ID: 996423789

View in Genome Browser
Species Human (GRCh38)
Location 5:123290893-123290915
Sequence CTGCAATGAAGTCTCAATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996423789_996423791 -5 Left 996423789 5:123290893-123290915 CCTCCATTGAGACTTCATTGCAG No data
Right 996423791 5:123290911-123290933 TGCAGCTAATATTCTCCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996423789 Original CRISPR CTGCAATGAAGTCTCAATGG AGG (reversed) Intergenic
No off target data available for this crispr