ID: 996427345

View in Genome Browser
Species Human (GRCh38)
Location 5:123329258-123329280
Sequence TTGGTGTTCCTGAGGAAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996427345_996427349 -7 Left 996427345 5:123329258-123329280 CCCTTCTTCCTCAGGAACACCAA No data
Right 996427349 5:123329274-123329296 ACACCAATTATTCTTAGGTTTGG 0: 265
1: 423
2: 482
3: 512
4: 1196
996427345_996427351 24 Left 996427345 5:123329258-123329280 CCCTTCTTCCTCAGGAACACCAA No data
Right 996427351 5:123329305-123329327 CATAATCCCAAATTTCTTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996427345 Original CRISPR TTGGTGTTCCTGAGGAAGAA GGG (reversed) Intergenic
No off target data available for this crispr