ID: 996417565

View in Genome Browser
Species Human (GRCh38)
Location 5:123226928-123226950
Sequence TTAACCAAGTGTCACCCTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996417565_996417569 4 Left 996417565 5:123226928-123226950 CCAAGAGGGTGACACTTGGTTAA No data
Right 996417569 5:123226955-123226977 CCCCTTTTCCATGATAACTATGG No data
996417565_996417575 26 Left 996417565 5:123226928-123226950 CCAAGAGGGTGACACTTGGTTAA No data
Right 996417575 5:123226977-123226999 GCAAAGTGGAGTGGAAGAACAGG No data
996417565_996417573 12 Left 996417565 5:123226928-123226950 CCAAGAGGGTGACACTTGGTTAA No data
Right 996417573 5:123226963-123226985 CCATGATAACTATGGCAAAGTGG No data
996417565_996417576 30 Left 996417565 5:123226928-123226950 CCAAGAGGGTGACACTTGGTTAA No data
Right 996417576 5:123226981-123227003 AGTGGAGTGGAAGAACAGGCAGG No data
996417565_996417574 17 Left 996417565 5:123226928-123226950 CCAAGAGGGTGACACTTGGTTAA No data
Right 996417574 5:123226968-123226990 ATAACTATGGCAAAGTGGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996417565 Original CRISPR TTAACCAAGTGTCACCCTCT TGG (reversed) Intergenic
No off target data available for this crispr