ID: 996419876

View in Genome Browser
Species Human (GRCh38)
Location 5:123250942-123250964
Sequence GTGTTACACTTTAAGTTCTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996419874_996419876 5 Left 996419874 5:123250914-123250936 CCACATTTTCTTTTTTTAATTTT No data
Right 996419876 5:123250942-123250964 GTGTTACACTTTAAGTTCTAGGG No data
996419873_996419876 21 Left 996419873 5:123250898-123250920 CCATGGTGTATATGTGCCACATT 0: 20686
1: 12735
2: 9454
3: 7765
4: 6466
Right 996419876 5:123250942-123250964 GTGTTACACTTTAAGTTCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996419876 Original CRISPR GTGTTACACTTTAAGTTCTA GGG Intergenic
No off target data available for this crispr