ID: 996423791

View in Genome Browser
Species Human (GRCh38)
Location 5:123290911-123290933
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996423783_996423791 23 Left 996423783 5:123290865-123290887 CCCAGTCTCCGCAATCCCATGGC No data
Right 996423791 5:123290911-123290933 TGCAGCTAATATTCTCCCTCTGG No data
996423780_996423791 30 Left 996423780 5:123290858-123290880 CCCGTATCCCAGTCTCCGCAATC No data
Right 996423791 5:123290911-123290933 TGCAGCTAATATTCTCCCTCTGG No data
996423781_996423791 29 Left 996423781 5:123290859-123290881 CCGTATCCCAGTCTCCGCAATCC No data
Right 996423791 5:123290911-123290933 TGCAGCTAATATTCTCCCTCTGG No data
996423789_996423791 -5 Left 996423789 5:123290893-123290915 CCTCCATTGAGACTTCATTGCAG No data
Right 996423791 5:123290911-123290933 TGCAGCTAATATTCTCCCTCTGG No data
996423786_996423791 15 Left 996423786 5:123290873-123290895 CCGCAATCCCATGGCTGAGGCCT No data
Right 996423791 5:123290911-123290933 TGCAGCTAATATTCTCCCTCTGG No data
996423788_996423791 7 Left 996423788 5:123290881-123290903 CCATGGCTGAGGCCTCCATTGAG No data
Right 996423791 5:123290911-123290933 TGCAGCTAATATTCTCCCTCTGG No data
996423784_996423791 22 Left 996423784 5:123290866-123290888 CCAGTCTCCGCAATCCCATGGCT No data
Right 996423791 5:123290911-123290933 TGCAGCTAATATTCTCCCTCTGG No data
996423790_996423791 -8 Left 996423790 5:123290896-123290918 CCATTGAGACTTCATTGCAGCTA No data
Right 996423791 5:123290911-123290933 TGCAGCTAATATTCTCCCTCTGG No data
996423787_996423791 8 Left 996423787 5:123290880-123290902 CCCATGGCTGAGGCCTCCATTGA No data
Right 996423791 5:123290911-123290933 TGCAGCTAATATTCTCCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type