ID: 996415733

View in Genome Browser
Species Human (GRCh38)
Location 5:123208365-123208387
Sequence GCTAATCCTGCAATCATTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996415727_996415733 21 Left 996415727 5:123208321-123208343 CCAACTACAGTCCTAAGAGGACC No data
Right 996415733 5:123208365-123208387 GCTAATCCTGCAATCATTACAGG No data
996415725_996415733 24 Left 996415725 5:123208318-123208340 CCTCCAACTACAGTCCTAAGAGG No data
Right 996415733 5:123208365-123208387 GCTAATCCTGCAATCATTACAGG No data
996415730_996415733 -1 Left 996415730 5:123208343-123208365 CCGAGACTGTGTGATCCCTGTTG No data
Right 996415733 5:123208365-123208387 GCTAATCCTGCAATCATTACAGG No data
996415724_996415733 30 Left 996415724 5:123208312-123208334 CCTTCTCCTCCAACTACAGTCCT No data
Right 996415733 5:123208365-123208387 GCTAATCCTGCAATCATTACAGG No data
996415729_996415733 0 Left 996415729 5:123208342-123208364 CCCGAGACTGTGTGATCCCTGTT No data
Right 996415733 5:123208365-123208387 GCTAATCCTGCAATCATTACAGG No data
996415728_996415733 10 Left 996415728 5:123208332-123208354 CCTAAGAGGACCCGAGACTGTGT No data
Right 996415733 5:123208365-123208387 GCTAATCCTGCAATCATTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996415733 Original CRISPR GCTAATCCTGCAATCATTAC AGG Intergenic
No off target data available for this crispr