ID: 996416013

View in Genome Browser
Species Human (GRCh38)
Location 5:123211160-123211182
Sequence TTCAATCCTCAGGAAGGGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996416013_996416018 -2 Left 996416013 5:123211160-123211182 CCTACCCCTTCCTGAGGATTGAA No data
Right 996416018 5:123211181-123211203 AATATCTATCTTAATAATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996416013 Original CRISPR TTCAATCCTCAGGAAGGGGT AGG (reversed) Intergenic
No off target data available for this crispr