ID: 996417577

View in Genome Browser
Species Human (GRCh38)
Location 5:123226999-123227021
Sequence GCAGGTGCATCTTGAATGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996417570_996417577 20 Left 996417570 5:123226956-123226978 CCCTTTTCCATGATAACTATGGC No data
Right 996417577 5:123226999-123227021 GCAGGTGCATCTTGAATGTGTGG No data
996417566_996417577 23 Left 996417566 5:123226953-123226975 CCCCCCTTTTCCATGATAACTAT No data
Right 996417577 5:123226999-123227021 GCAGGTGCATCTTGAATGTGTGG No data
996417567_996417577 22 Left 996417567 5:123226954-123226976 CCCCCTTTTCCATGATAACTATG No data
Right 996417577 5:123226999-123227021 GCAGGTGCATCTTGAATGTGTGG No data
996417571_996417577 19 Left 996417571 5:123226957-123226979 CCTTTTCCATGATAACTATGGCA No data
Right 996417577 5:123226999-123227021 GCAGGTGCATCTTGAATGTGTGG No data
996417568_996417577 21 Left 996417568 5:123226955-123226977 CCCCTTTTCCATGATAACTATGG No data
Right 996417577 5:123226999-123227021 GCAGGTGCATCTTGAATGTGTGG No data
996417572_996417577 13 Left 996417572 5:123226963-123226985 CCATGATAACTATGGCAAAGTGG No data
Right 996417577 5:123226999-123227021 GCAGGTGCATCTTGAATGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996417577 Original CRISPR GCAGGTGCATCTTGAATGTG TGG Intergenic
No off target data available for this crispr