGAAGGAAAAAGG - Intergenic
1081532841 11:43975241-43975263 CTGTTAAGTATGAAGAAGCAGGG + Intergenic
1081532841 11:43975241-43975263 CTGTTAAGTATGAAGAAGCAGGG + Intergenic
1082024862 11:47564949-47564971 CTGTTTGGTCAGATGAAGGAGGG + Intronic
1082024862 11:47564949-47564971 CTGTTTGGTCAGATGAAGGAGGG + Intronic
1082237826 11:49840680-49840702 GTGTTTAGTAAAAAAGAGTAAGG - Intergenic
1082237826 11:49840680-49840702 GTGTTTAGTAAAAAAGAGTAAGG - Intergenic
1084073542 11:66754074-66754096 GTGTTCAGGAAGAAGGAGAATGG + Intronic
1084073542 11:66754074-66754096 GTGTTCAGGAAGAAGGAGAATGG + Intronic
1084268713 11:68017962-68017984 CTGTTTAGCAAGAAGCAGAGTGG - Intronic
1084268713 11:68017962-68017984 CTGTTTAGCAAGAAGCAGAGTGG - Intronic
1084514733 11:69630590-69630612 CTGCTGAGTAAGAAGCAGTAAGG - Intergenic
1084514733 11:69630590-69630612 CTGCTGAGTAAGAAGCAGTAAGG - Intergenic
1089615342 11:119691869-119691891 CTGCTGAGAAAGAGGGAGGAAGG - Intronic
1089615342 11:119691869-119691891 CTGCTGAGAAAGAGGGAGGAAGG - Intronic
1089962584 11:122629032-122629054 CTGTGCAGTAAGAGGGAGGCAGG + Intergenic
1089962584 11:122629032-122629054 CTGTGCAGTAAGAGGGAGGCAGG + Intergenic
1090390965 11:126386942-126386964 CAGTTTGGCAAGTAGGAGGAGGG + Intronic
1090390965 11:126386942-126386964 CAGTTTGGCAAGTAGGAGGAGGG + Intronic
1090570400 11:128038598-128038620 CTGACTTGGAAGAAGGAGGAGGG - Intergenic
1090570400 11:128038598-128038620 CTGACTTGGAAGAAGGAGGAGGG - Intergenic
1091593112 12:1857098-1857120 ATGTGTAGGAAGAAGGAAGAAGG + Intronic
1091593112 12:1857098-1857120 ATGTGTAGGAAGAAGGAAGAAGG + Intronic
1092475344 12:8814170-8814192 ATAATTAGTAAGAAGGAGGGAGG + Intergenic
1092475344 12:8814170-8814192 ATAATTAGTAAGAAGGAGGGAGG + Intergenic
1092948267 12:13476471-13476493 CCGTTTAGCAAGATGGAGGTGGG - Intergenic
1092948267 12:13476471-13476493 CCGTTTAGCAAGATGGAGGTGGG - Intergenic
1093757986 12:22874195-22874217 GTGTAGAGAAAGAAGGAGGAGGG - Intergenic
1093757986 12:22874195-22874217 GTGTAGAGAAAGAAGGAGGAGGG - Intergenic
1093783614 12:23166822-23166844 CTATTTAGAAAGATTGAGGAAGG + Intergenic
1093783614 12:23166822-23166844 CTATTTAGAAAGATTGAGGAAGG + Intergenic
1093915074 12:24792686-24792708 ATGTTTAGTATAAATGAGGAAGG + Intergenic
1093915074 12:24792686-24792708 ATGTTTAGTATAAATGAGGAAGG + Intergenic
1094430562 12:30365130-30365152 CTGTTTAGGAAGAAAAAGAAAGG + Intergenic
1094430562 12:30365130-30365152 CTGTTTAGGAAGAAAAAGAAAGG + Intergenic
1095575356 12:43731604-43731626 TTGTTTAATAAAAAAGAGGAGGG + Intronic
1095575356 12:43731604-43731626 TTGTTTAATAAAAAAGAGGAGGG + Intronic
1097427250 12:59461681-59461703 ATGTTTTGTCAGAAGGAGAAAGG + Intergenic
1097427250 12:59461681-59461703 ATGTTTTGTCAGAAGGAGAAAGG + Intergenic
1098095051 12:66946001-66946023 CTGTGTAGCAGGAAGAAGGAAGG - Intergenic
1098095051 12:66946001-66946023 CTGTGTAGCAGGAAGAAGGAAGG - Intergenic
1098364099 12:69684263-69684285 CTGATTAGAAAGATGAAGGAGGG - Intronic
1098364099 12:69684263-69684285 CTGATTAGAAAGATGAAGGAGGG - Intronic
1099252452 12:80272913-80272935 CATTTTAGTAAAAAGGAGAAGGG + Intronic
1099252452 12:80272913-80272935 CATTTTAGTAAAAAGGAGAAGGG + Intronic
1101294308 12:103405133-103405155 CTGTTATTTAAAAAGGAGGAGGG + Intronic
1101294308 12:103405133-103405155 CTGTTATTTAAAAAGGAGGAGGG + Intronic
1101368090 12:104095130-104095152 GTGTTTAGAATGAACGAGGAAGG + Intronic
1101368090 12:104095130-104095152 GTGTTTAGAATGAACGAGGAAGG + Intronic
1102071480 12:110023555-110023577 CTCTTTTGTAAGGAGCAGGATGG + Intronic
1102071480 12:110023555-110023577 CTCTTTTGTAAGGAGCAGGATGG + Intronic
1102572737 12:113837150-113837172 GTGTATATTAAGTAGGAGGATGG - Intronic
1102572737 12:113837150-113837172 GTGTATATTAAGTAGGAGGATGG - Intronic
1102983625 12:117261864-117261886 CTGTTTAGTTAGAAAGAGGCTGG - Intronic
1102983625 12:117261864-117261886 CTGTTTAGTTAGAAAGAGGCTGG - Intronic
1103332030 12:120160899-120160921 ATGTTTAGTAAAAGGGAGGAAGG + Intronic
1103332030 12:120160899-120160921 ATGTTTAGTAAAAGGGAGGAAGG + Intronic
1107325441 13:39237081-39237103 CTCTGTAGTGAGAAGGAGCATGG + Intergenic
1107325441 13:39237081-39237103 CTCTGTAGTGAGAAGGAGCATGG + Intergenic
1107739930 13:43438908-43438930 GTGATTAGTTAAAAGGAGGAAGG + Intronic
1107739930 13:43438908-43438930 GTGATTAGTTAAAAGGAGGAAGG + Intronic
1109103776 13:58222310-58222332 TTGATTAGTTAGCAGGAGGAAGG + Intergenic
1109103776 13:58222310-58222332 TTGATTAGTTAGCAGGAGGAAGG + Intergenic
1109280093 13:60345804-60345826 CTGTTTAGTAAGAGAAAGAAAGG - Intergenic
1109280093 13:60345804-60345826 CTGTTTAGTAAGAGAAAGAAAGG - Intergenic
1109512392 13:63396600-63396622 ATGTCTAGGAAGAAGGAGGTAGG - Intergenic
1109512392 13:63396600-63396622 ATGTCTAGGAAGAAGGAGGTAGG - Intergenic
1109740006 13:66541104-66541126 ATTTATAGTTAGAAGGAGGAAGG - Intronic
1109740006 13:66541104-66541126 ATTTATAGTTAGAAGGAGGAAGG - Intronic
1109741210 13:66558387-66558409 CTGTCTTGTAAGGAGGTGGAGGG + Intronic
1109741210 13:66558387-66558409 CTGTCTTGTAAGGAGGTGGAGGG + Intronic
1109944716 13:69418990-69419012 ATGTCTATTAACAAGGAGGATGG - Intergenic
1109944716 13:69418990-69419012 ATGTCTATTAACAAGGAGGATGG - Intergenic
1110518048 13:76439868-76439890 AAGTTTTGTTAGAAGGAGGAAGG - Intergenic
1110518048 13:76439868-76439890 AAGTTTTGTTAGAAGGAGGAAGG - Intergenic
1112986108 13:105451988-105452010 CTGTTCAGTTACAAGGAGGGAGG - Intergenic
1112986108 13:105451988-105452010 CTGTTCAGTTACAAGGAGGGAGG - Intergenic
1116240744 14:42339227-42339249 CTGTATAGCAAGAATGGGGAAGG - Intergenic
1116240744 14:42339227-42339249 CTGTATAGCAAGAATGGGGAAGG - Intergenic
1117400865 14:55357525-55357547 CTGTTTATTAAGAAGTATGAAGG + Intronic
1117400865 14:55357525-55357547 CTGTTTATTAAGAAGTATGAAGG + Intronic
1118437204 14:65782403-65782425 TTGCTTAGTGAGTAGGAGGAGGG + Intergenic
1118437204 14:65782403-65782425 TTGCTTAGTGAGTAGGAGGAGGG + Intergenic
1120113835 14:80590508-80590530 CTGTTTAGGAATAAAGATGAAGG + Intronic
1120113835 14:80590508-80590530 CTGTTTAGGAATAAAGATGAAGG + Intronic
1122171487 14:99879388-99879410 CTGTTTAGTAAAGCTGAGGAAGG + Intronic
1122171487 14:99879388-99879410 CTGTTTAGTAAAGCTGAGGAAGG + Intronic
1128176239 15:65558497-65558519 CTGCTTAGTAAGCAGGAGTCAGG + Intronic
1128176239 15:65558497-65558519 CTGCTTAGTAAGCAGGAGTCAGG + Intronic
1129004026 15:72357340-72357362 CTGTTTGGGAAGAGGAAGGAAGG - Intronic
1129004026 15:72357340-72357362 CTGTTTGGGAAGAGGAAGGAAGG - Intronic
1129058215 15:72837326-72837348 CTGGTTCTTAAGAAGAAGGAAGG + Intergenic
1129058215 15:72837326-72837348 CTGGTTCTTAAGAAGAAGGAAGG + Intergenic
1129185929 15:73906469-73906491 CAGTTTGGAAAGAAGGATGAGGG + Intergenic
1129185929 15:73906469-73906491 CAGTTTGGAAAGAAGGATGAGGG + Intergenic
1129504501 15:76070257-76070279 CCAGTTAGGAAGAAGGAGGAAGG + Intronic
1129504501 15:76070257-76070279 CCAGTTAGGAAGAAGGAGGAAGG + Intronic
1129682713 15:77667046-77667068 CTGGATAAGAAGAAGGAGGAGGG + Intronic
1129682713 15:77667046-77667068 CTGGATAAGAAGAAGGAGGAGGG + Intronic
1129828765 15:78653327-78653349 CTGATTAGCAGGAAGGAGGGAGG - Intronic
1129828765 15:78653327-78653349 CTGATTAGCAGGAAGGAGGGAGG - Intronic
1131067896 15:89445676-89445698 CTCTTGAGTAAGAAGGCGTATGG - Intergenic
1131067896 15:89445676-89445698 CTCTTGAGTAAGAAGGCGTATGG - Intergenic
1131133307 15:89913529-89913551 CTGTGCAGGAAGAAGGAGGGAGG - Intergenic
1131133307 15:89913529-89913551 CTGTGCAGGAAGAAGGAGGGAGG - Intergenic
1132141974 15:99404196-99404218 CTGTCTATGAAGAAGGAGCAGGG + Intergenic
1132141974 15:99404196-99404218 CTGTCTATGAAGAAGGAGCAGGG + Intergenic
1132682004 16:1146265-1146287 CTGTGGAGTGGGAAGGAGGAGGG - Intergenic
1132682004 16:1146265-1146287 CTGTGGAGTGGGAAGGAGGAGGG - Intergenic
1133551887 16:6864123-6864145 CTCTTTAGCAGGAAGAAGGAGGG + Intronic
1133551887 16:6864123-6864145 CTCTTTAGCAGGAAGAAGGAGGG + Intronic
1134022348 16:10929838-10929860 CTGTTTATTGGGAGGGAGGAGGG + Exonic
1134022348 16:10929838-10929860 CTGTTTATTGGGAGGGAGGAGGG + Exonic
1135169210 16:20168370-20168392 CTGTTCTGTAAGGAGGAGGCTGG + Intergenic
1135169210 16:20168370-20168392 CTGTTCTGTAAGGAGGAGGCTGG + Intergenic
1135742041 16:24984270-24984292 CTGTCTAGCAGGGAGGAGGACGG - Intronic
1135742041 16:24984270-24984292 CTGTCTAGCAGGGAGGAGGACGG - Intronic
1135886896 16:26318386-26318408 ATGTTCAGGAAGAAGAAGGAAGG + Intergenic
1135886896 16:26318386-26318408 ATGTTCAGGAAGAAGAAGGAAGG + Intergenic
1138387421 16:56645285-56645307 ACGTTCAGTATGAAGGAGGAAGG + Intronic
1138387421 16:56645285-56645307 ACGTTCAGTATGAAGGAGGAAGG + Intronic
1139525977 16:67516959-67516981 GTGTTAAGTGAGAAGGAGGAAGG + Intergenic
1139525977 16:67516959-67516981 GTGTTAAGTGAGAAGGAGGAAGG + Intergenic
1139633403 16:68244319-68244341 CTGCTTACCAAGAAGAAGGAAGG + Intergenic
1139633403 16:68244319-68244341 CTGCTTACCAAGAAGAAGGAAGG + Intergenic
1140019641 16:71225673-71225695 AGGTTCAGAAAGAAGGAGGAGGG + Intronic
1140019641 16:71225673-71225695 AGGTTCAGAAAGAAGGAGGAGGG + Intronic
1140507600 16:75483696-75483718 ATATCCAGTAAGAAGGAGGAAGG + Intronic
1140507600 16:75483696-75483718 ATATCCAGTAAGAAGGAGGAAGG + Intronic
1141891264 16:86928271-86928293 CTGGTTTGTAAGAAGTAGGGTGG - Intergenic
1141891264 16:86928271-86928293 CTGGTTTGTAAGAAGTAGGGTGG - Intergenic
1144443020 17:15301065-15301087 CTGTTTAGAGAGAGGGATGAGGG + Intergenic
1144443020 17:15301065-15301087 CTGTTTAGAGAGAGGGATGAGGG + Intergenic
1144823025 17:18088641-18088663 CTGTGTACTAAGATGGAGCAGGG - Intronic
1144823025 17:18088641-18088663 CTGTGTACTAAGATGGAGCAGGG - Intronic
1146749572 17:35366095-35366117 CTTTTTAATTTGAAGGAGGATGG - Intronic
1146749572 17:35366095-35366117 CTTTTTAATTTGAAGGAGGATGG - Intronic
1148535812 17:48437834-48437856 CTGTTTAGAATGAGTGAGGAAGG - Intergenic
1148535812 17:48437834-48437856 CTGTTTAGAATGAGTGAGGAAGG - Intergenic
1148855904 17:50579205-50579227 ATGTTTAGTTAGGAGGAGCAAGG + Intronic
1148855904 17:50579205-50579227 ATGTTTAGTTAGGAGGAGCAAGG + Intronic
1150497652 17:65620905-65620927 CTGTTCAGCAAGAAGGGTGAGGG + Intronic
1150497652 17:65620905-65620927 CTGTTCAGCAAGAAGGGTGAGGG + Intronic
1151198796 17:72452607-72452629 CTGTTTAGAGAGCAGGAGGTGGG + Intergenic
1151198796 17:72452607-72452629 CTGTTTAGAGAGCAGGAGGTGGG + Intergenic
1152971358 18:164748-164770 CTGTTTAGAAAAAAGGGGGCTGG - Intronic
1152971358 18:164748-164770 CTGTTTAGAAAAAAGGGGGCTGG - Intronic
1156259403 18:35430705-35430727 CTGTTTAGAGAGAAAAAGGAAGG - Intergenic
1156259403 18:35430705-35430727 CTGTTTAGAGAGAAAAAGGAAGG - Intergenic
1158081173 18:53592515-53592537 CAGCTTAGGAAGAAGAAGGAAGG - Intergenic
1158081173 18:53592515-53592537 CAGCTTAGGAAGAAGAAGGAAGG - Intergenic
1159074631 18:63666440-63666462 TGGTTGAGTAGGAAGGAGGAAGG - Intronic
1159074631 18:63666440-63666462 TGGTTGAGTAGGAAGGAGGAAGG - Intronic
1159275264 18:66211132-66211154 CTGATTAATCAGAAGAAGGAGGG - Intergenic
1159275264 18:66211132-66211154 CTGATTAATCAGAAGAAGGAGGG - Intergenic
1160379817 18:78445634-78445656 ATGTTTAATAAGGAGAAGGAAGG + Intergenic
1160379817 18:78445634-78445656 ATGTTTAATAAGGAGAAGGAAGG + Intergenic
1163232180 19:16012352-16012374 CTGTTTTGAAAGAAGGATCAGGG + Intergenic
1163232180 19:16012352-16012374 CTGTTTTGAAAGAAGGATCAGGG + Intergenic
1163431121 19:17268403-17268425 TTGGTTACTAAGAAGGAAGAGGG - Intronic
1163431121 19:17268403-17268425 TTGGTTACTAAGAAGGAAGAGGG - Intronic
1167943180 19:52963584-52963606 TTGTTTATTGAGACGGAGGAGGG - Intergenic
1167943180 19:52963584-52963606 TTGTTTATTGAGACGGAGGAGGG - Intergenic
926339877 2:11896133-11896155 TGGTGTAGGAAGAAGGAGGATGG + Intergenic
926339877 2:11896133-11896155 TGGTGTAGGAAGAAGGAGGATGG + Intergenic
926889151 2:17624622-17624644 CTGCTTTTGAAGAAGGAGGAAGG + Intronic
926889151 2:17624622-17624644 CTGCTTTTGAAGAAGGAGGAAGG + Intronic
929184108 2:39075226-39075248 CTGTTAAGGTAGAAGGAGGTAGG + Intronic
929184108 2:39075226-39075248 CTGTTAAGGTAGAAGGAGGTAGG + Intronic
931593544 2:63913993-63914015 CTGTGGAGTAAGAAGGAAGCAGG + Intronic
931593544 2:63913993-63914015 CTGTGGAGTAAGAAGGAAGCAGG + Intronic
932102663 2:68914823-68914845 CAGATTAGAAAGCAGGAGGAGGG - Intergenic
932102663 2:68914823-68914845 CAGATTAGAAAGCAGGAGGAGGG - Intergenic
933003671 2:76960120-76960142 CTGTTTGGTAATTAGGATGATGG - Intronic
933003671 2:76960120-76960142 CTGTTTGGTAATTAGGATGATGG - Intronic
933311341 2:80665407-80665429 CTGTGTATTAAGAAGCTGGAGGG + Intergenic
933311341 2:80665407-80665429 CTGTGTATTAAGAAGCTGGAGGG + Intergenic
934536896 2:95141591-95141613 CTGTTTAGGAAGATGCGGGAAGG - Intronic
934536896 2:95141591-95141613 CTGTTTAGGAAGATGCGGGAAGG - Intronic
938625623 2:133105978-133106000 GGGTTTAGGTAGAAGGAGGATGG - Intronic
938625623 2:133105978-133106000 GGGTTTAGGTAGAAGGAGGATGG - Intronic
939548797 2:143588020-143588042 CTGTTTGGAAAGAAGGAAGAGGG - Intronic
939548797 2:143588020-143588042 CTGTTTGGAAAGAAGGAAGAGGG - Intronic
941892722 2:170598377-170598399 CTGTTTATTCAGATGGAGGCAGG - Intronic
941892722 2:170598377-170598399 CTGTTTATTCAGATGGAGGCAGG - Intronic
941918779 2:170829074-170829096 CTGTATAAGCAGAAGGAGGAGGG - Intronic
941918779 2:170829074-170829096 CTGTATAAGCAGAAGGAGGAGGG - Intronic
942455133 2:176132788-176132810 CTGTTTAATAAGAAAGGGGTGGG + Intergenic
942455133 2:176132788-176132810 CTGTTTAATAAGAAAGGGGTGGG + Intergenic
942833633 2:180266038-180266060 CTGATTTCTAAGAAGAAGGAGGG + Intergenic
942833633 2:180266038-180266060 CTGATTTCTAAGAAGAAGGAGGG + Intergenic
942961039 2:181829937-181829959 CTGTTGGGAGAGAAGGAGGAGGG - Intergenic
942961039 2:181829937-181829959 CTGTTGGGAGAGAAGGAGGAGGG - Intergenic
943290010 2:186057905-186057927 ATCTTTAGTGAGAAGGAAGATGG + Intergenic
943290010 2:186057905-186057927 ATCTTTAGTGAGAAGGAAGATGG + Intergenic
943569784 2:189559737-189559759 CTGTGTAGGAAGAAGAAGCATGG - Intergenic
943569784 2:189559737-189559759 CTGTGTAGGAAGAAGAAGCATGG - Intergenic
944880196 2:204005309-204005331 CTCTTTAGAAAGAAGCAGGATGG - Intergenic
944880196 2:204005309-204005331 CTCTTTAGAAAGAAGCAGGATGG - Intergenic
945159384 2:206873692-206873714 CTGTTTAAAGAGAAAGAGGATGG + Intergenic
945159384 2:206873692-206873714 CTGTTTAAAGAGAAAGAGGATGG + Intergenic
946081658 2:217125319-217125341 CTGTTTACTCAGAGAGAGGAAGG + Intergenic
946081658 2:217125319-217125341 CTGTTTACTCAGAGAGAGGAAGG + Intergenic
947728113 2:232412871-232412893 CTGGATTGTAAGAAGGAGGGAGG + Intergenic
947728113 2:232412871-232412893 CTGGATTGTAAGAAGGAGGGAGG + Intergenic
948732569 2:239976402-239976424 CAGTTGAGGGAGAAGGAGGATGG - Intronic
948732569 2:239976402-239976424 CAGTTGAGGGAGAAGGAGGATGG - Intronic
1169095185 20:2891474-2891496 ATGTCAAGTAAGAAGGAGGGAGG - Intronic
1169095185 20:2891474-2891496 ATGTCAAGTAAGAAGGAGGGAGG - Intronic
1169510271 20:6256309-6256331 GTGTTTAGGAAAATGGAGGAAGG + Intergenic
1169510271 20:6256309-6256331 GTGTTTAGGAAAATGGAGGAAGG + Intergenic
1170362624 20:15563284-15563306 GTCTTTCATAAGAAGGAGGATGG - Intronic
1170362624 20:15563284-15563306 GTCTTTCATAAGAAGGAGGATGG - Intronic
1170458348 20:16554093-16554115 CTGGGTAGAAAGAAGGAGGTGGG + Intronic
1170458348 20:16554093-16554115 CTGGGTAGAAAGAAGGAGGTGGG + Intronic
1170477271 20:16728385-16728407 CTGTTTGATAATAATGAGGATGG - Intergenic
1170477271 20:16728385-16728407 CTGTTTGATAATAATGAGGATGG - Intergenic
1170638823 20:18133873-18133895 TTGTTTGGGAAGAAGGTGGAGGG - Intergenic
1170638823 20:18133873-18133895 TTGTTTGGGAAGAAGGTGGAGGG - Intergenic
1174039676 20:47690072-47690094 CTGCTTAGCATGAAGGGGGAGGG - Intronic
1174039676 20:47690072-47690094 CTGCTTAGCATGAAGGGGGAGGG - Intronic
1177171302 21:17659097-17659119 CGGTTTAGTTAGATGGAGGCGGG - Intergenic
1177171302 21:17659097-17659119 CGGTTTAGTTAGATGGAGGCGGG - Intergenic
1177201281 21:17959088-17959110 TTTTTTAGAAAGCAGGAGGAAGG + Intronic
1177201281 21:17959088-17959110 TTTTTTAGAAAGCAGGAGGAAGG + Intronic
1177374193 21:20247937-20247959 ATTTTTAGCAAGAAGCAGGAAGG - Intergenic
1177374193 21:20247937-20247959 ATTTTTAGCAAGAAGCAGGAAGG - Intergenic
1179429828 21:41313349-41313371 GTGTTGAGTAAGATGGAGCAAGG - Intronic
1179429828 21:41313349-41313371 GTGTTGAGTAAGATGGAGCAAGG - Intronic
1181634594 22:24168756-24168778 CTTTTCTGTAACAAGGAGGATGG + Intronic
1181634594 22:24168756-24168778 CTTTTCTGTAACAAGGAGGATGG + Intronic
1182791109 22:32953830-32953852 ATGTTGATGAAGAAGGAGGAGGG - Intronic
1182791109 22:32953830-32953852 ATGTTGATGAAGAAGGAGGAGGG - Intronic
1183291956 22:37008147-37008169 CTGTGTAGGAAAAAGGAGGAAGG + Intergenic
1183291956 22:37008147-37008169 CTGTGTAGGAAAAAGGAGGAAGG + Intergenic
1183762150 22:39831386-39831408 CTGTTAAGCAGGAAGGAGAAAGG + Intronic
1183762150 22:39831386-39831408 CTGTTAAGCAGGAAGGAGAAAGG + Intronic
949108921 3:235144-235166 ATGTTTAGAAAGAGGGGGGAGGG - Intronic
949108921 3:235144-235166 ATGTTTAGAAAGAGGGGGGAGGG - Intronic
949192343 3:1265447-1265469 CTCTTGAGTAAGAACCAGGATGG - Intronic
949192343 3:1265447-1265469 CTCTTGAGTAAGAACCAGGATGG - Intronic
951120438 3:18920698-18920720 CTGTGTTTTCAGAAGGAGGAAGG - Intergenic
951120438 3:18920698-18920720 CTGTGTTTTCAGAAGGAGGAAGG - Intergenic
951959413 3:28300433-28300455 CTGTTTAGTAACAACTAGGTGGG - Intronic
951959413 3:28300433-28300455 CTGTTTAGTAACAACTAGGTGGG - Intronic
952145912 3:30531719-30531741 CTGCTCAGGAATAAGGAGGATGG - Intergenic
952145912 3:30531719-30531741 CTGCTCAGGAATAAGGAGGATGG - Intergenic
952993105 3:38849737-38849759 GTGTTTTATAAGAAGGAGTATGG + Intronic
952993105 3:38849737-38849759 GTGTTTTATAAGAAGGAGTATGG + Intronic
955510922 3:59679521-59679543 GTCATGAGTAAGAAGGAGGAGGG + Intergenic
955510922 3:59679521-59679543 GTCATGAGTAAGAAGGAGGAGGG + Intergenic
955605015 3:60692270-60692292 CTATTTAGTAAGCAGGATAATGG + Intronic
955605015 3:60692270-60692292 CTATTTAGTAAGCAGGATAATGG + Intronic
958798900 3:98733570-98733592 CAGTTTAGGAGAAAGGAGGACGG + Intronic
958798900 3:98733570-98733592 CAGTTTAGGAGAAAGGAGGACGG + Intronic
958962358 3:100522409-100522431 CTGTGAATTCAGAAGGAGGATGG - Intronic
958962358 3:100522409-100522431 CTGTGAATTCAGAAGGAGGATGG - Intronic
959040189 3:101413655-101413677 CTGTTTAGCAAGAAAAAGAAAGG + Intronic
959040189 3:101413655-101413677 CTGTTTAGCAAGAAAAAGAAAGG + Intronic
959395715 3:105835406-105835428 CAGTTTAGTAGGAAGGAGAAGGG + Intronic
959395715 3:105835406-105835428 CAGTTTAGTAGGAAGGAGAAGGG + Intronic
960182944 3:114604293-114604315 CTTTTGTGTAAGAAGGTGGAAGG + Intronic
960182944 3:114604293-114604315 CTTTTGTGTAAGAAGGTGGAAGG + Intronic
960882813 3:122362929-122362951 GTGTTTGGAAAGAAGTAGGAGGG - Intronic
960882813 3:122362929-122362951 GTGTTTGGAAAGAAGTAGGAGGG - Intronic
962335078 3:134522162-134522184 CTGTTTATTGACAAGGAGAAAGG - Intronic
962335078 3:134522162-134522184 CTGTTTATTGACAAGGAGAAAGG - Intronic
963561886 3:146876088-146876110 CTGTTTGGGAAGAAGCAGCAGGG + Intergenic
963561886 3:146876088-146876110 CTGTTTGGGAAGAAGCAGCAGGG + Intergenic
963669499 3:148233791-148233813 CTTTTTAGTCAGAAAGAGGGAGG + Intergenic
963669499 3:148233791-148233813 CTTTTTAGTCAGAAAGAGGGAGG + Intergenic
963683931 3:148414203-148414225 GTGTTTAGTAAGAAGAATCAAGG - Intergenic
963683931 3:148414203-148414225 GTGTTTAGTAAGAAGAATCAAGG - Intergenic
964551355 3:157888339-157888361 CTGTTGAGTAAGAGGGATAATGG - Intergenic
964551355 3:157888339-157888361 CTGTTGAGTAAGAGGGATAATGG - Intergenic
964726894 3:159822904-159822926 CTGTTTGGCAAGAGGGAGGTGGG + Intronic
964726894 3:159822904-159822926 CTGTTTGGCAAGAGGGAGGTGGG + Intronic
965859101 3:173125386-173125408 GTCTTTAGTAAGAATGAGGTGGG - Intronic
965859101 3:173125386-173125408 GTCTTTAGTAAGAATGAGGTGGG - Intronic
966354870 3:179069231-179069253 TTATTTGTTAAGAAGGAGGAGGG - Intronic
966354870 3:179069231-179069253 TTATTTGTTAAGAAGGAGGAGGG - Intronic
966670957 3:182525345-182525367 CTCTTTAGTAACTAGGAGGAGGG - Intergenic
966670957 3:182525345-182525367 CTCTTTAGTAACTAGGAGGAGGG - Intergenic
967258905 3:187622414-187622436 CTGTCTAGGGAGATGGAGGATGG - Intergenic
967258905 3:187622414-187622436 CTGTCTAGGGAGATGGAGGATGG - Intergenic
967465943 3:189806251-189806273 CTGTGTAGCTAGAAGCAGGAGGG + Intronic
967465943 3:189806251-189806273 CTGTGTAGCTAGAAGCAGGAGGG + Intronic
968075825 3:195815767-195815789 CTGTGTAAGAAGAAGGAGGCCGG - Intergenic
968075825 3:195815767-195815789 CTGTGTAAGAAGAAGGAGGCCGG - Intergenic
969309065 4:6341697-6341719 CTGTATAGGAGGAAGAAGGAAGG + Intronic
969309065 4:6341697-6341719 CTGTATAGGAGGAAGAAGGAAGG + Intronic
971555129 4:28003739-28003761 CTGTGTGGTAAGTAGGAGCATGG + Intergenic
971555129 4:28003739-28003761 CTGTGTGGTAAGTAGGAGCATGG + Intergenic
972631603 4:40846804-40846826 CTGCTTACTAATGAGGAGGAGGG + Intronic
972631603 4:40846804-40846826 CTGCTTACTAATGAGGAGGAGGG + Intronic
972804054 4:42509362-42509384 CTGTTGAGGAAGAAGGGGGATGG + Intronic
972804054 4:42509362-42509384 CTGTTGAGGAAGAAGGGGGATGG + Intronic
975210304 4:71691915-71691937 CTGTCTAGTAAGCATGAGTATGG - Intergenic
975210304 4:71691915-71691937 CTGTCTAGTAAGCATGAGTATGG - Intergenic
975237724 4:72019727-72019749 CTGTATTGAATGAAGGAGGAAGG + Intergenic
975237724 4:72019727-72019749 CTGTATTGAATGAAGGAGGAAGG + Intergenic
975482648 4:74898729-74898751 CTGTTTAGGAAGATGTGGGAAGG + Intergenic
975482648 4:74898729-74898751 CTGTTTAGGAAGATGTGGGAAGG + Intergenic
977058535 4:92225183-92225205 CTGTTGAATAGGAAGGAGGGAGG + Intergenic
977058535 4:92225183-92225205 CTGTTGAATAGGAAGGAGGGAGG + Intergenic
977695273 4:99957780-99957802 CTGTTTAGGAAGATGTAGGGGGG + Intergenic
977695273 4:99957780-99957802 CTGTTTAGGAAGATGTAGGGGGG + Intergenic
980457451 4:133063880-133063902 CTGTTTTTTAAGAAAGAAGATGG - Intergenic
980457451 4:133063880-133063902 CTGTTTTTTAAGAAAGAAGATGG - Intergenic
981029042 4:140105535-140105557 CTGTTTTGTCAGACAGAGGATGG - Intronic
981029042 4:140105535-140105557 CTGTTTTGTCAGACAGAGGATGG - Intronic
983530696 4:168807097-168807119 CTTCTTGGTAAGCAGGAGGAAGG + Intronic
983530696 4:168807097-168807119 CTTCTTGGTAAGCAGGAGGAAGG + Intronic
983939051 4:173522827-173522849 ATGTTTAGAAAGAAGGGGGAGGG - Intergenic
983939051 4:173522827-173522849 ATGTTTAGAAAGAAGGGGGAGGG - Intergenic
984251662 4:177343330-177343352 CAGTTCAGTAAGAATGAGAAAGG + Intronic
984251662 4:177343330-177343352 CAGTTCAGTAAGAATGAGAAAGG + Intronic
985182280 4:187278375-187278397 CTGATTACAAAGAAGGAGGTAGG - Intergenic
985182280 4:187278375-187278397 CTGATTACAAAGAAGGAGGTAGG - Intergenic
985338518 4:188922075-188922097 TTGTTCAGTGAGAAGGAGGAAGG - Intergenic
985338518 4:188922075-188922097 TTGTTCAGTGAGAAGGAGGAAGG - Intergenic
985969002 5:3360666-3360688 CTGTTTGTGAAGACGGAGGAAGG + Intergenic
985969002 5:3360666-3360688 CTGTTTGTGAAGACGGAGGAAGG + Intergenic
986485870 5:8236353-8236375 CTGTTTTGGGGGAAGGAGGAGGG - Intergenic
986485870 5:8236353-8236375 CTGTTTTGGGGGAAGGAGGAGGG - Intergenic
987309645 5:16669960-16669982 TTGTTTAGAAAAAAGGAGGCAGG + Intronic
987309645 5:16669960-16669982 TTGTTTAGAAAAAAGGAGGCAGG + Intronic
989306692 5:39966038-39966060 CTGTTTAAAAAGATGCAGGAAGG - Intergenic
989306692 5:39966038-39966060 CTGTTTAAAAAGATGCAGGAAGG - Intergenic
989977763 5:50607395-50607417 CTGTTAACAAAGAAGGAAGAGGG + Intergenic
989977763 5:50607395-50607417 CTGTTAACAAAGAAGGAAGAGGG + Intergenic
990674835 5:58171963-58171985 CTGCTTATTAAGAAGGAAGTCGG - Intergenic
990674835 5:58171963-58171985 CTGCTTATTAAGAAGGAAGTCGG - Intergenic
992135171 5:73737208-73737230 CACTTTTGTAAAAAGGAGGAGGG - Intronic
992135171 5:73737208-73737230 CACTTTTGTAAAAAGGAGGAGGG - Intronic
993164584 5:84335927-84335949 CTGTTTCCTCAGATGGAGGAAGG + Intronic
993164584 5:84335927-84335949 CTGTTTCCTCAGATGGAGGAAGG + Intronic
994207200 5:97048365-97048387 CTGTCTTGGAAGATGGAGGAAGG + Intergenic
994207200 5:97048365-97048387 CTGTCTTGGAAGATGGAGGAAGG + Intergenic
995021748 5:107374384-107374406 CTGTTTGGAAAGGAGGAGGTGGG + Intergenic
995021748 5:107374384-107374406 CTGTTTGGAAAGGAGGAGGTGGG + Intergenic
995734413 5:115284208-115284230 CTGGTTAGTAAGAAGAACAATGG + Intronic
995734413 5:115284208-115284230 CTGGTTAGTAAGAAGAACAATGG + Intronic
996413454 5:123183802-123183824 CTGTTTAGTAAGAAGGAGGAAGG - Intronic
996413454 5:123183802-123183824 CTGTTTAGTAAGAAGGAGGAAGG - Intronic
996490278 5:124086602-124086624 CAGTTTCCCAAGAAGGAGGAAGG - Intergenic
996490278 5:124086602-124086624 CAGTTTCCCAAGAAGGAGGAAGG - Intergenic
996755495 5:126930711-126930733 CTTATTAGTGAGAAGAAGGAAGG - Intronic
996755495 5:126930711-126930733 CTTATTAGTGAGAAGAAGGAAGG - Intronic
996761255 5:126988057-126988079 CTGTCTAGAAAGAACTAGGAGGG + Intronic
996761255 5:126988057-126988079 CTGTCTAGAAAGAACTAGGAGGG + Intronic
997678757 5:135734524-135734546 CTATTTATTAAGAAGGGGAAGGG + Intergenic
997678757 5:135734524-135734546 CTATTTATTAAGAAGGGGAAGGG + Intergenic
998138546 5:139687315-139687337 CTGTGCAGGAAGAAGGAAGAAGG + Intergenic
998138546 5:139687315-139687337 CTGTGCAGGAAGAAGGAAGAAGG + Intergenic
998179494 5:139926563-139926585 CTGCTGAGTAAGAATGAGCAGGG + Intronic
998179494 5:139926563-139926585 CTGCTGAGTAAGAATGAGCAGGG + Intronic
998874208 5:146583026-146583048 CTGATTAGTAAAAAGTAGGAAGG - Intronic
998874208 5:146583026-146583048 CTGATTAGTAAAAAGTAGGAAGG - Intronic
1000101984 5:158025030-158025052 CGTTTGTGTAAGAAGGAGGAAGG - Intergenic
1000101984 5:158025030-158025052 CGTTTGTGTAAGAAGGAGGAAGG - Intergenic
1000173358 5:158726233-158726255 CTGGTTAGTAGTAAGGAGAATGG - Intronic
1000173358 5:158726233-158726255 CTGGTTAGTAGTAAGGAGAATGG - Intronic
1000185565 5:158854671-158854693 CTCTTTAGAAGCAAGGAGGAAGG - Intronic
1000185565 5:158854671-158854693 CTCTTTAGAAGCAAGGAGGAAGG - Intronic
1000383087 5:160646610-160646632 CTGTTTATTAAGGAGGAGGCTGG + Intronic
1000383087 5:160646610-160646632 CTGTTTATTAAGGAGGAGGCTGG + Intronic
1002660214 5:180786635-180786657 CGTTTTAGGAAGAAGGAGGAAGG - Intergenic
1002660214 5:180786635-180786657 CGTTTTAGGAAGAAGGAGGAAGG - Intergenic
1002829312 6:804803-804825 CTGTTAACAAAGAAGGAGGAAGG - Intergenic
1002829312 6:804803-804825 CTGTTAACAAAGAAGGAGGAAGG - Intergenic
1004337414 6:14776940-14776962 CAGTTCAGTATAAAGGAGGAAGG - Intergenic
1004337414 6:14776940-14776962 CAGTTCAGTATAAAGGAGGAAGG - Intergenic
1006879950 6:37330897-37330919 CTGTTTGGGAGGAAGGAGGCTGG + Intronic
1006879950 6:37330897-37330919 CTGTTTGGGAGGAAGGAGGCTGG + Intronic
1007037049 6:38684971-38684993 GTGGTAAGAAAGAAGGAGGAAGG + Intronic
1007037049 6:38684971-38684993 GTGGTAAGAAAGAAGGAGGAAGG + Intronic
1008567080 6:52779678-52779700 CAGTCTAGTAAACAGGAGGAGGG - Intergenic
1008567080 6:52779678-52779700 CAGTCTAGTAAACAGGAGGAGGG - Intergenic
1008701693 6:54108076-54108098 CCGTTTAGTAATAAGGGTGACGG + Intronic
1008701693 6:54108076-54108098 CCGTTTAGTAATAAGGGTGACGG + Intronic
1010835235 6:80578939-80578961 TTTATTAGTAAGAAGGATGAAGG + Intergenic
1010835235 6:80578939-80578961 TTTATTAGTAAGAAGGATGAAGG + Intergenic
1011078617 6:83464937-83464959 CTGTGTAGTAAAAAGGCAGAGGG + Intergenic
1011078617 6:83464937-83464959 CTGTGTAGTAAAAAGGCAGAGGG + Intergenic
1013278882 6:108615954-108615976 CTATGTAGTAAGAAGGTAGAGGG - Intronic
1013278882 6:108615954-108615976 CTATGTAGTAAGAAGGTAGAGGG - Intronic
1013455009 6:110322698-110322720 CTCTTTTGAAAGAAGGAGGTGGG - Intronic
1013455009 6:110322698-110322720 CTCTTTTGAAAGAAGGAGGTGGG - Intronic
1013520425 6:110927763-110927785 TGGTTGAGTAAGTAGGAGGAGGG - Intergenic
1013520425 6:110927763-110927785 TGGTTGAGTAAGTAGGAGGAGGG - Intergenic
1014906489 6:127035783-127035805 CTTTAAAGTAAGAAGCAGGAAGG - Intergenic
1014906489 6:127035783-127035805 CTTTAAAGTAAGAAGCAGGAAGG - Intergenic
1015148516 6:130014650-130014672 CTGTTATGTGAGAAGGAGTAGGG + Intronic
1015148516 6:130014650-130014672 CTGTTATGTGAGAAGGAGTAGGG + Intronic
1016005007 6:139080173-139080195 CTTTCTAATCAGAAGGAGGAGGG + Intergenic
1016005007 6:139080173-139080195 CTTTCTAATCAGAAGGAGGAGGG + Intergenic
1016866438 6:148772347-148772369 CTGCTCAGTAAGAGGGAAGAAGG - Intronic
1016866438 6:148772347-148772369 CTGCTCAGTAAGAGGGAAGAAGG - Intronic
1018306716 6:162464898-162464920 ATATTTATTAAGAAGGAGGAGGG - Intronic
1018306716 6:162464898-162464920 ATATTTATTAAGAAGGAGGAGGG - Intronic
1018513714 6:164555136-164555158 CTGCTTAGTAGGAAGGAGGGTGG + Intergenic
1018513714 6:164555136-164555158 CTGCTTAGTAGGAAGGAGGGTGG + Intergenic
1018901640 6:168054578-168054600 ATGTTTCCTAAGAAGGAGGGTGG - Intergenic
1018901640 6:168054578-168054600 ATGTTTCCTAAGAAGGAGGGTGG - Intergenic
1019397533 7:830093-830115 CTGTTAAGGGGGAAGGAGGAAGG + Intronic
1019397533 7:830093-830115 CTGTTAAGGGGGAAGGAGGAAGG + Intronic
1019465697 7:1187317-1187339 CTGTTTAGCAAGAAGGAGGAAGG + Intergenic
1019465697 7:1187317-1187339 CTGTTTAGCAAGAAGGAGGAAGG + Intergenic
1019684234 7:2371754-2371776 CTGTTTAAAAAAAAGGGGGAAGG - Intronic
1019684234 7:2371754-2371776 CTGTTTAAAAAAAAGGGGGAAGG - Intronic
1020617124 7:10473475-10473497 GGTTTTGGTAAGAAGGAGGAAGG - Intergenic
1020617124 7:10473475-10473497 GGTTTTGGTAAGAAGGAGGAAGG - Intergenic
1020866759 7:13574090-13574112 CTATTCAGTAACAAGGCGGATGG - Intergenic
1020866759 7:13574090-13574112 CTATTCAGTAACAAGGCGGATGG - Intergenic
1023113516 7:36838105-36838127 CTGTTGAGTCAGAAAAAGGATGG + Intergenic
1023113516 7:36838105-36838127 CTGTTGAGTCAGAAAAAGGATGG + Intergenic
1023413483 7:39910387-39910409 CTGGTTAGCAAGAATGATGAAGG - Intergenic
1023413483 7:39910387-39910409 CTGGTTAGCAAGAATGATGAAGG - Intergenic
1025172417 7:56771613-56771635 CTGATTCTCAAGAAGGAGGAAGG + Intergenic
1025172417 7:56771613-56771635 CTGATTCTCAAGAAGGAGGAAGG + Intergenic
1025822870 7:64986341-64986363 CTGTTATGTAAGAGGGAGGTAGG + Intronic
1025822870 7:64986341-64986363 CTGTTATGTAAGAGGGAGGTAGG + Intronic
1026808622 7:73443861-73443883 AAGTTTGGTAAGAAGGAGGAGGG + Intronic
1026808622 7:73443861-73443883 AAGTTTGGTAAGAAGGAGGAGGG + Intronic
1029178875 7:98685090-98685112 GTGCTTAGGAAGAAGGCGGATGG + Intergenic
1029178875 7:98685090-98685112 GTGCTTAGGAAGAAGGCGGATGG + Intergenic
1029846585 7:103418182-103418204 TAATTTAGAAAGAAGGAGGAGGG - Intronic
1029846585 7:103418182-103418204 TAATTTAGAAAGAAGGAGGAGGG - Intronic
1031326719 7:120408982-120409004 ATGTTTCTTAAGAAGGAGGGAGG + Intronic
1031326719 7:120408982-120409004 ATGTTTCTTAAGAAGGAGGGAGG + Intronic
1032166999 7:129553206-129553228 TTTGTTAGTAAGAAGGAGGCAGG - Intergenic
1032166999 7:129553206-129553228 TTTGTTAGTAAGAAGGAGGCAGG - Intergenic
1032924990 7:136594013-136594035 CTGTTTCGTATGGAGGAAGAAGG - Intergenic
1032924990 7:136594013-136594035 CTGTTTCGTATGGAGGAAGAAGG - Intergenic
1033904875 7:146190821-146190843 CTGTTTAGAAAGAGAGAGAAGGG - Intronic
1033904875 7:146190821-146190843 CTGTTTAGAAAGAGAGAGAAGGG - Intronic
1035032161 7:155868442-155868464 CTGTTTAGCCAGAAGGAAGAGGG + Intergenic
1035032161 7:155868442-155868464 CTGTTTAGCCAGAAGGAAGAGGG + Intergenic
1035920407 8:3669885-3669907 ATGTTAAGAAAGAAGAAGGAAGG - Intronic
1035920407 8:3669885-3669907 ATGTTAAGAAAGAAGAAGGAAGG - Intronic
1037046591 8:14312938-14312960 CTTCTTAGTAAGAAGGTGAAGGG - Intronic
1037046591 8:14312938-14312960 CTTCTTAGTAAGAAGGTGAAGGG - Intronic
1038109540 8:24480044-24480066 CCTTTTTGTAAGAGGGAGGAAGG + Intronic
1038109540 8:24480044-24480066 CCTTTTTGTAAGAGGGAGGAAGG + Intronic
1038176872 8:25188184-25188206 TTGTTTGGTTAGATGGAGGAAGG + Intronic
1038176872 8:25188184-25188206 TTGTTTGGTTAGATGGAGGAAGG + Intronic
1038594310 8:28872619-28872641 CTAGTCAGTAGGAAGGAGGAAGG - Intronic
1038594310 8:28872619-28872641 CTAGTCAGTAGGAAGGAGGAAGG - Intronic
1039188354 8:34943187-34943209 TTGTTTAGTAAAAAGAATGATGG - Intergenic
1039188354 8:34943187-34943209 TTGTTTAGTAAAAAGAATGATGG - Intergenic
1041643980 8:60232545-60232567 CTGTTCAGAAATAAGAAGGAAGG - Intronic
1041643980 8:60232545-60232567 CTGTTCAGAAATAAGAAGGAAGG - Intronic
1041973657 8:63772795-63772817 CTTTTTAGGAAAAAAGAGGAAGG + Intergenic
1041973657 8:63772795-63772817 CTTTTTAGGAAAAAAGAGGAAGG + Intergenic
1041976608 8:63805909-63805931 GTGTTTAGTAGGAAGGAGCCAGG + Intergenic
1041976608 8:63805909-63805931 GTGTTTAGTAGGAAGGAGCCAGG + Intergenic
1042810771 8:72823040-72823062 CTGGCTCCTAAGAAGGAGGAAGG + Intronic
1042810771 8:72823040-72823062 CTGGCTCCTAAGAAGGAGGAAGG + Intronic
1043598250 8:81909132-81909154 CTGTTTAGAAACAAAAAGGAAGG + Intergenic
1043598250 8:81909132-81909154 CTGTTTAGAAACAAAAAGGAAGG + Intergenic
1043917368 8:85938490-85938512 CTGTTAAAGAAGAAAGAGGAAGG - Intergenic
1043917368 8:85938490-85938512 CTGTTAAAGAAGAAAGAGGAAGG - Intergenic
1043930744 8:86088509-86088531 CTGTTTAGGAAAGAGGAGAAGGG + Intronic
1043930744 8:86088509-86088531 CTGTTTAGGAAAGAGGAGAAGGG + Intronic
1044070850 8:87757628-87757650 CTGTTTAGTAAGAAAAGGAAAGG + Intergenic
1044070850 8:87757628-87757650 CTGTTTAGTAAGAAAAGGAAAGG + Intergenic
1044378771 8:91507010-91507032 CTCTTTTGAAAGATGGAGGAGGG - Intergenic
1044378771 8:91507010-91507032 CTCTTTTGAAAGATGGAGGAGGG - Intergenic
1044864042 8:96551894-96551916 CTGTTTAAGAAAAAGGAAGAAGG - Intronic
1044864042 8:96551894-96551916 CTGTTTAAGAAAAAGGAAGAAGG - Intronic
1044920305 8:97162999-97163021 CTTTCTAGCAAGAAGGAAGATGG - Intergenic
1044920305 8:97162999-97163021 CTTTCTAGCAAGAAGGAAGATGG - Intergenic
1045109059 8:98922015-98922037 CTCTGTAGTGAGAAGGAGAAAGG - Intronic
1045109059 8:98922015-98922037 CTCTGTAGTGAGAAGGAGAAAGG - Intronic
1045559075 8:103243644-103243666 CTGCTTAGGCAGAAGGAGCAGGG + Intergenic
1045559075 8:103243644-103243666 CTGCTTAGGCAGAAGGAGCAGGG + Intergenic
1046204508 8:110975301-110975323 CTGTTTAGAAAGATAAAGGAGGG + Intergenic
1046204508 8:110975301-110975323 CTGTTTAGAAAGATAAAGGAGGG + Intergenic
1046501415 8:115082816-115082838 CCCTTTAGGAAGACGGAGGAAGG + Intergenic
1046501415 8:115082816-115082838 CCCTTTAGGAAGACGGAGGAAGG + Intergenic
1046676146 8:117110856-117110878 CTGTAAAGCAAGAAAGAGGATGG - Intronic
1046676146 8:117110856-117110878 CTGTAAAGCAAGAAAGAGGATGG - Intronic
1046903498 8:119547109-119547131 CTGTCTTCCAAGAAGGAGGAAGG - Intergenic
1046903498 8:119547109-119547131 CTGTCTTCCAAGAAGGAGGAAGG - Intergenic
1049230675 8:141479644-141479666 GTGTTTAAGAAGGAGGAGGAGGG + Intergenic
1049230675 8:141479644-141479666 GTGTTTAAGAAGGAGGAGGAGGG + Intergenic
1049254708 8:141607655-141607677 CTGCCCAGTGAGAAGGAGGAAGG - Intergenic
1049254708 8:141607655-141607677 CTGCCCAGTGAGAAGGAGGAAGG - Intergenic
1049564249 8:143330073-143330095 TCATTTGGTAAGAAGGAGGAAGG + Intronic
1049564249 8:143330073-143330095 TCATTTGGTAAGAAGGAGGAAGG + Intronic
1049949105 9:627263-627285 TGGTTTAGGGAGAAGGAGGAGGG - Intronic
1049949105 9:627263-627285 TGGTTTAGGGAGAAGGAGGAGGG - Intronic
1050119263 9:2291595-2291617 GTATTTAGGAGGAAGGAGGAGGG - Intergenic
1050119263 9:2291595-2291617 GTATTTAGGAGGAAGGAGGAGGG - Intergenic
1050501459 9:6302457-6302479 CTGTTCATGAACAAGGAGGAAGG - Intergenic
1050501459 9:6302457-6302479 CTGTTCATGAACAAGGAGGAAGG - Intergenic
1052025430 9:23568623-23568645 TTATTTATTATGAAGGAGGATGG + Intergenic
1052025430 9:23568623-23568645 TTATTTATTATGAAGGAGGATGG + Intergenic
1052336764 9:27328219-27328241 CAGGTTAGGAAGAAGAAGGAGGG + Exonic
1052336764 9:27328219-27328241 CAGGTTAGGAAGAAGAAGGAGGG + Exonic
1055266045 9:74497366-74497388 CTGTTCAGTTACAGGGAGGAAGG - Exonic
1055266045 9:74497366-74497388 CTGTTCAGTTACAGGGAGGAAGG - Exonic
1055380147 9:75697758-75697780 TTGTTTAGTGAAAAGGATGACGG + Intergenic
1055380147 9:75697758-75697780 TTGTTTAGTGAAAAGGATGACGG + Intergenic
1057587459 9:96342531-96342553 CTCTCTAGTAAGAATGAGCAGGG - Intronic
1057587459 9:96342531-96342553 CTCTCTAGTAAGAATGAGCAGGG - Intronic
1057913562 9:99038497-99038519 CTGTTTTATAAGAAGGGGGAGGG + Intronic
1057913562 9:99038497-99038519 CTGTTTTATAAGAAGGGGGAGGG + Intronic
1058498536 9:105587289-105587311 ATGTTTGGTTAGAAGGAGGGAGG + Intronic
1058498536 9:105587289-105587311 ATGTTTGGTTAGAAGGAGGGAGG + Intronic
1058994567 9:110287161-110287183 TTCTTTAGTAAGAAGGAATAAGG + Intergenic
1058994567 9:110287161-110287183 TTCTTTAGTAAGAAGGAATAAGG + Intergenic
1059209756 9:112502089-112502111 CTGGTGAGTAGAAAGGAGGAGGG + Intronic
1059209756 9:112502089-112502111 CTGGTGAGTAGAAAGGAGGAGGG + Intronic
1061295311 9:129673861-129673883 CTGTTTAGACAGAGGGAGGTTGG + Intronic
1061295311 9:129673861-129673883 CTGTTTAGACAGAGGGAGGTTGG + Intronic
1185788162 X:2907730-2907752 CTATTCAGTGAAAAGGAGGAGGG + Intronic
1185788162 X:2907730-2907752 CTATTCAGTGAAAAGGAGGAGGG + Intronic
1186667266 X:11730285-11730307 ATATTTAGTCACAAGGAGGAAGG - Intergenic
1186667266 X:11730285-11730307 ATATTTAGTCACAAGGAGGAAGG - Intergenic
1187274891 X:17808569-17808591 CTGGGAAGTAAGAAGGAAGATGG - Intronic
1187274891 X:17808569-17808591 CTGGGAAGTAAGAAGGAAGATGG - Intronic
1188552148 X:31376179-31376201 CTGTTTTGTTAGAGGAAGGAAGG - Intronic
1188552148 X:31376179-31376201 CTGTTTTGTTAGAGGAAGGAAGG - Intronic
1188655423 X:32688525-32688547 CTGTTGTGTAAGAAGGTGAATGG + Intronic
1188655423 X:32688525-32688547 CTGTTGTGTAAGAAGGTGAATGG + Intronic
1190730027 X:53219797-53219819 CTGACTAATAAGAAGGAGCAGGG - Intronic
1190730027 X:53219797-53219819 CTGACTAATAAGAAGGAGCAGGG - Intronic
1192218786 X:69182591-69182613 GTGTTTAGGAAGAAATAGGAGGG + Intergenic
1192218786 X:69182591-69182613 GTGTTTAGGAAGAAATAGGAGGG + Intergenic
1192468027 X:71371655-71371677 CTGTTGAGTGAGAGGCAGGATGG + Intronic
1192468027 X:71371655-71371677 CTGTTGAGTGAGAGGCAGGATGG + Intronic
1192835776 X:74797870-74797892 GGGTTCAGTAAGAAGAAGGATGG + Intronic
1192835776 X:74797870-74797892 GGGTTCAGTAAGAAGAAGGATGG + Intronic
1193329657 X:80222201-80222223 CTGTTCAGGAAGCAGGGGGAAGG + Intergenic
1193329657 X:80222201-80222223 CTGTTCAGGAAGCAGGGGGAAGG + Intergenic
1194183693 X:90745079-90745101 ATTTTTAGCAAGAAGGAGAATGG - Intergenic
1194183693 X:90745079-90745101 ATTTTTAGCAAGAAGGAGAATGG - Intergenic
1194363825 X:92988942-92988964 CTGTTAAGAAAGAAGCTGGATGG - Intergenic
1194363825 X:92988942-92988964 CTGTTAAGAAAGAAGCTGGATGG - Intergenic
1194584719 X:95718200-95718222 CTGTTTAGTAACAAGAGGAAGGG + Intergenic
1194584719 X:95718200-95718222 CTGTTTAGTAACAAGAGGAAGGG + Intergenic
1196199745 X:112872102-112872124 CTGTTTACACAAAAGGAGGAGGG - Intergenic
1196199745 X:112872102-112872124 CTGTTTACACAAAAGGAGGAGGG - Intergenic
1198968807 X:142256589-142256611 CTGTTTAGAAATAAGATGGAAGG + Intergenic
1198968807 X:142256589-142256611 CTGTTTAGAAATAAGATGGAAGG + Intergenic
1199583085 X:149380261-149380283 CTGCTAAGTAAGAATGAAGAGGG + Intergenic
1199583085 X:149380261-149380283 CTGCTAAGTAAGAATGAAGAGGG + Intergenic
1200530294 Y:4327028-4327050 ATTTTTAGCAAGAAGGAGAATGG - Intergenic
1200530294 Y:4327028-4327050 ATTTTTAGCAAGAAGGAGAATGG - Intergenic
1200672057 Y:6105179-6105201 CTGTTAAGAAAGAAGCTGGATGG - Intergenic
1200672057 Y:6105179-6105201 CTGTTAAGAAAGAAGCTGGATGG - Intergenic
1201279986 Y:12333626-12333648 TTGTTTAGAAAACAGGAGGAAGG - Intergenic
1201279986 Y:12333626-12333648 TTGTTTAGAAAACAGGAGGAAGG - Intergenic