ID: 996417570

View in Genome Browser
Species Human (GRCh38)
Location 5:123226956-123226978
Sequence GCCATAGTTATCATGGAAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996417570_996417576 2 Left 996417570 5:123226956-123226978 CCCTTTTCCATGATAACTATGGC No data
Right 996417576 5:123226981-123227003 AGTGGAGTGGAAGAACAGGCAGG No data
996417570_996417577 20 Left 996417570 5:123226956-123226978 CCCTTTTCCATGATAACTATGGC No data
Right 996417577 5:123226999-123227021 GCAGGTGCATCTTGAATGTGTGG No data
996417570_996417575 -2 Left 996417570 5:123226956-123226978 CCCTTTTCCATGATAACTATGGC No data
Right 996417575 5:123226977-123226999 GCAAAGTGGAGTGGAAGAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996417570 Original CRISPR GCCATAGTTATCATGGAAAA GGG (reversed) Intergenic
No off target data available for this crispr