ID: 996417567

View in Genome Browser
Species Human (GRCh38)
Location 5:123226954-123226976
Sequence CATAGTTATCATGGAAAAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996417567_996417577 22 Left 996417567 5:123226954-123226976 CCCCCTTTTCCATGATAACTATG No data
Right 996417577 5:123226999-123227021 GCAGGTGCATCTTGAATGTGTGG No data
996417567_996417576 4 Left 996417567 5:123226954-123226976 CCCCCTTTTCCATGATAACTATG No data
Right 996417576 5:123226981-123227003 AGTGGAGTGGAAGAACAGGCAGG No data
996417567_996417574 -9 Left 996417567 5:123226954-123226976 CCCCCTTTTCCATGATAACTATG No data
Right 996417574 5:123226968-123226990 ATAACTATGGCAAAGTGGAGTGG No data
996417567_996417575 0 Left 996417567 5:123226954-123226976 CCCCCTTTTCCATGATAACTATG No data
Right 996417575 5:123226977-123226999 GCAAAGTGGAGTGGAAGAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996417567 Original CRISPR CATAGTTATCATGGAAAAGG GGG (reversed) Intergenic
No off target data available for this crispr