ID: 996417575

View in Genome Browser
Species Human (GRCh38)
Location 5:123226977-123226999
Sequence GCAAAGTGGAGTGGAAGAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996417572_996417575 -9 Left 996417572 5:123226963-123226985 CCATGATAACTATGGCAAAGTGG No data
Right 996417575 5:123226977-123226999 GCAAAGTGGAGTGGAAGAACAGG No data
996417564_996417575 27 Left 996417564 5:123226927-123226949 CCCAAGAGGGTGACACTTGGTTA No data
Right 996417575 5:123226977-123226999 GCAAAGTGGAGTGGAAGAACAGG No data
996417570_996417575 -2 Left 996417570 5:123226956-123226978 CCCTTTTCCATGATAACTATGGC No data
Right 996417575 5:123226977-123226999 GCAAAGTGGAGTGGAAGAACAGG No data
996417571_996417575 -3 Left 996417571 5:123226957-123226979 CCTTTTCCATGATAACTATGGCA No data
Right 996417575 5:123226977-123226999 GCAAAGTGGAGTGGAAGAACAGG No data
996417567_996417575 0 Left 996417567 5:123226954-123226976 CCCCCTTTTCCATGATAACTATG No data
Right 996417575 5:123226977-123226999 GCAAAGTGGAGTGGAAGAACAGG No data
996417565_996417575 26 Left 996417565 5:123226928-123226950 CCAAGAGGGTGACACTTGGTTAA No data
Right 996417575 5:123226977-123226999 GCAAAGTGGAGTGGAAGAACAGG No data
996417566_996417575 1 Left 996417566 5:123226953-123226975 CCCCCCTTTTCCATGATAACTAT No data
Right 996417575 5:123226977-123226999 GCAAAGTGGAGTGGAAGAACAGG No data
996417568_996417575 -1 Left 996417568 5:123226955-123226977 CCCCTTTTCCATGATAACTATGG No data
Right 996417575 5:123226977-123226999 GCAAAGTGGAGTGGAAGAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996417575 Original CRISPR GCAAAGTGGAGTGGAAGAAC AGG Intergenic
No off target data available for this crispr