ID: 996435738

View in Genome Browser
Species Human (GRCh38)
Location 5:123430858-123430880
Sequence TGGCGCTCGTCGAGGAGGCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996435738_996435754 24 Left 996435738 5:123430858-123430880 CCGAGCCTCCTCGACGAGCGCCA No data
Right 996435754 5:123430905-123430927 CCATCGGCGCCCAGTCCCAAGGG No data
996435738_996435752 23 Left 996435738 5:123430858-123430880 CCGAGCCTCCTCGACGAGCGCCA No data
Right 996435752 5:123430904-123430926 CCCATCGGCGCCCAGTCCCAAGG No data
996435738_996435741 -8 Left 996435738 5:123430858-123430880 CCGAGCCTCCTCGACGAGCGCCA No data
Right 996435741 5:123430873-123430895 GAGCGCCACCCCCTGCTCCACGG 0: 101
1: 471
2: 448
3: 313
4: 415
996435738_996435747 8 Left 996435738 5:123430858-123430880 CCGAGCCTCCTCGACGAGCGCCA No data
Right 996435747 5:123430889-123430911 TCCACGGCGCCCAGTCCCATCGG 0: 3
1: 7
2: 4
3: 6
4: 130
996435738_996435755 30 Left 996435738 5:123430858-123430880 CCGAGCCTCCTCGACGAGCGCCA No data
Right 996435755 5:123430911-123430933 GCGCCCAGTCCCAAGGGCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996435738 Original CRISPR TGGCGCTCGTCGAGGAGGCT CGG (reversed) Intergenic
No off target data available for this crispr