ID: 996419624

View in Genome Browser
Species Human (GRCh38)
Location 5:123248051-123248073
Sequence ACATTTAAACAGATGAGGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996419619_996419624 13 Left 996419619 5:123248015-123248037 CCTTCAATCCACTCAAAACTCAG No data
Right 996419624 5:123248051-123248073 ACATTTAAACAGATGAGGAAAGG No data
996419621_996419624 5 Left 996419621 5:123248023-123248045 CCACTCAAAACTCAGTGAGGCTT No data
Right 996419624 5:123248051-123248073 ACATTTAAACAGATGAGGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996419624 Original CRISPR ACATTTAAACAGATGAGGAA AGG Intergenic
No off target data available for this crispr