ID: 996435739

View in Genome Browser
Species Human (GRCh38)
Location 5:123430863-123430885
Sequence GGGGGTGGCGCTCGTCGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996435739_996435752 18 Left 996435739 5:123430863-123430885 CCTCCTCGACGAGCGCCACCCCC No data
Right 996435752 5:123430904-123430926 CCCATCGGCGCCCAGTCCCAAGG No data
996435739_996435747 3 Left 996435739 5:123430863-123430885 CCTCCTCGACGAGCGCCACCCCC No data
Right 996435747 5:123430889-123430911 TCCACGGCGCCCAGTCCCATCGG 0: 3
1: 7
2: 4
3: 6
4: 130
996435739_996435755 25 Left 996435739 5:123430863-123430885 CCTCCTCGACGAGCGCCACCCCC No data
Right 996435755 5:123430911-123430933 GCGCCCAGTCCCAAGGGCTGAGG No data
996435739_996435754 19 Left 996435739 5:123430863-123430885 CCTCCTCGACGAGCGCCACCCCC No data
Right 996435754 5:123430905-123430927 CCATCGGCGCCCAGTCCCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996435739 Original CRISPR GGGGGTGGCGCTCGTCGAGG AGG (reversed) Intergenic
No off target data available for this crispr