ID: 996417822

View in Genome Browser
Species Human (GRCh38)
Location 5:123229178-123229200
Sequence ATGTTGAAGGTTAGGGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996417822_996417828 14 Left 996417822 5:123229178-123229200 CCATCTTCCCTAACCTTCAACAT No data
Right 996417828 5:123229215-123229237 CATGTTTCCCATGTGAATTTAGG No data
996417822_996417831 29 Left 996417822 5:123229178-123229200 CCATCTTCCCTAACCTTCAACAT No data
Right 996417831 5:123229230-123229252 AATTTAGGAGTCAGAATCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996417822 Original CRISPR ATGTTGAAGGTTAGGGAAGA TGG (reversed) Intergenic
No off target data available for this crispr