ID: 996435737

View in Genome Browser
Species Human (GRCh38)
Location 5:123430857-123430879
Sequence GGCGCTCGTCGAGGAGGCTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996435737_996435754 25 Left 996435737 5:123430857-123430879 CCCGAGCCTCCTCGACGAGCGCC No data
Right 996435754 5:123430905-123430927 CCATCGGCGCCCAGTCCCAAGGG No data
996435737_996435752 24 Left 996435737 5:123430857-123430879 CCCGAGCCTCCTCGACGAGCGCC No data
Right 996435752 5:123430904-123430926 CCCATCGGCGCCCAGTCCCAAGG No data
996435737_996435741 -7 Left 996435737 5:123430857-123430879 CCCGAGCCTCCTCGACGAGCGCC No data
Right 996435741 5:123430873-123430895 GAGCGCCACCCCCTGCTCCACGG 0: 101
1: 471
2: 448
3: 313
4: 415
996435737_996435747 9 Left 996435737 5:123430857-123430879 CCCGAGCCTCCTCGACGAGCGCC No data
Right 996435747 5:123430889-123430911 TCCACGGCGCCCAGTCCCATCGG 0: 3
1: 7
2: 4
3: 6
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996435737 Original CRISPR GGCGCTCGTCGAGGAGGCTC GGG (reversed) Intergenic
No off target data available for this crispr