ID: 996417574

View in Genome Browser
Species Human (GRCh38)
Location 5:123226968-123226990
Sequence ATAACTATGGCAAAGTGGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996417567_996417574 -9 Left 996417567 5:123226954-123226976 CCCCCTTTTCCATGATAACTATG No data
Right 996417574 5:123226968-123226990 ATAACTATGGCAAAGTGGAGTGG No data
996417566_996417574 -8 Left 996417566 5:123226953-123226975 CCCCCCTTTTCCATGATAACTAT No data
Right 996417574 5:123226968-123226990 ATAACTATGGCAAAGTGGAGTGG No data
996417568_996417574 -10 Left 996417568 5:123226955-123226977 CCCCTTTTCCATGATAACTATGG No data
Right 996417574 5:123226968-123226990 ATAACTATGGCAAAGTGGAGTGG No data
996417564_996417574 18 Left 996417564 5:123226927-123226949 CCCAAGAGGGTGACACTTGGTTA No data
Right 996417574 5:123226968-123226990 ATAACTATGGCAAAGTGGAGTGG No data
996417565_996417574 17 Left 996417565 5:123226928-123226950 CCAAGAGGGTGACACTTGGTTAA No data
Right 996417574 5:123226968-123226990 ATAACTATGGCAAAGTGGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996417574 Original CRISPR ATAACTATGGCAAAGTGGAG TGG Intergenic
No off target data available for this crispr