ID: 996423790

View in Genome Browser
Species Human (GRCh38)
Location 5:123290896-123290918
Sequence TAGCTGCAATGAAGTCTCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996423790_996423791 -8 Left 996423790 5:123290896-123290918 CCATTGAGACTTCATTGCAGCTA No data
Right 996423791 5:123290911-123290933 TGCAGCTAATATTCTCCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996423790 Original CRISPR TAGCTGCAATGAAGTCTCAA TGG (reversed) Intergenic
No off target data available for this crispr