ID: 996435740

View in Genome Browser
Species Human (GRCh38)
Location 5:123430866-123430888
Sequence GCAGGGGGTGGCGCTCGTCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1840
Summary {0: 61, 1: 283, 2: 492, 3: 471, 4: 533}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996435740_996435747 0 Left 996435740 5:123430866-123430888 CCTCGACGAGCGCCACCCCCTGC 0: 61
1: 283
2: 492
3: 471
4: 533
Right 996435747 5:123430889-123430911 TCCACGGCGCCCAGTCCCATCGG 0: 3
1: 7
2: 4
3: 6
4: 130
996435740_996435759 30 Left 996435740 5:123430866-123430888 CCTCGACGAGCGCCACCCCCTGC 0: 61
1: 283
2: 492
3: 471
4: 533
Right 996435759 5:123430919-123430941 TCCCAAGGGCTGAGGAGTGCGGG 0: 11
1: 755
2: 636
3: 267
4: 412
996435740_996435754 16 Left 996435740 5:123430866-123430888 CCTCGACGAGCGCCACCCCCTGC 0: 61
1: 283
2: 492
3: 471
4: 533
Right 996435754 5:123430905-123430927 CCATCGGCGCCCAGTCCCAAGGG No data
996435740_996435755 22 Left 996435740 5:123430866-123430888 CCTCGACGAGCGCCACCCCCTGC 0: 61
1: 283
2: 492
3: 471
4: 533
Right 996435755 5:123430911-123430933 GCGCCCAGTCCCAAGGGCTGAGG No data
996435740_996435758 29 Left 996435740 5:123430866-123430888 CCTCGACGAGCGCCACCCCCTGC 0: 61
1: 283
2: 492
3: 471
4: 533
Right 996435758 5:123430918-123430940 GTCCCAAGGGCTGAGGAGTGCGG No data
996435740_996435752 15 Left 996435740 5:123430866-123430888 CCTCGACGAGCGCCACCCCCTGC 0: 61
1: 283
2: 492
3: 471
4: 533
Right 996435752 5:123430904-123430926 CCCATCGGCGCCCAGTCCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996435740 Original CRISPR GCAGGGGGTGGCGCTCGTCG AGG (reversed) Intergenic
900113223 1:1018356-1018378 GCAGGGGGCAGCGCTCATCGGGG + Intergenic
900119193 1:1041321-1041343 GCAGGAGCTGGCACTCGCCGGGG - Exonic
900134146 1:1107078-1107100 GCAGGGGGTGGTGCCCGTTGGGG - Intronic
900253373 1:1683514-1683536 GCAGGGGGTGGCGCCCAGAGAGG - Intronic
900799177 1:4727016-4727038 GCGGGGGGTGGCCCACGCCGGGG - Intronic
901045937 1:6395819-6395841 GCAGGGGGCGGTGCTCATTGGGG + Intergenic
901145465 1:7061787-7061809 GCAGGGGGTGGCGCTGGCAGAGG + Intronic
901494552 1:9613682-9613704 GCAGGGGCTCGCGCTGGTCCTGG - Exonic
901506758 1:9689889-9689911 GCAGGGGGTTGCGTTCGCGGTGG + Intronic
901601426 1:10426404-10426426 GCAGGGGGCCACGCTCATCGGGG + Intergenic
901783387 1:11609031-11609053 GCAGGGGGCGGCGCTCGTGGGGG - Intergenic
902032574 1:13433892-13433914 GCAGGGGGCGGCTCTCATCGGGG + Intergenic
902033488 1:13439562-13439584 GCAGGGGGCCGCGCTCGTCGGGG - Intergenic
902100380 1:13983208-13983230 GCAAGGGGTGGCGCTCGTGGAGG + Intergenic
902616544 1:17626485-17626507 GCAGGGGCTGGCCCTCATCAGGG + Intronic
902963920 1:19984536-19984558 GCAGGGGATGGCGCTCGTGGGGG + Intergenic
903481532 1:23657046-23657068 GCAGGGTGTGGTGCTGGCCGTGG + Intergenic
903595424 1:24490273-24490295 GCAGGGGGCGGTGCCCGTCGGGG - Intergenic
903624647 1:24721797-24721819 GCAGGGGGCGGAGCTCGTCAGGG - Intergenic
904238849 1:29131189-29131211 GCAGGGGGCGGCGCTCGTCGGGG + Intergenic
905185947 1:36196982-36197004 ACAGGGGGTGGCACTCATCAGGG + Intergenic
905375678 1:37518567-37518589 GTAGGGGGTGGTGCTCGTCAGGG - Intergenic
905761100 1:40558927-40558949 GCAGACGGTGGCGCTCATCGGGG + Intergenic
906007351 1:42487387-42487409 CCAGGGGGTGGGGCTCTTGGAGG - Intronic
906055937 1:42917043-42917065 GCAGGGGGCGGCACCCGTCGGGG + Intergenic
906563467 1:46778563-46778585 GCAGGGGGCGGTGCTCATCTGGG + Intronic
906876190 1:49541647-49541669 GCAGGGGGCAGCGCTCCTTGGGG - Intronic
907102192 1:51847423-51847445 GCAGGGGGCGGCGCTCGTTGGGG + Intronic
907371108 1:54004268-54004290 GCAGGGGTTGGCACTCGTACAGG + Intergenic
907759463 1:57343495-57343517 GCAGGGGGCTGCGCTCATTGGGG + Intronic
907889541 1:58623746-58623768 GCAGGGGGCGGCGCTCATCGGGG - Intergenic
907980098 1:59472400-59472422 GCAGGGGGCGGCGCTCGTCAGGG - Intronic
908027706 1:59969710-59969732 GCAGGGGGCGGCGCTTATCGGGG + Intergenic
908291389 1:62670205-62670227 GCAGGGGGTGGCGCTCGTCGGGG - Intronic
908299971 1:62753746-62753768 GCAGGGGGTGGCACCCATTGGGG - Intergenic
908643362 1:66249662-66249684 GCAGGGGGTGGGGCGGGTGGTGG - Intronic
908888638 1:68818027-68818049 GCAGGGGGTGGCGCTCGTCCGGG - Intergenic
909317983 1:74247945-74247967 GCAGGGGGTGGTGCCCGTCGGGG + Intronic
909377028 1:74952092-74952114 GCAGGGGGTGGCGCTCGTCGGGG + Intergenic
909608689 1:77531799-77531821 GCAGGGGGCTGCGCTCGTCGGGG + Intronic
909782236 1:79561574-79561596 GCAGGGGGCGGCACCCGTTGGGG + Intergenic
909820447 1:80053539-80053561 GCAGGTGGCGGCGCTCTTTGGGG + Intergenic
909904517 1:81178652-81178674 GCAGGGGGTGGTGCTCGTCAGGG + Intergenic
910034721 1:82776827-82776849 GCAGGGGGTGGTGCTCGTCCGGG + Intergenic
910478780 1:87636274-87636296 GCAGGGGGTGGTACTCGTCCAGG + Intergenic
910550343 1:88467386-88467408 GCAGGGGGCGGCGCTCGTCCAGG - Intergenic
910609709 1:89128086-89128108 GCAGGGGGTGGTGCTTGTCGGGG + Intronic
910625518 1:89302866-89302888 GCAGGGGGTGGTGCCCCTAGGGG + Intergenic
910693100 1:89984707-89984729 GCAGGGGGCTGCGCTCCTCGGGG + Intergenic
911001491 1:93170544-93170566 GCAGGGAGTGGCGCTCTTCGGGG - Intronic
911259550 1:95669673-95669695 GCAGGGGGTGGCACTCGTGGAGG + Intergenic
911305188 1:96224383-96224405 GCAGGGGGTGGTGCTCGTTGGGG + Intergenic
911839201 1:102660057-102660079 GCAGGGGGCGGCGCTCGTCGGGG + Intergenic
911853992 1:102854091-102854113 GCAGGGGGCGGCGCCCATCGGGG - Intergenic
911954450 1:104217489-104217511 GTAGGGGGTGGTGCTCGTCCGGG + Intergenic
912058077 1:105631280-105631302 GCAGGGGGTGGTGCTAGTAGGGG + Intergenic
912166203 1:107045084-107045106 GCAGGGGGCGGCGCTCATCGGGG - Intergenic
912312831 1:108640914-108640936 GTAGGGGGTGGTGCTCGTCGGGG + Intronic
912517608 1:110226060-110226082 GCAGGGCCCGGCGCTCCTCGGGG - Exonic
912538708 1:110396374-110396396 GCAGGGGGCGGTGCTCGTCAGGG + Intergenic
912819325 1:112854558-112854580 GCAGGGGGCGGCGCTCATCGGGG + Intergenic
913161016 1:116146599-116146621 GCAGGGGGCGGCACTCGTCGGGG + Intergenic
913178600 1:116298009-116298031 GCAGGGGGTGGGGCCGGTCGGGG + Intergenic
913469043 1:119171820-119171842 GCAGGGGGCGGCGCTCGTCAGGG - Intergenic
913470231 1:119179339-119179361 GCAGAGGGTGGTGCTCGTCGGGG - Intergenic
913486149 1:119334021-119334043 GCAGGGGGCGGTGCTCCTCGGGG - Intergenic
913692067 1:121289149-121289171 GCAGGGGGTGGTGCTCGTCGGGG + Intronic
913987140 1:143575370-143575392 GCAGGAGGCGGCGCTCCTTGGGG - Intergenic
914145491 1:144990965-144990987 GCAGGGGGTGGTGCTCGTCGGGG - Intronic
914203382 1:145505915-145505937 GCAGGGGGCGGCGCTCATCGGGG + Intergenic
914438392 1:147680811-147680833 GCAGGGGGCGGCACTCATCGGGG + Intergenic
914482504 1:148079069-148079091 GCAGGGGGCGGCGCTCATCGGGG + Intergenic
915172291 1:153986389-153986411 GCAGGGGGTGGAGCCCGGAGGGG - Intergenic
915242281 1:154532134-154532156 GCAGGGGGCGTTGCTCATCGGGG + Intronic
915260109 1:154671077-154671099 GCAGGGGGCGGTGCTCATCGGGG - Intergenic
915261279 1:154678364-154678386 GCAGGGGGCGGTGCTCATCGGGG - Intergenic
915764443 1:158349034-158349056 GCAGGGGGCTGCGCTCATCGGGG + Intergenic
915767114 1:158374200-158374222 GCAGGAGGTGGTGCTCGTCAGGG + Intergenic
915865505 1:159494653-159494675 GCAGGGGGCGGCACTCATTGGGG + Intergenic
916219914 1:162433467-162433489 GCAGGGGGCGGCGCTCGTCGGGG - Intergenic
916749821 1:167713988-167714010 GCTGGCGGTGGCGCTGGTCTAGG - Intergenic
916910067 1:169337120-169337142 GCAGGGGGCGGCGCTTGTAGGGG + Intronic
916940109 1:169668326-169668348 GCAGGGGGCAGCGCTCGTCGGGG - Intronic
916960329 1:169882425-169882447 GCAGGGGGCGGCGCTGGTCAGGG - Intronic
917348824 1:174056454-174056476 GCAGGGGGCGGCTCTGGTCGGGG + Intergenic
917406189 1:174710914-174710936 GCAGGGGGCGGTGCTCATCGGGG + Intronic
917445363 1:175102345-175102367 GCAGGGGATGGTATTCGTCGGGG + Intronic
917578502 1:176349312-176349334 GCAGGGGGCGGCGCTCGTCGAGG + Intergenic
917604912 1:176617322-176617344 GCAGGAGGTGGCGGTGGTTGTGG + Intronic
918002289 1:180508919-180508941 GCAGGGGGCGGCACTCGTTGGGG - Intergenic
918511974 1:185321760-185321782 GCAGGGGGCGGCGCTCGTGGGGG + Intergenic
918542646 1:185648977-185648999 GCAGGGGGCAGTGCCCGTCGGGG + Intergenic
918659716 1:187073861-187073883 GCAGGGGGCGGCGCTCCTCAGGG + Intergenic
918708987 1:187703935-187703957 GCAGGGGGCGGCGCTCATCGGGG - Intergenic
918720879 1:187850517-187850539 GCAGGGGGAGGCGCTCATTGGGG - Intergenic
918791991 1:188841220-188841242 GCAGGGGGCGGCGCTCATCTGGG + Intergenic
918853164 1:189718344-189718366 GCAGGGGGCAGCGCTCCTAGGGG + Intergenic
918952040 1:191151697-191151719 GCAGGGGGCGACACTAGTCGGGG - Intergenic
918993932 1:191732086-191732108 GCAGGGGGCGGCGCTCCTCAGGG - Intergenic
919167906 1:193918957-193918979 GCAGGGGGTGGTGCTCATCGGGG + Intergenic
919201304 1:194358315-194358337 GCAGGTGGCGGCGCTCATCCGGG + Intergenic
919237064 1:194859315-194859337 GCTGGGGGCGGCGCTTGTCGGGG - Intergenic
919250878 1:195054593-195054615 GCAGGGGGCCGTGCTCGTCGGGG - Intergenic
919297729 1:195722959-195722981 GCAGGGGGTGGTGCTCGTTGGGG + Intergenic
919419726 1:197355440-197355462 GCAGGGGGTGGTGCTCATCCTGG + Intronic
919630990 1:199959935-199959957 GCAGGGGGCGGAGCTTGTCGGGG - Intergenic
919640894 1:200042530-200042552 GCAGGGGGTGGGGCAGGTGGGGG - Intronic
920150275 1:203900554-203900576 GCAGGGGGCGGCACTCCTCGGGG - Intergenic
920479388 1:206307497-206307519 GCAGGGGGTGGTGCTCGTCGGGG + Intronic
920731324 1:208488483-208488505 GCAGGGGGCGGCGCTCGTCGGGG + Intergenic
920756726 1:208739993-208740015 GCAGGGGGTGGCGCTCCTCAGGG - Intergenic
920878409 1:209858694-209858716 GCAGGGGCCGGAGCTCCTCGGGG + Intergenic
920881985 1:209888996-209889018 GCAGGGGGCGGCGCTCGTCGGGG + Intergenic
920883104 1:209898845-209898867 GCAGGGGTTGGTGCTCGTCGGGG + Intergenic
921094359 1:211874309-211874331 GCAGGGGGCGGCGCTCATAGGGG + Intergenic
921096302 1:211889726-211889748 GCAGGGGGCGGTGCTCGTCGGGG - Intergenic
921396335 1:214673192-214673214 GCAGGGGGTGGCGCTGGTCGGGG + Intergenic
921801856 1:219410967-219410989 GCAGGGGGTGGCGCTCGTCGGGG - Intergenic
921897140 1:220412747-220412769 GCAGGGGGTGGTGCTCATCGGGG - Intergenic
921903786 1:220475714-220475736 GCAGGGGGCGGCACTCGTCGGGG + Intergenic
921983624 1:221285703-221285725 GCAGGGGGCGGCGCTCATCGGGG + Intergenic
922056874 1:222050061-222050083 GCAGGGGGCGGCGCTCATCAGGG - Intergenic
922128483 1:222753583-222753605 GCAGGAGGTGGAGATCGTTGAGG - Intergenic
922166092 1:223117007-223117029 GCAGGGGGCGGCGCCCGTTGGGG + Intronic
922306932 1:224352564-224352586 GCAGGGAGCGGCGCTCGTCGGGG + Intergenic
922417120 1:225431684-225431706 GCAGGGGGCAGCGCTCATCTGGG - Intergenic
922423258 1:225473022-225473044 GCAGGGGGTGGTGCTCCTCGGGG - Intergenic
922855841 1:228774019-228774041 GCAGGGGGCGCCGCTCATCGGGG - Intergenic
922985926 1:229865771-229865793 ATAGAGGGTGGTGCTCGTCGGGG - Intergenic
923157188 1:231289520-231289542 GCAGAGGGTGGCGCTCGTTGGGG + Intergenic
923193412 1:231641994-231642016 GCAGGGGGCGGCGCTTGTCGGGG + Intronic
923324766 1:232871489-232871511 GCAGGGGGTGGTGCTCGTCGGGG + Intergenic
923573865 1:235140609-235140631 GCAGGGGGTGGCGCTCCTCGGGG - Intronic
923810476 1:237309674-237309696 GCAGGGGGCGGCGCTTGTCGGGG + Intronic
923930032 1:238684676-238684698 GCAGGGGGCGGTGCTCGTCGGGG + Intergenic
924117569 1:240762804-240762826 GCAGGGGGCGGCGCTCCTCGGGG - Intergenic
924219189 1:241855625-241855647 GCAGGGGGTGGTGCTCGTTGGGG + Intronic
924313729 1:242774414-242774436 GCAGGGGGTGGCGCCCGTTGGGG + Intergenic
1063148901 10:3319859-3319881 GCAGTGGGCAGCGCTCGTCGGGG + Intergenic
1063300347 10:4844959-4844981 GCAGGGGGCGGTGCTCGTTGGGG + Intronic
1063318677 10:5032564-5032586 GCAGGGGGTGGTGCTCCTCAAGG + Intronic
1063321013 10:5053190-5053212 GCAGGGGGCAGCGCTCGTCAGGG + Intronic
1063322149 10:5060732-5060754 GCAGGGGGTGGCACTTGTTGGGG + Intronic
1063769745 10:9183664-9183686 GCAGGGGGCGGTGCTCGTCGGGG - Intergenic
1064197837 10:13259921-13259943 GCAGGGGGTGGTGCTCGTCGGGG - Intergenic
1064461072 10:15535252-15535274 GCAGGGGGCGGTGCGCGTCAGGG - Intronic
1064790313 10:18951324-18951346 GCAGGGGGTGGTGCTCGTTGGGG + Intergenic
1065441382 10:25756313-25756335 GCAGGGGGTGGCGCTCGTCGGGG - Intergenic
1065554954 10:26905859-26905881 GCAGGGGGTGGCTCTCGTCAGGG - Intergenic
1065743229 10:28815719-28815741 GCAGGGAGTGGCGCTCGTCGGGG + Intergenic
1065752131 10:28896865-28896887 GCAGGGGGCGGCGCTCGTCGCGG + Intergenic
1065802653 10:29366494-29366516 GTAGGGGGTGGTGCTTGTTGGGG - Intergenic
1065895930 10:30163127-30163149 GCAGGGGGCGGCGCTCGTAGGGG - Intergenic
1065981525 10:30902853-30902875 GCAGCGGGTGGTGCTCCTTGGGG + Intronic
1065983803 10:30930100-30930122 GCAGGGGGCGGTGCCCGTAGGGG + Intronic
1065995553 10:31056137-31056159 GCAGGGGGCGGTGCTCGTTGGGG - Intergenic
1066186351 10:33013607-33013629 GTAGGGGGTGGTGCTCGTCGGGG - Intergenic
1066190315 10:33049541-33049563 GCAGGTGGTGGCGCTCGTCGGGG - Intergenic
1066234093 10:33468348-33468370 GCAGGGGGTGGTGCTCGTCGGGG - Intergenic
1066235414 10:33480513-33480535 GCAGGGGGTGGTGCTCATCGGGG + Intergenic
1066293665 10:34035702-34035724 GCAGGGGGCGGCGCTCCTCGGGG - Intergenic
1066296141 10:34055830-34055852 GCAGGGGGCGGCACTCGTCAGGG - Intergenic
1066544199 10:36482043-36482065 GCAGGGGGTGGCGCTCTTCGGGG + Intergenic
1066567350 10:36734664-36734686 GCAGGGGTTGGCGCTCGTCAGGG + Intergenic
1066575520 10:36820247-36820269 GCAGGGGGTGGCACTCGTTGGGG - Intergenic
1066598245 10:37076278-37076300 GCAGGGGGTGGCACTCGTCGGGG - Intergenic
1066660925 10:37737644-37737666 GCAGGGGGCAGCGCTCGTTGGGG - Intergenic
1068211374 10:53924494-53924516 GCAGGGGGTGGTGCTCGTTGGGG - Intronic
1068374072 10:56155438-56155460 GCAGGGGGCGGCGCTCATCGGGG - Intergenic
1068554913 10:58448310-58448332 GCAGGGGGCGGCACTCCTTGGGG + Intergenic
1068792318 10:61040929-61040951 GCAGGGGGTGGTGCTCATAGGGG - Intergenic
1068820918 10:61376921-61376943 GCAGGGGGCGGCACCCGTCGGGG + Intergenic
1068863217 10:61867959-61867981 GCAGGGGGCGGTGCTCGTCGGGG - Intergenic
1068902161 10:62280693-62280715 GCAGGGGGTGGTGCTCGTTGGGG - Intergenic
1068978188 10:63033904-63033926 GCAGGGGGCGGCGCTCATCGGGG - Intergenic
1069090763 10:64196817-64196839 GCAGGGGGCGGTGCTTGTCTGGG + Intergenic
1069186477 10:65429453-65429475 GCAGGGGGTGGCGCTCGTCGGGG + Intergenic
1069215310 10:65812142-65812164 GCAGGGGGCAGCGCTTGTCTGGG + Intergenic
1069664483 10:70145647-70145669 GCAGGCGGTGAAGCGCGTCGCGG + Exonic
1069766194 10:70861958-70861980 GCAGGGAGTGGCGCTCGTCAAGG - Intronic
1069988727 10:72300918-72300940 GCAGGGGGCGGCGCTCATCGGGG - Intergenic
1069993022 10:72326269-72326291 GCAGGGGGCGGCGCTCATCGGGG - Intergenic
1070564049 10:77590326-77590348 GCAGGGGGCGGCGCTCCTCGGGG + Intronic
1070942519 10:80359542-80359564 GCAGTGGGTGGCGCTCATCAGGG + Intronic
1070968355 10:80543529-80543551 GCAGGGGGTGGCGCTCATCGGGG - Intronic
1070973430 10:80586189-80586211 GCAGGGGGCGGCGCTCGTCGTGG - Intronic
1070999188 10:80814470-80814492 GCAGGGGGCGGCACTTGTCAGGG - Intergenic
1071003807 10:80859569-80859591 GCAGGGGGTGGCGCTCGTCAGGG - Intergenic
1071037432 10:81264959-81264981 GCAGGGGGTGGTGCTCGTCGGGG + Intergenic
1071041043 10:81309120-81309142 GCAGGGGGCAGCGCTCATCGGGG + Intergenic
1071055731 10:81506088-81506110 GCAGGGGGCGGCACTCGTTGGGG - Intergenic
1071078763 10:81784533-81784555 GCAGGGGGCGGCGCTCCTTGGGG - Intergenic
1071085308 10:81862730-81862752 GCAGGGGGCGACACTCGTTGGGG + Intergenic
1071332226 10:84571512-84571534 GGAGGGGGCGGCGCTCGTCAGGG - Intergenic
1071388053 10:85141715-85141737 GCAGGGGGCAGCACTCGTCGGGG - Intergenic
1071610960 10:87031031-87031053 GCAGGGGGTGGCACCCGTCAGGG + Intergenic
1071797038 10:89018699-89018721 GCAGGGGGCGGTGATCGTTGGGG + Intergenic
1072341797 10:94459539-94459561 GCAGGCGGCGGTGCCCGTCGGGG + Intronic
1073262444 10:102200915-102200937 GCAGGGGGTGGCACCTGTCGGGG + Intergenic
1073789725 10:106928150-106928172 GCAGGCGGCGGCGCTCGTTGGGG + Intronic
1074098182 10:110331781-110331803 GCAGGGGGCGGCGCTCGTCGGGG - Intergenic
1074182985 10:111079085-111079107 GCCGGGGGAGGAGCGCGTCGGGG + Exonic
1074317045 10:112370074-112370096 GCAGGGGGCGGTGCTCGTCGGGG - Intergenic
1074317206 10:112370640-112370662 GCAGGGGCCGGTGCTTGTCGGGG - Intergenic
1074999279 10:118783218-118783240 GTAGGGGGTGGTGCTCGTCGGGG - Intergenic
1075255671 10:120924140-120924162 GCAGGGGGCGGCGCTCATCTGGG - Intergenic
1075269332 10:121035384-121035406 GCAGGGGGTGGTGCTCGTTGGGG + Intergenic
1075307666 10:121382434-121382456 GCAGGGGGCGGTGTTCGTCTGGG - Intergenic
1075375976 10:121978434-121978456 GCAGGGGGCGGCGCTCATCGGGG + Intergenic
1075504956 10:123013547-123013569 GCAGGGGGTGGCGCTCGTCGGGG + Intronic
1075537475 10:123283398-123283420 GCAGGGGGCGGCGCTCGTCGGGG + Intergenic
1076261611 10:129071397-129071419 GCAGGGGGTGGCACTCGTCGGGG + Intergenic
1076773659 10:132680968-132680990 GCAGGGGGCGGAGCTCGTCGGGG - Intronic
1076796489 10:132800990-132801012 GCAGGGGGCGGAGCTCGTCGGGG + Intergenic
1077018578 11:407434-407456 GCAGGAGGTCGCGGTCGTCCAGG + Exonic
1077578108 11:3399605-3399627 GCAGGGTGTGGCTCACGACGGGG - Intergenic
1077764637 11:5144711-5144733 GCAGGGGGCGGCGCTCGTCGGGG - Intergenic
1077805811 11:5590194-5590216 GCAGGGGGTGGCACTCGTTGGGG - Intronic
1077815647 11:5683219-5683241 GCAGGGGGCGGTGCTCGTCAGGG - Intronic
1078251852 11:9623080-9623102 GCAGAGGGTGGCGCTCGTCGGGG + Intergenic
1078301151 11:10133349-10133371 GCAGGGGGTGGTGCTTGTCGGGG + Intronic
1078377452 11:10808234-10808256 GCAGGGGCTGCCCTTCGTCGGGG - Intronic
1078743646 11:14091372-14091394 GCAGGGGGTGGTGCTCGTTGGGG + Intronic
1078795867 11:14591379-14591401 GCAGGGGGCGGCACTCATCGGGG - Intronic
1078891384 11:15561238-15561260 GCAGGGGGCGGCGGTCGTCGGGG - Intergenic
1079190942 11:18276181-18276203 GCAGGGGGCGGTGCTCGTCAGGG + Intergenic
1079555381 11:21753187-21753209 GCAGGGGGCGGTGCTCGTCGGGG + Intergenic
1079708638 11:23653232-23653254 GCAGGGGGAGGCGCTCGTAGGGG + Intergenic
1079726175 11:23883476-23883498 GCAGGGGGTGGTGCTTCTTGGGG + Intergenic
1079730520 11:23934794-23934816 GCAGGGGGTGGCATTCGTCGAGG + Intergenic
1079731707 11:23942323-23942345 GCAGGGGGTGGCGCTTGTCGAGG + Intergenic
1079756771 11:24274329-24274351 GCAGGGGGTGGCACTCGTGGGGG + Intergenic
1080107456 11:28525842-28525864 GCAGGGGGCGGCGCTTGTTGGGG + Intergenic
1080138878 11:28890924-28890946 GCAGCGGGCAGCGCTCGTGGGGG - Intergenic
1080195152 11:29600193-29600215 GCAGGGGGTGGTGCTCGTCGGGG + Intergenic
1080557646 11:33431789-33431811 GCAGGGGGCGGTGCTCATCGGGG + Intergenic
1081115305 11:39192677-39192699 GCAGGGGGCGGCACTCCTTGGGG + Intergenic
1081125108 11:39312147-39312169 GCAGGGGGTGGCGCTCGTCAGGG - Intergenic
1081126890 11:39333114-39333136 GCAGGGGGCGGTGCTTGTCGGGG + Intergenic
1081329662 11:41788270-41788292 GCAGGGGGCGGTGCTCGTTCGGG + Intergenic
1081420944 11:42874228-42874250 GCAGGGGGCGGGGCTCATCGGGG - Intergenic
1081422118 11:42881698-42881720 GCAGGGGAAGGCGCTCATCAGGG - Intergenic
1081428433 11:42950201-42950223 GCAGGGGGCGGCACTCATCGGGG - Intergenic
1082106772 11:48229224-48229246 GCAGGGAGTAGTGCTCGTAGGGG - Intergenic
1082270399 11:50164092-50164114 GCAGGGGGCGGCACTCATCGGGG + Intergenic
1082272167 11:50183589-50183611 GCAGGGTGCAGCGCTCGTTGGGG - Intergenic
1082698713 11:56401965-56401987 GCAGGGGGCGGCGCTCATCGGGG + Intergenic
1082734965 11:56845507-56845529 GCAGGGGGCGGTGCTCATCGGGG - Intergenic
1082912279 11:58390615-58390637 GCAGGCAGTGGCACTCGTGGGGG + Intergenic
1083295861 11:61715378-61715400 GCTGGAGGTGGCACTCGTGGGGG + Intronic
1083419476 11:62545204-62545226 GCAGGGTGTGGCTCCCGCCGCGG - Intronic
1083546159 11:63550520-63550542 GCAGGGGGCAGCGCTCGTCGGGG - Intergenic
1084024705 11:66440823-66440845 GCAGGGGGTGGTGCTCGTCGGGG + Intronic
1084107458 11:66989108-66989130 GCAGGGGGTGGTGCTCGTCGGGG - Intergenic
1084186690 11:67476368-67476390 GCAGGGGGCGTCGCTCGTCGCGG - Intergenic
1084210511 11:67619352-67619374 GCAGGGGGCGGCGCTCATCGGGG - Intergenic
1084240656 11:67817702-67817724 GCAGGGGGTGGTGCTCACTGGGG + Intergenic
1084259173 11:67963538-67963560 GCAGGGGGCGGTGCTCGTCGGGG - Intergenic
1085375935 11:76060880-76060902 GCAGGGGACAGTGCTCGTCGGGG - Intronic
1085447201 11:76609074-76609096 GCAGGGAGTGATGCTCGTTGGGG + Intergenic
1085671047 11:78465015-78465037 GCAGGGGGCGGCGCTCGTCAGGG + Intronic
1085687743 11:78639171-78639193 GCAGGGGGCAGCACTCATCGGGG - Intergenic
1085863183 11:80257876-80257898 GCAGGGGTCGGCGCTCGTCGGGG - Intergenic
1085982746 11:81744551-81744573 GCAGGGGGTGGCACCCGTGGGGG + Intergenic
1086034954 11:82404206-82404228 GCAGGGGGCGACGCTTGTCCGGG - Intergenic
1086210078 11:84308595-84308617 GCAGGGGGCGGCGCTGGTAGGGG + Intronic
1086397701 11:86433568-86433590 GCAGGGGGCAGCGCTTATCGGGG + Intergenic
1086449995 11:86906340-86906362 GCTGAGGGTGGCGCTGGTGGGGG - Intronic
1086552557 11:88069363-88069385 GCAGGGGTTGGTGCCCGTCGGGG - Intergenic
1087354586 11:97076915-97076937 GCATGGGGTGGTGCTCGTTGGGG - Intergenic
1087407268 11:97745660-97745682 GCAGGGGGCAGCGCTCGTCGGGG + Intergenic
1087486342 11:98763454-98763476 GCAGGGGGTGGTGCTCATCGGGG + Intergenic
1087682301 11:101231380-101231402 GCAGGGGGCGGTGCTCGTCGGGG + Intergenic
1087977214 11:104564997-104565019 GCAGGGGGCAGCGCCCGCCGGGG + Intergenic
1088481671 11:110300982-110301004 GCAGGGGGCGGCGCTCGTTGGGG + Intergenic
1088570923 11:111222292-111222314 GCAGGGGGCGGCGCTGGTCGGGG - Intergenic
1089062071 11:115633937-115633959 GCAGGGGACGGCGCTCGTCAGGG + Intergenic
1089244690 11:117110485-117110507 GCAGGGGGCGGCACTCGTCGGGG + Intergenic
1089373522 11:117978532-117978554 GCAGGGGGTGGTGCTCCACGGGG + Intergenic
1089800290 11:121021975-121021997 GCAGGGGGCGGCGCTCATCGGGG - Intergenic
1089812095 11:121140641-121140663 GCAGGGGGTGGTGCTTCCCGAGG - Intronic
1090133516 11:124170766-124170788 GCAGGGGGCGGCGCTCATCGGGG + Intergenic
1090229273 11:125089812-125089834 GCAGGGGGTGGTACTCGTCGGGG - Intronic
1090307636 11:125704747-125704769 GCAGGGGGTGGTGCTCGTCGGGG + Intergenic
1090776676 11:129971877-129971899 GCAGGGGGCGGCGCTCGTCGGGG + Intronic
1090782765 11:130021944-130021966 GCAGGGGGCGGCTCTCGTCGGGG - Intergenic
1090820483 11:130337441-130337463 GCAGGGGGTGGCGCTGGTCAGGG + Intergenic
1091201250 11:133782614-133782636 GCAGGGGGCGGCGCTCCTTGGGG - Intergenic
1091233408 11:134002934-134002956 GCGGGGGGCGGCGCTCGTCGGGG + Intergenic
1091402207 12:188162-188184 GCAGGGGGCGGCGCTGGTCGGGG + Intergenic
1092135250 12:6142512-6142534 GCAGGGGGTGGTGCTCGTCGGGG - Intergenic
1092137477 12:6159789-6159811 GCAGCGGGCGGTGCTCGTCGGGG - Intergenic
1092142061 12:6190916-6190938 GCAGGGGGCGGCGCTCATCGGGG + Intergenic
1092220333 12:6708598-6708620 GCAGGGGGCGGCGCTCATTGGGG - Intergenic
1092221448 12:6716352-6716374 ACAGGGGGCGGCGCTCGTCGGGG - Intergenic
1092256429 12:6928564-6928586 TCAGGGGGTGGGGCCCGCCGAGG + Intronic
1092272971 12:7037736-7037758 GCAGGGGGCGGCGCTCGTCGGGG - Intronic
1092336727 12:7640154-7640176 GCAGGGGGCGGCGCTCGTCGGGG - Intergenic
1092350470 12:7752114-7752136 GCAGGGGGTGGCGCTCATCGGGG + Intergenic
1092364102 12:7862501-7862523 GCAGGGGGCGGCATTCGTCGGGG - Intronic
1092366602 12:7881592-7881614 GCAGGAGGCCGCGCTTGTCGGGG - Intronic
1092410889 12:8252236-8252258 GCAGGGGGCGGTGCTCATCGGGG + Intergenic
1092430485 12:8404543-8404565 GCAGGGGGCGGTGCTCGTCGGGG - Intergenic
1092471818 12:8787582-8787604 GCAGGGGGTGGCCCTCGTCGAGG - Intergenic
1092473013 12:8795041-8795063 GCAGGGGGTGGCGCTCGTCGAGG - Intergenic
1092572371 12:9739621-9739643 GCAGGGGGCGGCGCTCATCGGGG + Intergenic
1092617104 12:10225673-10225695 GCAGGGGGTGGTGCTCGTCGGGG + Intergenic
1092732501 12:11547563-11547585 GCAGGGGGTGGCGCTTGTCGGGG - Intergenic
1092834178 12:12472479-12472501 GCAGGGGGCGGCGCTCGGGGAGG + Intergenic
1093034545 12:14320409-14320431 GCGGGGGGCGGCGGTCATCGGGG - Intergenic
1093172391 12:15874904-15874926 GCAGGGGGTGGCACTCCTCAGGG - Intronic
1093189450 12:16057690-16057712 GCAGGGGGCGGTGCTCATCAGGG - Intergenic
1093266324 12:17007939-17007961 GCAGGCGGTGGCGCTCATCGGGG - Intergenic
1093381612 12:18500460-18500482 GCAGGGGGCCGCGCTCGTAGGGG - Intronic
1093524749 12:20093366-20093388 GCAGGGGGCGGCACTCGTTGGGG + Intergenic
1093527044 12:20115275-20115297 GCAGGGGACGGTGCTCGTCGGGG + Intergenic
1093580982 12:20783825-20783847 GCAGGGGGCGGCACTCATCAGGG + Intergenic
1093652599 12:21661843-21661865 GCAGGGGGCGGCGCTCGTCCGGG - Intronic
1093653863 12:21674052-21674074 GCAGGGGGCGGTGCTCATCGGGG + Intronic
1093741323 12:22693083-22693105 GCAGGGGGCGGTGCCTGTCGGGG + Intergenic
1093793767 12:23286243-23286265 GCAGGGGGCGGCGCTCGTCGAGG - Intergenic
1093973008 12:25391744-25391766 GCAGGGGGTGGCACTCGTCACGG - Intergenic
1094327609 12:29256958-29256980 GCAGGGGGTGGCGCTCGTCGAGG - Intronic
1094405315 12:30110527-30110549 GCAGGGAGCAGCGCTCGTCGGGG + Intergenic
1094409885 12:30157175-30157197 GCAGGGGGTGGCACTCGTCGGGG - Intergenic
1094448772 12:30561948-30561970 GCAGGGGGTGGTGCTCGTCGGGG - Intergenic
1094470425 12:30796784-30796806 GCAGGGGGTTGGGGTGGTCGGGG - Intergenic
1094507143 12:31071620-31071642 TTAGGGGGCGGCGCTCGTCGGGG - Intergenic
1094589253 12:31805834-31805856 GCAGGGGGTGGTGCTCGTCGGGG + Intergenic
1094661332 12:32472607-32472629 GCAGGGGGTGGTGCTCGTCCGGG - Intronic
1094718148 12:33033976-33033998 GCAGGGGGCAGCACTCGTCAGGG + Intergenic
1094722092 12:33075619-33075641 GCAGGGGGCAGCGCTCATCTGGG - Intergenic
1094833244 12:34310008-34310030 GCAGAGGGCGGTGCTCGTCGGGG - Intergenic
1095444914 12:42273753-42273775 GCAGGGGGCAGCACTCGTTGGGG + Intronic
1095534010 12:43224595-43224617 GCAGGGGATGGCGCTCATCGGGG - Intergenic
1095587457 12:43864214-43864236 GCAGGGGGAGGTGCTGGTCGGGG - Intronic
1095642424 12:44500703-44500725 GCAGGGGGCGGCACTCATCGGGG - Intergenic
1095776749 12:46018332-46018354 GCAGTGGGTGGCGCTCATTGGGG - Intergenic
1095901591 12:47333696-47333718 GCAGGGGGCAGCGCTCATCGGGG - Intergenic
1097017873 12:56000191-56000213 GCAGGGGTCGGTGCTCCTCGGGG + Intronic
1097128890 12:56795884-56795906 GCAGGGGGTGGCGCTCGTCGGGG + Intergenic
1097212978 12:57386584-57386606 GCAGGGGGCGGCGCTCGTCAGGG - Intronic
1097253731 12:57656079-57656101 GCAGGGGGTGGCGCTCATCGGGG - Intergenic
1097664152 12:62461319-62461341 GCAGGGGGCGGTGCTCGTTGGGG + Intergenic
1097863955 12:64543569-64543591 ACAGGGGGTGGGGCTTGTCGGGG - Intergenic
1098168169 12:67719277-67719299 GCAGGGGGCGTTGCTCATCGGGG + Intergenic
1098498711 12:71166245-71166267 GAAGGGGGCGGCACTCGTCGGGG + Intronic
1098588724 12:72185361-72185383 GCAGGGGGTGGTGCTCGTCGGGG - Intronic
1098759287 12:74403262-74403284 GCAGGGGGCGGCGCTCGTCAGGG - Intergenic
1099191009 12:79561863-79561885 GCAGGGGGCGGCACCCATCGGGG - Intergenic
1099191440 12:79565269-79565291 GCAGGGGGCAGCACTCGTCGGGG - Intergenic
1099192474 12:79574187-79574209 GCAGGGGGTGGCACTCATTGGGG - Intergenic
1099228111 12:79993269-79993291 GCAGGGGGCGGCGCTTGTCGGGG + Intergenic
1099413664 12:82361460-82361482 GCAGGAGGCGGTGCTCGTTGGGG + Intronic
1099443865 12:82729039-82729061 GCAGGGGGCAGCGCTCGTCGGGG - Intronic
1099450543 12:82802083-82802105 GCAGGGGGTGGCGTTCGTGGGGG + Intronic
1099523894 12:83696340-83696362 GCAGGGGGTGGTGTTCGTCAGGG + Intergenic
1099716185 12:86296447-86296469 GCAGGGGGCGGCATTCGTCAGGG + Intronic
1100166574 12:91923953-91923975 GCAGGGGGCCGCACTCGTTGGGG + Intergenic
1100211837 12:92406563-92406585 GCAGGGGGCGGTGCTCATCGGGG + Intergenic
1100346699 12:93738568-93738590 GCAGGGGGTGGCGGTGGGAGCGG - Intronic
1100521502 12:95379900-95379922 GCAGGGGGTGGTGCTTGTTGGGG - Intronic
1100600679 12:96109177-96109199 GCAGGGGGTGGCGCTCGTCGGGG - Intergenic
1101009038 12:100430617-100430639 GCAGGGGGCGGCGCTCATCGGGG - Intergenic
1101021672 12:100559697-100559719 GCAGGGGGTGGTGCTCGTTGGGG - Intronic
1101461917 12:104905557-104905579 GCAGGGGGTGGCGCTCATCGGGG + Intronic
1101603892 12:106233335-106233357 GCAGGGGGCGGTGCTCGTCGGGG - Intergenic
1102309807 12:111835968-111835990 GCAGGGGGTGGTGCTCGTCGGGG - Intergenic
1102904057 12:116660997-116661019 GCAGGGGGCAGCGCTCGTCGGGG - Intergenic
1103146098 12:118597221-118597243 GCAGGGGGCGGCGCTCGTCGGGG + Intergenic
1103238888 12:119397759-119397781 GCAGGGGGCAGCGCCCGTCAGGG + Intronic
1103439178 12:120950371-120950393 GCAGGGGGCGGTGGTCATCGGGG + Intergenic
1103459621 12:121093580-121093602 GCAGGGGGCAGCACTTGTCGGGG + Intergenic
1103760825 12:123249363-123249385 GCAGGGGGCGGCGCCCGTCCGGG + Intronic
1103783345 12:123414158-123414180 GCAGGGGGTGGGGCTCGTGGAGG + Exonic
1103853335 12:123947276-123947298 GCAGGGAGCGGCACTGGTCGGGG - Intronic
1104344539 12:127983700-127983722 GCAGGGGGCGGCGCTTGTCGGGG - Intergenic
1104582683 12:130022370-130022392 GCAGGGGGTGGCACTCGTCGGGG - Intergenic
1104614469 12:130256699-130256721 GCAGGGGGTGGCACTCGTCGGGG + Intergenic
1104749289 12:131228127-131228149 GCAGGGGGTGGTGCTCGTCGGGG - Intergenic
1105037801 12:132939069-132939091 GCAGGGGGTGGTGCTCGTCAGGG - Intronic
1105605121 13:21920747-21920769 GCAGGGGGCTGCACTCGTCCGGG + Intergenic
1105722218 13:23127886-23127908 GCAGGGGGTGGTGCTCGTCAGGG - Intergenic
1105777597 13:23677874-23677896 GCAGGGGGCGGGGCTCCTAGGGG + Intergenic
1106221280 13:27748359-27748381 GCAGGGGGTGGCGCTCGTCGGGG + Intergenic
1106600514 13:31183097-31183119 GCAGGGGGCGGTGCTCGTCGGGG + Intergenic
1106617018 13:31339711-31339733 GCAGGGGGTGGTGCTCCTCGGGG + Intergenic
1106810995 13:33358296-33358318 GCAGGGGGTGGTGCTCCTCGGGG - Intergenic
1107259335 13:38472475-38472497 GCAGGGGATGGCGCTCGTCGGGG + Intergenic
1107590416 13:41898624-41898646 GCAGGGGGCGGCATTCGTCCGGG + Intronic
1107652624 13:42560041-42560063 GCAGGGGGCGGCGCTTATCAGGG - Intergenic
1107836162 13:44413890-44413912 GCAGGGGGCAGTGCTCCTCGGGG - Intergenic
1108099132 13:46936100-46936122 GCAGGGAGTGGTGCTCGTTGGGG + Intergenic
1108435391 13:50396904-50396926 GCAGGGGGCGGTGCTCATCGGGG - Intronic
1108469412 13:50753352-50753374 GCAGGGGGCGGCGCTCGTTGGGG + Intronic
1108643930 13:52408120-52408142 GCAGGGGGTGGTGCTCGTCAGGG + Intergenic
1108686779 13:52826571-52826593 GCAGGGGGTGGCGCCCATCAGGG - Intergenic
1108750165 13:53439963-53439985 GCAGGGGGTGGCACCTGTCAGGG - Intergenic
1108751492 13:53452439-53452461 GCAGGGGGTGGTGCTGGCTGGGG + Intergenic
1108845722 13:54676885-54676907 GCAGGAGGTGGTGCCCGTCAGGG - Intergenic
1108851569 13:54737321-54737343 GCAGGGGGTGGCGCTCGTCGGGG + Intergenic
1108856495 13:54799766-54799788 GTAGGGGGCGGCGCTCGTCTGGG + Intergenic
1108858911 13:54829545-54829567 GCAGGGGGTGGCGCTCCTCGAGG + Intergenic
1108991094 13:56659155-56659177 GCAGGGGGCAGCACCCGTCGGGG + Intergenic
1108996045 13:56735878-56735900 GCAGGGGGCGGTGCTCGTCGGGG - Intergenic
1109037688 13:57286658-57286680 GCAGGGGGCGGCGCCTGTCAGGG + Intergenic
1109110969 13:58318580-58318602 GCAGGGGGCAGCGCTCATCATGG + Intergenic
1109124672 13:58504316-58504338 GCAGGAGGCAGTGCTCGTCGGGG + Intergenic
1109124875 13:58505472-58505494 GCAGGGGGTGGCACTCGTTGGGG + Intergenic
1109141096 13:58714398-58714420 GCAGGGGCTGGCGCTCGTCAGGG - Intergenic
1109152073 13:58858901-58858923 GCAGGGGGCGGCGCTCATTGGGG + Intergenic
1109159828 13:58958227-58958249 GCAGGCGGTGGCGCTTGTCGGGG + Intergenic
1109201913 13:59440227-59440249 GAAGGGGGCGGTGCTCGTCGGGG - Intergenic
1109322106 13:60823538-60823560 GGAGGGGGTGGGGCTGGTTGGGG + Intergenic
1109364682 13:61339484-61339506 GCAGGGGGCGGCGCTCCACTGGG - Intergenic
1109441412 13:62379544-62379566 GTAGGGGGTGGTGCTCGTCTGGG - Intergenic
1109506190 13:63306047-63306069 GCAGGGGGCGGCACTCGCTGGGG - Intergenic
1109829909 13:67772982-67773004 GCAGGGGGTGGCACCTGTAGGGG + Intergenic
1109854251 13:68107764-68107786 ACAGGGGGCGGCGCTTGTCGGGG + Intergenic
1110024026 13:70511956-70511978 GCAGGGGGCGGTGCTCGTCAGGG + Intergenic
1110368914 13:74718703-74718725 GCAGGGGGTGGCACTGGTTGGGG - Intergenic
1110417526 13:75268764-75268786 GCAGGGGATGGTGCTTGTCGGGG - Intergenic
1110440249 13:75518867-75518889 GCAGGGGGTGGTGCCCGTTGGGG - Intergenic
1110497896 13:76190405-76190427 GCAGGGGGTGGTGTTCTTCTGGG - Intergenic
1110609781 13:77475541-77475563 ACAGGGGGCGGCGCTCCTCGGGG + Intergenic
1110751354 13:79119682-79119704 GCAGGGGGCGGCGCTCGTCGGGG + Intergenic
1110792352 13:79600203-79600225 GCAGGGGATGGCGCTCGTCGAGG + Intergenic
1110874317 13:80490602-80490624 GCAGGGGGCGGCGCTCATCGGGG + Intergenic
1110940248 13:81340816-81340838 GCAGGGGGCGGCGATCATCGGGG + Intergenic
1110999794 13:82164992-82165014 GCAGGGGGCGGCGCTCATCAGGG + Intergenic
1111220962 13:85205228-85205250 GCAGGGGGTGGCGCCCGTAGGGG - Intergenic
1111441950 13:88292135-88292157 GCAGGGGGCGGCGCTCATCGGGG - Intergenic
1111591074 13:90348914-90348936 GCAGGGGGCGGCGCTCATGGGGG - Intergenic
1111602769 13:90495095-90495117 GCAGGGGGTGGTGCTCGTCGGGG - Intergenic
1111747719 13:92291161-92291183 GCAGGGGGTGGCGCTCCTCGGGG - Intronic
1111748374 13:92296981-92297003 GCAGGGGGTGGTGCTCGTCGGGG - Intronic
1112077703 13:95931482-95931504 GCAGGGGGCAGCACTCGTCGGGG + Intronic
1112226552 13:97545600-97545622 GCAGGGAGCGGCGCTCCTTGGGG - Intergenic
1112427100 13:99312625-99312647 GCAGCTGGTGGCTCTCCTCGTGG - Intronic
1112518693 13:100077831-100077853 GCAGGGGGCAGCGCTCATCAGGG - Intergenic
1112533123 13:100224094-100224116 GCAGGGGGCGGCGCACATCAGGG + Intronic
1112613145 13:100976011-100976033 GCAGGGGGTGGCGCTCGTCGGGG - Intergenic
1112705898 13:102068789-102068811 CAGGGGGGTGGTGCTCGTCGGGG - Intronic
1112842731 13:103600254-103600276 GCAGGGGGCGGCGCTTGTCGGGG - Intergenic
1113371907 13:109732714-109732736 GCAGGGGGCGGCGCTCATAGGGG + Intergenic
1113482638 13:110633074-110633096 GCAGGGGGTGGTGCTCGTCGGGG + Intronic
1113506681 13:110821475-110821497 GCAGGGGGTAGTGCTCGTCGGGG - Intergenic
1113538084 13:111083917-111083939 GCAGGGGGTGGCGCTCGTCGGGG + Intergenic
1113678100 13:112222032-112222054 GCAGGGGGTAGTGCTCGTCGGGG - Intergenic
1114560263 14:23584926-23584948 GCAGGGGGTGGTGCTCGTCGGGG + Intergenic
1114593583 14:23892073-23892095 GCAGGGGGTGGTGCTCGTCGGGG - Intergenic
1114679605 14:24473422-24473444 GCAGGGGGCAGTGCTTGTCGAGG - Intergenic
1115162422 14:30410728-30410750 GCAGTGGGTGGAGCTCATGGAGG - Intergenic
1115284305 14:31700865-31700887 GCAGGGGGCAGCACCCGTCGGGG - Intronic
1115533200 14:34345851-34345873 GCAGGGGGCGGCACTCGTCGTGG + Intronic
1116114456 14:40629686-40629708 GCAGGGGGTGGCGCTCGTCGGGG + Intergenic
1116152073 14:41154291-41154313 ACAGGGGGCGGCGCCCGTCAGGG + Intergenic
1116223146 14:42113537-42113559 GCAGGGGGCGGTGCTCGTCGGGG + Intergenic
1116250991 14:42482438-42482460 GCAGGGGGCGGCGCTCCTCGGGG + Intergenic
1116297862 14:43135972-43135994 GCAGGGGGTGGTGCCTGTCAGGG + Intergenic
1116311054 14:43326918-43326940 GCAGGGGGTGGTGCTCCTTGGGG - Intergenic
1116390572 14:44385058-44385080 GCAGGGGGTGGCGTTCGTCGAGG - Intergenic
1116437649 14:44912479-44912501 GCAGGGGGCGGCGCCCGTCGGGG - Intergenic
1116452408 14:45080751-45080773 GCAGGGGGCGTCGCTCATCTGGG - Intergenic
1116624060 14:47242759-47242781 GCAGGGGGTGGTGCTCGTCGGGG - Intronic
1116657030 14:47665876-47665898 GCAGGGGGCCGCGCTCCTCAGGG - Intronic
1117077911 14:52122559-52122581 GCAGGGGGTGGCGCTTGTCAGGG - Intergenic
1117297430 14:54393024-54393046 GCAGGGAGCGGCGCCCATCGGGG + Intergenic
1117297609 14:54393755-54393777 GCAGGAGGCGGCGCTCATCGGGG - Intergenic
1117302560 14:54443367-54443389 GCAGGGGGTGGCGCTCGCTGGGG - Intergenic
1117449856 14:55839782-55839804 GCAGGGGGCGGTGCTCGTCAGGG - Intergenic
1117565678 14:56991332-56991354 GCAGGGGGCAGCGCTCATCAGGG - Intergenic
1117571880 14:57056661-57056683 GCAGGGGGTGGTGCTCGTCGGGG + Intergenic
1117837212 14:59819644-59819666 GCAGGGGACGGCGCCCGTCGGGG + Intronic
1118215325 14:63803309-63803331 GCAGGGGGTGGTGCTAGTCGGGG + Intergenic
1118558867 14:67056769-67056791 GCAGGGGGTGGCACCTGTCGTGG + Intronic
1118932467 14:70255158-70255180 GCAGGGGGCGGTGCTCGTCGAGG - Intergenic
1119027816 14:71167808-71167830 GCAGGGGGCGGCGCTCGTTGGGG - Intergenic
1119038893 14:71254613-71254635 AGCAGGGGTGGCGCTCGTCGAGG - Intergenic
1119300275 14:73566378-73566400 GCAGGGGGCGGCGCTCGTCAGGG + Intergenic
1119303640 14:73590524-73590546 GCAGGGAGCGGAGCTCGTTGAGG + Intergenic
1119486828 14:74994464-74994486 GCAGGGGGCGGCATTCGTAGGGG - Intergenic
1119673405 14:76536796-76536818 GCAGGGGGCGGCGCTCGTCGGGG + Intergenic
1119870658 14:78014025-78014047 GCAGGGGGTGCTGCTCGTCGGGG + Intergenic
1120215689 14:81679234-81679256 GCAGGGGGCGGTGCTCCTTGGGG + Intergenic
1120331027 14:83092699-83092721 GCAGGGGGCGGCGCTCGTCAGGG - Intergenic
1120439063 14:84512954-84512976 GCAGGGGGCGGCGCTCATCAGGG + Intergenic
1120632262 14:86905469-86905491 GCAGGAGGCGGCGTTCGTCCGGG + Intergenic
1120704711 14:87734776-87734798 GCAGGGGGCGGCACTCGTAGGGG + Intergenic
1120844211 14:89111963-89111985 GCAGGGAGTGGCACTCGCTGGGG - Intergenic
1121350614 14:93170162-93170184 GCAGGGGGTGGCACTCGTCGGGG + Intergenic
1122096180 14:99374740-99374762 GGAGGGGGTGGCCCGAGTCGGGG - Intergenic
1122216482 14:100208211-100208233 GCAGGGGACGGCGCTCGTCAGGG + Intergenic
1122493409 14:102135556-102135578 GCAGGAGGTGGTGCTCGTCGGGG + Intronic
1122514578 14:102298004-102298026 GCAGGGGGCGGTGCTCCTCGGGG - Intronic
1123051939 14:105548160-105548182 GCAGGGGGCAGCGCTCTTCCGGG - Intergenic
1123799189 15:23803229-23803251 GCAGGCGGCGGCGCTCATCTGGG - Intergenic
1123949084 15:25253238-25253260 GCAGGGGGCGGCACTCGTCGGGG + Intergenic
1124036404 15:26057188-26057210 GCAGGGGGCAGCGCTCATCTGGG - Intergenic
1124061544 15:26298110-26298132 GCAGGGGGCGGCGCTTGTCGGGG + Intergenic
1124114805 15:26831224-26831246 GCAGGGGGCGGCGCTCATCCGGG + Intronic
1124198547 15:27656493-27656515 GCAGGGGGCGGCACTCATTGGGG + Intergenic
1124380316 15:29159967-29159989 GCAGGAGGCGGCGCTCGCCCGGG + Intronic
1124573175 15:30884072-30884094 GCAGGGGGTGGTGCTCGTCGGGG - Intergenic
1124818433 15:33019526-33019548 GTAGGGGGCGGCGCTTGTCGGGG + Intronic
1125112263 15:36047269-36047291 GCAGGGGGCGGCATTCGTCGGGG - Intergenic
1125480243 15:40074818-40074840 GAAGGGGGCGGCATTCGTCGGGG + Intergenic
1125565708 15:40676972-40676994 GCAGGGGGCGGTGCTCATCAGGG + Intergenic
1125603130 15:40926318-40926340 TCAGGGGACGGCGCTCTTCGCGG - Intergenic
1125609743 15:40961933-40961955 GCAGGGGGCGGCGCTCGTCGGGG - Intergenic
1125631633 15:41151954-41151976 GCAGGGGGCGGCGCTCCTCCGGG - Intergenic
1125885506 15:43226633-43226655 GCAGAGGGCGGCGCTCCTTGGGG + Intergenic
1126089040 15:45035150-45035172 GCAGGGGGCGGCACTCGTCGGGG - Intronic
1126128127 15:45314408-45314430 GCAGGGGGCGGCGCTCATTGGGG - Intergenic
1126165482 15:45651057-45651079 GCAGGGGGCGGCGCCCATCAGGG + Intronic
1126639719 15:50812284-50812306 GCAGGGGGCGGCACTCGTCAGGG - Intergenic
1126997640 15:54462768-54462790 GCAGGGGGTGGCGCCCGTCAGGG - Intronic
1127211643 15:56779962-56779984 GCAGGGGGCGGCACTCGTCGGGG - Intronic
1127766018 15:62186609-62186631 GCAGGGGTGGGCGTTCGTCGGGG + Intergenic
1127916495 15:63459404-63459426 GCAGGAGGTGGTGCTCCTCAGGG - Intergenic
1127984827 15:64061201-64061223 GCAGGGGGTGGCGCTTGTCAGGG - Intronic
1128110890 15:65075340-65075362 GCAGGGGGTAGTGCTCGTCGGGG - Intronic
1128594063 15:68928999-68929021 GCAGGGAGCGGCGCTCCTCAGGG + Intronic
1128598526 15:68975714-68975736 GTAGGGGACGGCGCTCGTTGGGG + Intronic
1128669936 15:69567403-69567425 GCAGGGGGCGGCACTCATCGGGG + Intergenic
1128782834 15:70374281-70374303 GCAGTGGGTGGAGCTCCTCCTGG - Intergenic
1128813259 15:70587217-70587239 GCAGGGGGCAGCGCTCGTCGGGG + Intergenic
1129158223 15:73732230-73732252 GCAGGGGGCAGCGGTCGTCGGGG + Intergenic
1129196971 15:73974024-73974046 GCAGGGGGCGGCGCTCATCGCGG - Intergenic
1129208678 15:74052815-74052837 GCAGGGGGTGGCGCTCGTCCTGG - Intergenic
1129280350 15:74480390-74480412 GCAGGGGGCGGCGCTCATCAGGG + Intergenic
1129373969 15:75116041-75116063 GCAAGGGGTGGCGCTCCTGGGGG + Intronic
1129586802 15:76875870-76875892 GCAGGGGGCGGCGCTGGTCGAGG + Intronic
1129859214 15:78847189-78847211 GCAGGGGGCGGCGCTCCTTGGGG - Intronic
1129986938 15:79926390-79926412 GCAGGGGTCGGTGCTCGTCGGGG - Intergenic
1129997184 15:80016793-80016815 GCAGGGGGCGGCGCTCGTCGGGG - Intergenic
1130002633 15:80060140-80060162 GCTCGGGGCGGCGCGCGTCGCGG - Intronic
1130132913 15:81158937-81158959 GCAGGCGGCGGTGCTCATCGGGG - Intergenic
1131250294 15:90825789-90825811 GCAGGGAGCAGCGCTCGTCTGGG - Intergenic
1131472788 15:92711104-92711126 GCAGGGGGCGGTGCTCGTCGGGG + Intronic
1131507834 15:93032143-93032165 GCAGAGGGTGGTGCTCGTCGGGG - Intergenic
1131846067 15:96491878-96491900 GCAGGGGGCGGTGCTCGTCGGGG + Intergenic
1131892141 15:96984220-96984242 GCAGGGGGCGGCGCTGGTCAGGG + Intergenic
1131912643 15:97224562-97224584 GCACGGGGTGGCGCCCGTTGGGG - Intergenic
1131992344 15:98104310-98104332 GCAGGGAGCGGCGCTCGTCGGGG + Intergenic
1132044250 15:98550028-98550050 GCAGGGGGTGGCACTCTTCGGGG - Intergenic
1132098832 15:99008321-99008343 GCAGGGGGCGGCACTCGTGGGGG + Intergenic
1132155799 15:99494722-99494744 GCAGGGGGCGGCACTCGTCAGGG + Intergenic
1132625179 16:888159-888181 GCAGGGGGTGGAGCTCAGTGGGG + Intronic
1132836772 16:1958245-1958267 GCAGGGGGCGGCGCTCGTCGGGG + Intergenic
1132896605 16:2232259-2232281 GCAGGGGCTGGGGCTCGCAGGGG + Exonic
1133362612 16:5186409-5186431 GCAGGGAGTGGCGCTCGTTGGGG + Intergenic
1133367488 16:5222055-5222077 GCAGGGGGCGGCGCTCGTCGGGG + Intergenic
1135262079 16:20989687-20989709 GCAGGGGGTGGTGCTCGTCGGGG + Intronic
1135280900 16:21152913-21152935 GCAGGGGGTGGCGCTCGTCGGGG - Intronic
1135299349 16:21312825-21312847 GCAGGGGGTGATGCTCGTGGGGG + Intergenic
1135470179 16:22723041-22723063 GCAGGGAGCGGAGCTTGTCGGGG + Intergenic
1135751016 16:25058955-25058977 GCAGGGGGTGGTGCTCGTCAGGG + Intergenic
1135942656 16:26836143-26836165 GCAGGGGGCGGCGCTCGTCGGGG + Intergenic
1136712717 16:32253349-32253371 GCAGGGTGAGGCGCGCATCGCGG - Exonic
1136755199 16:32676080-32676102 GCAGGGTGAGGCGCGCATCGCGG + Exonic
1136812914 16:33194289-33194311 GCAGGGTGAGGCGCGCATCGCGG - Exonic
1136819390 16:33304369-33304391 GCAGGGTGAGGCGCGCATCGCGG - Exonic
1136825953 16:33360904-33360926 GCAGGGTGAGGCGCGCATCGCGG - Exonic
1136831019 16:33459675-33459697 GCAGGGTGAGGCGCGCATCGCGG - Exonic
1137066860 16:35855744-35855766 GCAGGGGGTGCCGCATGTGGGGG + Intergenic
1137300473 16:47143814-47143836 GCAGGAGGCGGCGCCCGTCGGGG - Exonic
1137426461 16:48385022-48385044 GCGGGGGGCGGCGCTCGACCGGG + Intronic
1137442555 16:48509003-48509025 GCAGGGGGCGGCGCTCGTCGGGG - Intergenic
1137945733 16:52731723-52731745 GCAGGGGGCGGCTCTCGTCGGGG - Intergenic
1138289810 16:55837055-55837077 GCAGGGGGTGGCTCTGGGGGAGG + Intergenic
1138688826 16:58749172-58749194 GCAGGGGGTGGTGCTCGTCGGGG - Intergenic
1138693557 16:58790814-58790836 GCAGGGGGCCGCGCTCATCTGGG + Intergenic
1138889828 16:61128800-61128822 GCAGGGGAGGGCGCCCGTTGGGG + Intergenic
1139051526 16:63129948-63129970 GCAGGGGGCGGCGCTCGTCCGGG - Intergenic
1139125493 16:64072373-64072395 GCAGGGGGTGGCGCTCGTCAAGG + Intergenic
1139147782 16:64344209-64344231 GCAGGGGGCGGCGCTCGTCGGGG - Intergenic
1139400269 16:66675746-66675768 GCAGTGTGTGGCGCTGGTGGAGG - Intronic
1139442352 16:66974544-66974566 GCAGGGGGCGGCGCTCCTTGGGG - Exonic
1139600329 16:67982538-67982560 ACAGGGGTTGGCGCTCGTCGGGG - Intergenic
1139603102 16:67998531-67998553 GCAGGGGGCGGCGCTCACCGGGG - Intronic
1139894478 16:70277375-70277397 GCAGGTGGTGTCACTCGTGGTGG - Intronic
1139919542 16:70450840-70450862 GCAGGGAGCGGCGCTCGTCGGGG + Intergenic
1140722474 16:77784429-77784451 GCAGGGGGTGGCGCTCGTCGGGG + Intergenic
1141465700 16:84204660-84204682 GCAGGGGGCGGTGCTCATCGGGG + Intergenic
1141714831 16:85720795-85720817 GTTGGGGGTGGCGCTGGGCGTGG + Intronic
1142129808 16:88427486-88427508 GTGGGGGGCGGCGCTCCTCGGGG - Exonic
1142350055 16:89575708-89575730 GCAGGGGGTGGGGCGCGGCCGGG - Intergenic
1202991491 16_KI270728v1_random:17259-17281 GCAGGGTGAGGCGCGCATCGCGG - Intergenic
1203057341 16_KI270728v1_random:936419-936441 GCAGGGTGAGGCGCGCATCGCGG + Intergenic
1142505714 17:361909-361931 GCAGGGGGTGGCGCTCGTCGGGG - Intronic
1143127945 17:4656594-4656616 GCAGGGGGCAGCGCTCGTCGGGG + Intergenic
1143148331 17:4790420-4790442 GCCGGGGGCGGCCCTCGCCGCGG - Intergenic
1143283407 17:5771532-5771554 GCAGGGGGCGGCGCTCGTCGGGG - Intergenic
1143321373 17:6070878-6070900 GGCGGGGGCGGCGCTCGGCGCGG + Intronic
1143460473 17:7100639-7100661 GCAGGGGGCGGCGCTGGTCGGGG + Intergenic
1143550461 17:7627478-7627500 GCAGGGGGAGGGGCTCGCCTTGG - Intronic
1143552773 17:7641152-7641174 GCAGGGGGTGGCGCTCCTCAGGG - Intergenic
1143708607 17:8718122-8718144 GCAGGGGGCGGCTCTTGTCGGGG + Intergenic
1144467196 17:15506004-15506026 GCAGGGGGTGGCGCTCGTCGGGG - Intronic
1144723253 17:17486669-17486691 GCAGGGGGTGGTGCTCGTCAGGG - Intronic
1144804630 17:17956541-17956563 GCAGGGGTTTGCGCTCCTTGGGG + Intronic
1145050251 17:19654357-19654379 GCAGGGGGCGGCGCCCATCAGGG + Intronic
1146740418 17:35278959-35278981 GCAGGGGATGGCGCTCGTCGGGG + Intergenic
1147373669 17:40011249-40011271 GCAGGGGGTGGTGCTCGTCGGGG - Intergenic
1147431864 17:40376146-40376168 GCAGGAGGCAGTGCTCGTCGAGG - Intergenic
1147805398 17:43127136-43127158 GCAGGGGGCGGTGCCCGTCGGGG - Intergenic
1147997580 17:44369119-44369141 GCAGGGGGCGCCGCTCATCCGGG - Intergenic
1148016922 17:44528289-44528311 GCAGGGAGTGGCACTCGTCGGGG - Intergenic
1148366131 17:47057327-47057349 GCAGGGGGTGGCGCTCATCGGGG + Intergenic
1148385188 17:47229277-47229299 CTAGGGGGTGGGGCTGGTCGTGG + Intergenic
1148836829 17:50469822-50469844 GGAGGGGGTGGGGCAGGTCGAGG + Intronic
1149099214 17:52884020-52884042 GCAGGGGGCGGCGCTTGTCAGGG + Intronic
1149754019 17:59172837-59172859 GCAGGGGGCGGCGCTCGTCAGGG - Intronic
1149916437 17:60613932-60613954 GCAGGGGGTGGTGCTCATCGGGG - Intronic
1150775859 17:68080930-68080952 ACAGGGGGCGGCGCTCCTCGGGG - Intergenic
1150778323 17:68099597-68099619 GCAGGGGGCAGGGCTTGTCGGGG - Intergenic
1150786713 17:68169403-68169425 GCAGGGGGCGGCGCTCCTCGGGG + Intergenic
1150792275 17:68208129-68208151 GCAGGGGGCGGTGCTCGTCAGGG - Intergenic
1150804563 17:68308957-68308979 GCAGGGGGTGGTGCTCGAGGAGG + Intronic
1151438457 17:74113354-74113376 GCAGGGCGCGGCGCTTGTCAGGG + Intergenic
1151567417 17:74907088-74907110 GCAGGCGACAGCGCTCGTCGGGG + Intergenic
1151672755 17:75580831-75580853 GCGCGGGGTGGCGCTCGTCGGGG - Intergenic
1151782629 17:76257692-76257714 GCAGGGGGCGGCGCTCATCGGGG + Intergenic
1151866478 17:76806431-76806453 GCAGGTGGCGGCGCTCATTGGGG - Intergenic
1151983103 17:77526085-77526107 GCAGGGGGCAGCCCCCGTCGAGG + Intergenic
1152409084 17:80112895-80112917 GCTGGGGGTGCCTCTGGTCGGGG + Intergenic
1152618999 17:81352078-81352100 GCAGGGGGTGGCGCTCGTCGGGG + Intergenic
1153070428 18:1098547-1098569 GCGGGGAGCGGCGCTCGTCGGGG - Intergenic
1153644010 18:7178711-7178733 GCAGGGGGAGGCGCTCGTCGGGG + Intergenic
1153665090 18:7360952-7360974 GCAGGGGGTGGTGCCCGTTGGGG - Intergenic
1153832415 18:8935467-8935489 AGCGGGGGTGGCGCTCGTCGAGG + Intergenic
1154047102 18:10916332-10916354 GCAGGGGGCGGCGCCTGTAGGGG + Intronic
1154057193 18:11023692-11023714 GCAGGGGGCGGCGCTCGTCCGGG + Intronic
1154128716 18:11716991-11717013 GCAGGGGGCGGCGCTGGTCAGGG + Intronic
1154231111 18:12557191-12557213 GCAGGGGGTGGCGCCCGTCGGGG + Intronic
1154255263 18:12776891-12776913 GCAGGGGGCGGCGCTCGTCTGGG + Intergenic
1154294070 18:13134730-13134752 GCAGGGAGCGGCGCTCGTCCGGG + Intergenic
1154954653 18:21242341-21242363 CCAGGGGGTGGCCCTCGGCTCGG - Intronic
1155003366 18:21706835-21706857 GCAGGGGGCAGCGCTCGTGGGGG - Intronic
1155208001 18:23577674-23577696 GCAGGGGGTGGCGCTCGTCGGGG + Intronic
1155271910 18:24149598-24149620 GCAGGGGGCGGTGCTCATCGGGG + Intronic
1155294986 18:24376624-24376646 GCAGGGGGCAGTGCTCATCGAGG + Intronic
1155602790 18:27568843-27568865 GCAGGGGGTGGGGCTGGGAGTGG + Intergenic
1155611670 18:27673934-27673956 GCAGGGGGCGGTGCTCGTGGGGG + Intergenic
1155772920 18:29723833-29723855 GCAGGGGGTGGCACTCGTCCGGG - Intergenic
1155856332 18:30839203-30839225 GCAGGGAGTGGTCCTCGTCGGGG + Intergenic
1156038718 18:32794890-32794912 GCAGGGGGTGGCGCTCGTCGAGG - Intergenic
1156079546 18:33316505-33316527 GCAGGGGGCGGCGCTCGTCAGGG - Intronic
1156150355 18:34234159-34234181 GCAGGGGGCGGCGCTCGTCGGGG - Intergenic
1156242991 18:35271697-35271719 GCAGGGGGCGGCACCCGCCGGGG + Intronic
1156629012 18:38944452-38944474 GCAGGGGGCGGTGCCTGTCGGGG + Intergenic
1156657872 18:39309408-39309430 GCAGGGGGTGGCTCCCATCGGGG - Intergenic
1156863700 18:41866073-41866095 GCAGGGGGTGGTGCTAGTCGGGG - Intergenic
1156943214 18:42795547-42795569 GCAGGGGGCTGCGCTCATCCGGG - Intronic
1156969719 18:43139836-43139858 GCAAGGGGTGGCGCTTGTCGGGG - Intergenic
1157086014 18:44581049-44581071 GCAGGGGGTGGTGCTTGTCGGGG - Intergenic
1157661870 18:49452673-49452695 GCAGGGAGCGGCGCTCGTCAGGG - Intronic
1157856863 18:51111888-51111910 GCAGGGGGCAGCACTCGTCTGGG + Intergenic
1157858332 18:51121002-51121024 GCAGGGGGCGGCACTCGTAGGGG + Intergenic
1157935142 18:51864410-51864432 GCAGGGAGCAGCGCTCGTCGGGG + Intergenic
1157979755 18:52366948-52366970 GCAGGGGGTGGTGCTCCTTGGGG + Intronic
1158351968 18:56572606-56572628 GCAGGGGGCGGCGCTCGTGGAGG - Intergenic
1158460694 18:57643704-57643726 GCAGGGGGTGGTGCTGGTCAGGG + Intergenic
1158553925 18:58459692-58459714 GCAGGGGGTGGCGCTTGTCGGGG - Intergenic
1158697214 18:59714137-59714159 GCAGGGGGTGGTGCTCGTCAGGG + Intergenic
1158705708 18:59790496-59790518 GCAGGGGGTGGTGCTCGTCGGGG + Intergenic
1159230850 18:65605570-65605592 AGCGGGGGTGGCGCTCCTCGAGG - Intergenic
1159260442 18:66006008-66006030 GCAGGGGGCGGTGCTCTTAGGGG + Intergenic
1159472897 18:68880040-68880062 GCAGGGGGCGGTGCTCATCGGGG + Intronic
1159656059 18:71031382-71031404 GCAGGGGGTGGCGCTCGTCGGGG + Intergenic
1159670109 18:71212437-71212459 GCAGGGAGCGGCGCTCCTCTGGG + Intergenic
1160176574 18:76600175-76600197 GCAGGGGGTGGTGCTCGTCGGGG + Intergenic
1160198603 18:76777560-76777582 GCAGGGGGTGGTGCTCGTCAGGG - Intergenic
1160200035 18:76788619-76788641 CCAGGGGGTGGCACTCGTCGGGG + Intergenic
1160789497 19:917112-917134 GCAGGGGGTGGGCCGCGTGGAGG - Intergenic
1161094994 19:2385139-2385161 GCAGGGGGCGGAGCTCGCGGAGG + Intergenic
1161348127 19:3778043-3778065 GCAGGGGCTGGCCCACGTAGGGG - Exonic
1162091041 19:8280404-8280426 GCAGTGGGTGGCGCTCATGAGGG + Intronic
1162093275 19:8295242-8295264 GCAGTGGGTGGCGCTCATGAGGG + Intronic
1162233062 19:9283498-9283520 GCAGAGGGTGGCGCTCGTCGGGG + Intergenic
1162237794 19:9321912-9321934 GCAGGGGGCGGCACTTGTCGGGG - Intergenic
1162263094 19:9548118-9548140 GCAGGGGGTGGCGCCCGTTGGGG - Intergenic
1162506771 19:11090377-11090399 GGAGGGGGTGGCCCCCGTCCCGG - Intronic
1162524218 19:11197857-11197879 GGAGGGGGTGGAGCTGGCCGGGG + Intergenic
1162632658 19:11941340-11941362 GCAGGGGGCGGCGCTCATCGGGG + Intronic
1162814679 19:13186749-13186771 GCAGGGGGTGGCGCTCGTCGAGG + Intergenic
1162987141 19:14277922-14277944 GCAGGGGGCGGCGCTGGTAGGGG - Intergenic
1163181681 19:15608690-15608712 GCAGGGGGCGGCGCTCGTCGGGG + Intergenic
1163203720 19:15787251-15787273 GCAGGGGGTGGTGGTGGTGGTGG + Intergenic
1163218894 19:15899999-15900021 GCAGGGGGCGGCGCTCATCGGGG - Intergenic
1163334399 19:16661373-16661395 GCAGCGGGTGGCGCGGGCCGGGG + Intronic
1164143987 19:22499033-22499055 GCAGGGGGTGGCGCTCGTCCAGG + Intronic
1164310504 19:24041630-24041652 GCAGGGGGTGGTGCTCGTCGGGG - Intronic
1164975842 19:32571900-32571922 GCAGTGGGTGGTGCTCGTCCGGG - Intergenic
1165036423 19:33036913-33036935 GCAGGGGGCGGCGCTCGTCGGGG - Intronic
1165266967 19:34668461-34668483 GCAGGGGGCGGCGCTCGTCTCGG - Intronic
1165473078 19:36014549-36014571 GCAGGTGATGGCGCTGGCCGCGG - Intergenic
1165846631 19:38821812-38821834 GCAGGGGGTGGCGCTCCTCGGGG - Intronic
1166036170 19:40170185-40170207 GCAGGGGGCGGCGCTCATCCGGG + Intergenic
1166231817 19:41428902-41428924 GCAGGGGGTGCTGCTCCTCCTGG + Intronic
1166486965 19:43221966-43221988 GCAGGAGGTGGCACTCCTCAGGG + Intronic
1166649687 19:44563286-44563308 GCAGGGGGTGGCGCTCCTCAGGG + Intergenic
1166773349 19:45297812-45297834 GCAGGGGGTGGGGGTGGTGGGGG + Exonic
1168659938 19:58157623-58157645 GCAGGGGGCGACGCTCGTCGGGG - Intergenic
924977433 2:191403-191425 GCAGGGGGCGGTGCCCGTTGGGG + Intergenic
925088652 2:1134769-1134791 GCAGGGGGCGTCGCTCGTTGGGG + Intronic
925533023 2:4884531-4884553 GCAGGGCGTGGTGCCCATCGGGG - Intergenic
925537763 2:4935359-4935381 GCACGGGGTGGCACTCGTCGGGG + Intergenic
926095874 2:10080317-10080339 GCAGGGGGAGGCGCGGGGCGAGG + Exonic
926097538 2:10091733-10091755 GCAGGGGGCGACACTCGTCCAGG - Intergenic
926437622 2:12854126-12854148 GCAGGGAGCAGCGCTCGTCGGGG + Intergenic
926474726 2:13308359-13308381 GCAGGGGGCGGCGCTCCTAGGGG + Intergenic
926616587 2:15002579-15002601 GCAGGGGGTGGCACTCACTGGGG + Intergenic
926850694 2:17193827-17193849 GCAGGGGGCAGCGCTCGTCTGGG - Intergenic
927357114 2:22186614-22186636 AGAGGGGGCGGCGCTCGTAGGGG - Intergenic
927777838 2:25915777-25915799 GCAGGAGGCGGCGCTCATCGGGG - Intergenic
928599147 2:32886617-32886639 GCACGGGGCGGCGCCTGTCGGGG + Intergenic
928617898 2:33057471-33057493 GCAGGGGGCAGCTCTCATCGGGG + Intronic
928688607 2:33775665-33775687 GCAGGGGGTGGCACCCGTCGGGG - Intergenic
928723074 2:34142579-34142601 GCAGGGGGTGGTGCTCGTCAGGG + Intergenic
928753240 2:34494609-34494631 GCAGGGGGTGGCGCTCGTCGGGG - Intergenic
928880620 2:36092555-36092577 GCAGGGGGCGGCACTCATTGGGG - Intergenic
928936944 2:36688576-36688598 GCAGGGGGTGGCGCTCGTCGGGG - Intergenic
929070103 2:38020826-38020848 GCAGGGGGTGGCGCTCGTGGGGG - Intronic
929109904 2:38397578-38397600 GGAGGGGGCGGTGCTCGTCGGGG - Intergenic
929233754 2:39585671-39585693 ACAGGGGGTGGTATTCGTCGGGG - Intergenic
929379733 2:41335906-41335928 GCAGGGGGCGGCGCTCGTCAGGG - Intergenic
929890823 2:45917715-45917737 GCAGGGGGCGGCGCTCGTCGGGG + Intronic
930038058 2:47100048-47100070 GCAGGGGGCGGCACTCATCAGGG - Intronic
930039259 2:47107596-47107618 GCAGGGGGCGGCACTCATCAGGG - Intronic
930420834 2:51151659-51151681 GCAGGGGGCAGCGCTCCTCGAGG + Intergenic
930485558 2:52007124-52007146 GCAGGGGACAGTGCTCGTCGGGG - Intergenic
930605211 2:53486347-53486369 GCAGGAAGTGGCGCCCCTCGTGG - Intergenic
932142875 2:69294989-69295011 GCTGGGGGTGGCGGACCTCGAGG + Intergenic
932178323 2:69622356-69622378 GCAGGGGGTGGCGCTCGTCGGGG - Intronic
932239977 2:70148621-70148643 GCAGGGGGTGGTGCTCGTCAGGG - Intergenic
932359478 2:71092532-71092554 GCAGGGGGCGGCGCTCATGGGGG + Intergenic
932486524 2:72087197-72087219 GTAGGGGGTGGTGCTCGTCGGGG - Intergenic
932521817 2:72422142-72422164 GCAGGGGGTGGTGCTCGTTGGGG - Intronic
932753866 2:74391663-74391685 GCAGGGGTGGGCGCTTGTCGGGG - Intronic
932902091 2:75711890-75711912 GCAGGGGGTGGTGCTCGTCGGGG - Intergenic
933049963 2:77590789-77590811 GCAGGGGGAGGTTCTCATCGGGG - Intronic
933060799 2:77734830-77734852 GCAGGGAGCGGTGCTGGTCGGGG + Intergenic
933139859 2:78779312-78779334 GCAGGGGGTGGCGCCCGTCAGGG - Intergenic
933442051 2:82326331-82326353 GCAGGGGCCTGCGCTCGTTGGGG + Intergenic
933487209 2:82938487-82938509 GCAGGGGGTGGTGCTCGTCGGGG + Intergenic
933712116 2:85334458-85334480 GCAGGGGGCGGTGCTCGTCGGGG + Intergenic
934085163 2:88503411-88503433 GCAGGGGGCGGCGCTCGTCGTGG - Intergenic
934898539 2:98139318-98139340 GCAGGGGGTGGCGCTCGTCGGGG - Intronic
935866479 2:107392601-107392623 GCAGGGGGCGGCGCTCCTCGGGG - Intergenic
935872799 2:107469469-107469491 GCAGGAGGAGGCGCTGGTCGGGG + Intergenic
935878320 2:107536135-107536157 GCAGGGGGTGACACTCATCAGGG + Intergenic
935896806 2:107747383-107747405 GCAGGGGGCGGCGCTCGTCTGGG + Intergenic
936172666 2:110190277-110190299 GCAGGGGGTGGCACTTGTCAGGG + Intronic
936346933 2:111682166-111682188 GCAGGGGGTGGCGCTCGTCGGGG - Intergenic
937209551 2:120259795-120259817 GCAGGGGGTGGCGCTCGTCGGGG + Intronic
937596892 2:123684090-123684112 GCAAGGGGTGGTGCTCGTCGGGG - Intergenic
937711804 2:124987455-124987477 GCAGAGGGCGGCGCTCGTCGGGG + Intergenic
937751384 2:125479203-125479225 GCAGGGGGCGGCGCCGGTTGGGG + Intergenic
938014752 2:127858108-127858130 GCTGGTGGTGGCGCGCGGCGCGG - Exonic
938126031 2:128672167-128672189 GCAGGGGGCAGTGCTCGTCAGGG + Intergenic
938401071 2:130991760-130991782 GCACGGGGTGGCGCTCATCTGGG - Intronic
938725984 2:134109391-134109413 GCAGGGGGCTGCGCTCGTCGGGG + Intergenic
938728859 2:134130326-134130348 GCAAGGGGTGGTGCCCGTAGGGG - Intronic
938931171 2:136088115-136088137 GCAGGGGGCGGTGCTCGTCGGGG + Intergenic
939003171 2:136758736-136758758 GCAGGGGGCGGCGCTCATCGGGG - Intergenic
939053170 2:137331652-137331674 GCAGGGGGCGGTGCTCATCGGGG + Intronic
939085722 2:137716109-137716131 GCAGGGGGCGGCGCCCGCTGGGG - Intergenic
939229804 2:139410656-139410678 GCAGGGGGTGGCGCTCGTCAGGG - Intergenic
939281794 2:140074095-140074117 GCAGGGGGCGGCGCTCATGGGGG - Intergenic
939465176 2:142546376-142546398 GCAGGGGGCGGCGCTCCTCGGGG - Intergenic
939777315 2:146403736-146403758 GCAGGGGGTGGTGCTCGTCGGGG + Intergenic
939898960 2:147827175-147827197 GCAGGGGGCGGTGCTCCTCAGGG - Intergenic
939972501 2:148678445-148678467 GCAGGGGGTGGCGCTTGTTGAGG + Intronic
940215136 2:151296273-151296295 GCAGGGGGCGGCGCTCGTCGGGG - Intergenic
940784568 2:157967958-157967980 GCAGGGGGCAGCACTCCTCGGGG + Intronic
941240129 2:163026591-163026613 GCAGGGGGTGGCACTCGTCGGGG - Intergenic
941309830 2:163913933-163913955 GCAGGGGGCGGCGCTCGTCGGGG - Intergenic
941397886 2:164994799-164994821 GCAGGGTGTGGCGTTCGTCGGGG + Intergenic
941476544 2:165957108-165957130 GCAGGGGGCGGCGCCCTTCGAGG + Intergenic
941705827 2:168657483-168657505 GCAGGGGGTGGAGCTCGTCGGGG + Intronic
941712076 2:168724942-168724964 GCAGGGGGTGGCACTCGTCGTGG + Intronic
941820836 2:169841849-169841871 GTAGGGGGTGGTGCTCGTCGGGG - Intronic
941878555 2:170459673-170459695 GCAGGGGGTGGTGCCCGTCGAGG + Intronic
941928020 2:170915414-170915436 GCAGGGGGCGGTGCCCATCGGGG + Intergenic
942170211 2:173282635-173282657 GCAGGGGGCAGTGCTCGTCTGGG + Intergenic
942317549 2:174709609-174709631 GCAGGGGGCGGCGCTTGTCGGGG + Intergenic
942368615 2:175257045-175257067 GCAGGGGGCGGCGCCCGTAGGGG + Intergenic
942540232 2:177008166-177008188 GCAGGGGGCGGCACTCGTCGGGG - Intergenic
942620061 2:177835987-177836009 GCAGGGGGCAGCGCTCGTCGGGG - Intronic
942867336 2:180691703-180691725 GCAGGGAGCGGCGCTCATCGTGG - Intergenic
943024249 2:182608713-182608735 GCAGGGGGCGGCGCTGGTCGGGG - Intergenic
943106115 2:183546723-183546745 GCAGGGGGCGGTGCTCATTGAGG + Intergenic
943494705 2:188606439-188606461 GCAGGGGGTGGCGCTCGTCGGGG + Intergenic
943516244 2:188890880-188890902 GCAGGGTGCGGCGCCCGTTGGGG - Intergenic
943680293 2:190760999-190761021 GCAGGGGGTGGCGCTCGTCAAGG + Intergenic
943790074 2:191921903-191921925 GCAGGGGGCAGCGCTCGTCGGGG - Intergenic
943835204 2:192508284-192508306 GCAGGGGGTGGCGCTTGTCAAGG - Intergenic
943906083 2:193502510-193502532 GCAGGGGGCGGCGCTCGTCGGGG + Intergenic
943942770 2:194020476-194020498 GCAGGGGGCAGCGCTCGTCGGGG - Intergenic
943954996 2:194176680-194176702 GCAGGGGGTGGTGCTCCTCGGGG - Intergenic
944055216 2:195515943-195515965 GCAGGGAGTGGCGCTGGTTGGGG - Intergenic
944058450 2:195547399-195547421 GCAGGGGGTGGCGCTTGGTCGGG + Intergenic
944482834 2:200175054-200175076 GCAGGGGGTGGCGCTTCTTGGGG - Intergenic
944728650 2:202497225-202497247 GCAGGGGGCGGCACTCATCGGGG - Intronic
944729684 2:202503686-202503708 GCAGGGGGCGGCACTCATCAGGG - Intronic
944843099 2:203642913-203642935 GCAGGGGGCAGCGCTCGTCGGGG + Intergenic
944857888 2:203785619-203785641 GCAGGGGGTGGCGCTCATCGGGG + Intergenic
945401429 2:209387650-209387672 GCAGGGGGCCACTCTCGTCGGGG - Intergenic
945451452 2:210000661-210000683 GCAGGGGGCGGCGCTCCTCAGGG + Intergenic
945575431 2:211524422-211524444 GCAGGGGGTGGTGCTCGTCGGGG + Intronic
945745825 2:213718807-213718829 GTAGGGGGTGGTGCTCGTCGGGG - Intronic
945869190 2:215208190-215208212 GCAGGGGGCTGCACCCGTCGGGG - Intergenic
945870261 2:215219378-215219400 GTAGGGGGTGGTGCTCGTTAGGG - Intergenic
945872788 2:215245786-215245808 GAAGGGGGCGGCGCTTGTCAGGG + Intergenic
946152719 2:217787310-217787332 GCAGGGGGCGGTGCCCGTCGGGG + Intergenic
946358039 2:219201472-219201494 GCAGGGGGTGGTGCTCGTCGGGG + Intronic
946923519 2:224603746-224603768 GCAGGGGGTGGCGCTCGTAGAGG + Intergenic
947026677 2:225744449-225744471 GCAGGGGGCGGCGCTCATCGGGG - Intergenic
947103843 2:226648328-226648350 GCAGGGGGCGGCACTCATTGGGG - Intergenic
947250387 2:228096433-228096455 GCAGGGAGAGGGGCTTGTCGGGG - Intronic
947412034 2:229851032-229851054 GCAGGGGGCGGCGCTCGTCGGGG - Intronic
947720469 2:232366656-232366678 GCAGGGGGTGGCGCTCATCGGGG - Intergenic
947932012 2:233972513-233972535 GCAGGGGGTGGCGCTCGTGGAGG + Intronic
947937981 2:234024324-234024346 GAAGGGGGCGGCACTCATCGGGG + Intergenic
947962087 2:234247989-234248011 GGAGGGGGCGGTGCTCGTCGGGG - Intergenic
948820138 2:240538585-240538607 GCAGGGGGCGGCGCCTGTCGGGG - Intronic
949011276 2:241680273-241680295 CCAGGGCGTGACCCTCGTCGTGG - Exonic
1169645310 20:7803603-7803625 GCAGGGGGCGGCGCTCGTCGGGG + Intergenic
1169814409 20:9641634-9641656 GCAGGGGGTGGTGCTCGTCAGGG + Intronic
1169849234 20:10031994-10032016 GCAGGGGGTGGTGCTCATCGGGG - Intronic
1170230836 20:14044873-14044895 GCAGGGAGTGGCGCTCGGGGAGG + Intronic
1170246514 20:14226822-14226844 GCAGGGGGCGGCGCTCATCGGGG - Intronic
1170649545 20:18227080-18227102 GCGGGGGGCCACGCTCGTCGGGG - Intergenic
1170806804 20:19639675-19639697 GCAGGGGGCGGCGCTCAATGGGG + Intronic
1170989930 20:21292187-21292209 GCAGGGGGTGGCACTCGTCGGGG - Intergenic
1171973380 20:31578616-31578638 GGAGGGGGCGGCGCTCGTAGGGG + Intergenic
1172431807 20:34898845-34898867 GCAGGGGGCGGTGCTCGTCGGGG + Intronic
1173195484 20:40910514-40910536 GCAGGGGGTGGTGCTCGTCAGGG + Intergenic
1173195733 20:40911499-40911521 GTAGGGGGTGGTGCTTGTTGGGG - Intergenic
1173601640 20:44299450-44299472 GTAGGGGGCGGCGCTCATCGGGG - Intergenic
1174162846 20:48564154-48564176 GCAGGGGGCAGCACTCGTCTGGG + Intergenic
1174179576 20:48666313-48666335 GGAGGCAGTGGCGCTCGGCGTGG - Exonic
1175254194 20:57629104-57629126 GCAGGGGGCGGCGCTCGGCAGGG - Intergenic
1175911497 20:62407296-62407318 GCAGGGGGTGGGGCGCTTCGCGG - Intergenic
1176146663 20:63568506-63568528 GCTGGCCGTGGCGCTCATCGCGG - Exonic
1176189422 20:63800848-63800870 GCAGGGAGGGGCACTCGTCAGGG - Intronic
1176344793 21:5733557-5733579 ACAGGGGGTGGAGCTCGTTGGGG + Intergenic
1176351607 21:5854141-5854163 ACAGGGGGTGGAGCTCGTTGGGG + Intergenic
1176500034 21:7590898-7590920 ACAGGGGGTGGAGCTCGTTGGGG - Intergenic
1176539114 21:8131627-8131649 ACAGGGGGTGGAGCTCGTTGGGG + Intergenic
1176558065 21:8314672-8314694 ACAGGGGGTGGAGCTCGTTGGGG + Intergenic
1176671082 21:9735852-9735874 GCAGGGGGCAGCGCTTGTCAGGG - Intergenic
1176872208 21:14093014-14093036 GCAGGGGGTGGCACTCGTTGGGG + Intergenic
1176966570 21:15218620-15218642 GTAGGGGGTGGTGCTCCTAGGGG + Intergenic
1177182343 21:17757632-17757654 GCAGGGGGTGGTGCTCCTAGGGG + Intergenic
1177318756 21:19493858-19493880 GCAGGGGGCGGTGCTCGTAGGGG - Intergenic
1177496977 21:21902740-21902762 GCAGGGTGTGGCACTCGTCGGGG - Intergenic
1177565786 21:22818903-22818925 GCAGGGGGCGGCGCTCATCAGGG + Intergenic
1177637665 21:23807331-23807353 GTAGGGTGTGGCGCTCGTCGAGG - Intergenic
1177795937 21:25778632-25778654 GCAGGGGGCGGCGCTCGTCAGGG - Intergenic
1178054577 21:28784072-28784094 CTGGGGGATGGCGCTCGTCGGGG - Intergenic
1178074214 21:29000455-29000477 GTAGGGGGTGGCGCTTGTCGGGG - Intergenic
1178082188 21:29077240-29077262 GCAGCGGGCGGCGCTCGTCGCGG + Intergenic
1178327036 21:31654501-31654523 GCAGGGGGCGGTGCTTGTCGGGG - Intergenic
1178365800 21:31987863-31987885 GCAGGGGGTGGAGCTGGATGGGG + Intronic
1178398787 21:32265647-32265669 GCAGGGGGTGGTGCTCGTCGGGG - Intergenic
1178585601 21:33868362-33868384 GCAGGGGGCGGCGCTCGTCGGGG + Intronic
1178983307 21:37283230-37283252 GCAGGGGGCGGCGCTCGTCGGGG + Intergenic
1179518359 21:41925551-41925573 GCAGGGGCTGGCGCTGGAAGAGG - Intronic
1179627898 21:42658888-42658910 GGAGGGGGTGGCGGTGGTGGAGG + Intronic
1179726166 21:43342248-43342270 GCAGTGGGTGGCGCTCACCAGGG - Intergenic
1179928269 21:44550389-44550411 GCAGAGGGTGACGCTCCTGGGGG + Exonic
1180740995 22:18053401-18053423 GCAGGGGGCGGCGCTCGTCGGGG + Intergenic
1180755131 22:18155803-18155825 GCCGGGAGCGGCGCTGGTCGGGG - Intronic
1181077633 22:20392455-20392477 GCAGGGGGCGGCGCTTGTCGGGG + Intergenic
1181415397 22:22755370-22755392 GCAGGGGGAGGGGCTGGTTGGGG + Intronic
1181450501 22:23017097-23017119 GCAGGGGGCGGTGCTCGTCCGGG + Intergenic
1181800849 22:25346973-25346995 GCAGGGGGCGTCGCCTGTCGGGG + Intergenic
1182299608 22:29330302-29330324 CCAGGGGGTGGCCCTGGTGGAGG - Intronic
1182337995 22:29598110-29598132 GCAGGGAGCGGCGCTCGTCGGGG + Intergenic
1182456054 22:30451158-30451180 GCCGGGGGTGGCGCTGCTCTGGG + Intronic
1182479426 22:30597180-30597202 GCAGGGGGCGGCGCTCGTTGGGG - Intronic
1183319361 22:37155762-37155784 GCAAGGCGTGGAGCTCGTGGAGG - Intronic
1183685282 22:39357915-39357937 GCAGGGGGTGGTGCTCATCGGGG - Intronic
1183990398 22:41593834-41593856 GCAGGGGGCGGCGCTCGCCGGGG - Intergenic
1184584302 22:45437044-45437066 GCACGGGGCGGCGCTCGTCGGGG - Intergenic
1184690104 22:46113626-46113648 GCAGGGGCTGGTGCTGGGCGGGG + Intronic
1184906204 22:47488351-47488373 GCAGGGGGCGGCGCTCGTCGGGG + Intergenic
1185229074 22:49670246-49670268 GCAGGGGGCGGCGCTCGTCGGGG + Intergenic
1203244064 22_KI270733v1_random:47982-48004 ACAGGGGGTGGAGCTCGTTGGGG + Intergenic
949259022 3:2083943-2083965 GCAGGGGGCGGCGCTCGTCGGGG - Intergenic
949770043 3:7568908-7568930 GCAGGGGGCGGCGCTCGTCCGGG - Intronic
950068914 3:10136480-10136502 GCAGGGGGTGGCGCTCGTCGGGG + Intergenic
950207924 3:11094315-11094337 GCAGGGGGCGGCGCTCGTAGGGG - Intergenic
950256610 3:11511640-11511662 GCAGGGGGTGGTGCTCGTCGGGG + Intronic
950256918 3:11513290-11513312 GCAGGGGGCGGTGCTCGTTGGGG + Intronic
950400927 3:12768838-12768860 GCAGGGGGCAGCGCTCATTGGGG + Intronic
950418593 3:12883164-12883186 GCAGGGAGCGGCGCTCGTCCGGG - Intergenic
950470206 3:13180032-13180054 GCAGGGTGCGGTGCTCGTCGGGG - Intergenic
950513321 3:13447241-13447263 GCAGGGGGTGGTGCTCGTCGGGG + Intergenic
950601277 3:14037521-14037543 GCAGGGGGCGGTGCCCGTTGGGG - Intronic
951024810 3:17817717-17817739 GCAGGGGGCGGCGCTCTTAGGGG + Intronic
951185008 3:19702843-19702865 GCAGGGGGCGGTGCCCGTAGGGG - Intergenic
951332909 3:21387296-21387318 GCAGGGGGTGGCGCTTGTTGAGG + Intergenic
951415488 3:22417266-22417288 GCAGGGGGTGGTGCTCATCAGGG - Intergenic
951551833 3:23882576-23882598 GCAGGGGGTGGTCCCCATCGGGG + Intronic
951734830 3:25852036-25852058 GCAGGGGATGGCGATAGTCGGGG - Intergenic
951951042 3:28200458-28200480 GCAGGGGGCGGCGCTCATCGGGG + Intergenic
952011237 3:28903211-28903233 GCAGCGGGTGGTGCTCGTCGGGG + Intergenic
952058045 3:29473549-29473571 ACCAGGGGTGGCGCTCGTTGGGG + Intronic
952275297 3:31870431-31870453 GTAGGGGGCGGCGCTCGTCGGGG - Intronic
952355421 3:32579031-32579053 GCAGGGGGCAGCGCTCGTCGGGG - Intergenic
952360516 3:32625950-32625972 GCAGGGGGCGGCGCTCGTCGGGG - Intergenic
952393756 3:32903109-32903131 GCAGGGGGCGGCATTCGTCGGGG - Intergenic
952398275 3:32939998-32940020 GCAGGGGGCGGCATTCGTCGGGG - Intergenic
952453737 3:33453772-33453794 GCAGGGGGCAGTGCTCGTCGGGG - Intergenic
952593685 3:34988693-34988715 GCAGGGGGCGGCGCTCATTGGGG - Intergenic
952713356 3:36453618-36453640 GCAGGGGGCGGCGCTCGTCAGGG - Intronic
952730689 3:36634223-36634245 GCAGGGGGCGGCGCTCATCGGGG - Intergenic
952795293 3:37233334-37233356 GCAGGGGGCGGCGCTCATCGGGG - Intergenic
953002936 3:38951467-38951489 GCAGAGGGCGGTGCTTGTCGGGG - Intergenic
953089875 3:39713631-39713653 GCAGGGGGTGGCGCTCGTTGGGG - Intergenic
953124467 3:40077972-40077994 GCAGGGGGTGGCGCTCGTTGGGG + Intronic
953307564 3:41844213-41844235 GCAGGGGGCGGCGCTCGCTGGGG + Intronic
953423064 3:42769982-42770004 GCAGGGGGTGGCGCTCGTTGGGG - Intronic
953522450 3:43656471-43656493 GCAGGGGGTGGTACTCGTCGGGG + Intronic
953674026 3:44986161-44986183 GCAGGGGGCAGCGCTCCTTGGGG + Intronic
954041049 3:47887521-47887543 GCAGGGGGTGGTGCTTGTCAGGG - Intronic
954160364 3:48717224-48717246 GCAGGGGGCGGGGCTCGGCCTGG - Exonic
954226159 3:49182709-49182731 GCAGGGGGCGGCGCTTGTTGGGG + Intronic
954265164 3:49465978-49466000 GCAGGGGCTGGTGCTGGTCAAGG - Intergenic
954620178 3:51990888-51990910 GCGGGGGGCGGCGCTCATGGGGG - Intergenic
955183398 3:56692196-56692218 GCAGGGGGCGGCGCTCATCGGGG - Intergenic
955186470 3:56719248-56719270 GCAGGGGGTGGTGCTCATCGGGG - Intergenic
955210333 3:56934781-56934803 GCAGGGGGTGGCGCTCGTCGGGG - Intronic
955266414 3:57449390-57449412 GCAGGGGGTGGTGCTCCTCAGGG + Intronic
955449525 3:59051173-59051195 GCAGGGGGCGGCGCTCATCGGGG - Intergenic
956183893 3:66544689-66544711 GCAGGGGGCGGCGCTCCTTGGGG + Intergenic
956195780 3:66651843-66651865 GCAGGGGGCGGTGCTCGTCAGGG - Intergenic
956459270 3:69454744-69454766 GCAGGGGGTGGTGCCCTTTGGGG - Intronic
956481502 3:69677769-69677791 GCAGGGGGTGGTGCTCGTCGGGG - Intergenic
956563673 3:70612129-70612151 GCAGGGGGCTGCCCTCGTCTGGG - Intergenic
956632643 3:71331413-71331435 GCAGGGAGCGGCGCTTGTCGGGG - Intronic
956723560 3:72138815-72138837 CCAGAGGGTGGCGCTCCTGGTGG + Intergenic
956809951 3:72855340-72855362 CAAGGGGGTAGCGGTCGTCGTGG - Intronic
956855305 3:73269509-73269531 GCAGGGGGTGGTGCTCGTCGGGG - Intergenic
956987010 3:74712345-74712367 GCACGGGGCGGAGCTCCTCGGGG - Intergenic
957002228 3:74900021-74900043 GCAGGGGGCGGCGCTCGTTGGGG + Intergenic
957009138 3:74985170-74985192 GCAGGGGGCGGCGCTCATTGGGG + Intergenic
957056128 3:75444479-75444501 GCAGGGGGCGGTGCTCATTGGGG + Intergenic
957074122 3:75588070-75588092 GCAGGGGGTGGTGCTCGTCGGGG - Intergenic
957209389 3:77240136-77240158 GCATGGGGCGGCGCCCGTCGGGG + Intronic
957277512 3:78108704-78108726 GCAGGGGGCGGCGCTCCTTGGGG - Intergenic
957386489 3:79502537-79502559 GCAGGGGATGGCGCTCGTCTGGG - Intronic
957419619 3:79951415-79951437 GCAGGGGGTGGTGCTCATCCGGG + Intergenic
957446164 3:80314764-80314786 GCAGGGGGCGGCTCTCATTGGGG - Intergenic
957560122 3:81812053-81812075 GCAGGGGGTGGCGCTCGTCAGGG + Intergenic
957804860 3:85133905-85133927 GCAGGGGGCGGCGCTCGTCGGGG + Intronic
957829967 3:85504720-85504742 GCAGGGGGCGGCGCTCATCGGGG + Intronic
957921868 3:86757917-86757939 GCAGGGGGCGGCCCTCATCGGGG - Intergenic
957995152 3:87679414-87679436 GCAGGGGGTGGTGCTCGTCGGGG - Intergenic
958022680 3:88016004-88016026 GCAGGGGGCGGCGCTCGTAGGGG - Intergenic
958419915 3:93917900-93917922 GCAGGGGGTGGGGCTCATCAAGG - Intronic
958810721 3:98858017-98858039 GCAGGGGGCGGTGCTCGTCGGGG + Intronic
960026879 3:113019742-113019764 GCAGGGGGTGGGGCTCGGGCGGG + Exonic
960149755 3:114238334-114238356 GCAGGGGGCGGCGCTCATCGGGG + Intergenic
960227490 3:115184932-115184954 GCAGGGGGCGGCGCTCCTCAGGG + Intergenic
960282184 3:115791878-115791900 GCAGGGGGCGGCGCTCATCGGGG - Intergenic
960487355 3:118269980-118270002 GCAGGGGGCAGTGCTCGTCTGGG - Intergenic
960559992 3:119073452-119073474 GCAGGTGGTGGCGCCCATCGGGG + Intronic
960669249 3:120140564-120140586 GCAGGGGGCGGCGCTCGTAGGGG - Intergenic
960761624 3:121078576-121078598 GCAGGGGGTGGTGCTCTTTGGGG + Intronic
960868548 3:122227257-122227279 GCAGGGGGTGGTGCTCATCAGGG + Intronic
961268848 3:125672060-125672082 GCAGGGGGTGGCGCCCATTGGGG - Intergenic
961279969 3:125758670-125758692 GCAGGGGGCGGTGCTCGTCGGGG + Intergenic
961460508 3:127046993-127047015 GCAGGGGGTGGTGCTCTTCGGGG - Intergenic
961688851 3:128653714-128653736 GCAGGGGGCGGCGCTCGTCGGGG - Intronic
961700744 3:128742971-128742993 GCAGGGGGCGGTGCCCGTCGGGG + Intronic
961746680 3:129068352-129068374 GCAGGGGGCGGCCCTTGACGGGG + Intergenic
961874430 3:130010909-130010931 GCAGGAGGCAGTGCTCGTCGGGG - Intergenic
961881605 3:130065386-130065408 GCAGGGTGTGGCTCACGACGGGG - Intergenic
962177194 3:133167441-133167463 GCAGGGGGTGGTGCCCGTCAGGG + Intronic
962283705 3:134070305-134070327 GCAGGGGGTGGTGCTCGTCGGGG + Intronic
962383719 3:134916400-134916422 GCAGGGGGCGGTGCTCGTCCGGG + Intronic
962600455 3:136987632-136987654 GCAGGGGGTGGCGCTCATCGGGG + Intronic
962758297 3:138484965-138484987 GCAGGGGGCGGTGCTCGTCGGGG - Intergenic
963397257 3:144750124-144750146 GCAGGGGGCGGTGCTTGTCGGGG - Intergenic
963440453 3:145333694-145333716 GCAGGGGGCAGCGCTCATCGGGG - Intergenic
963509110 3:146225476-146225498 GCAGGGGGTGGTGCTCGTCGGGG + Intronic
963554703 3:146772655-146772677 GCAGGGGGCGGCACTTGTCGGGG - Intergenic
963583383 3:147154384-147154406 GCAGGGGGTGGCGCCCTTCGGGG - Intergenic
963589945 3:147245653-147245675 GCAGGGGGCGGCGCTCGTCAGGG + Intergenic
963673468 3:148280610-148280632 GCAGGGAGTGGCGCTGGTTGGGG + Intergenic
963742878 3:149097765-149097787 GCAGGGGGCAGCACTCGTTGGGG + Intergenic
963744199 3:149109672-149109694 GCAGGGGACGGTGCTCGTTGGGG - Intergenic
963862218 3:150323284-150323306 GCAGGGGGTGGCGCTCATCGGGG - Intergenic
964014431 3:151928472-151928494 GCAGGGGGTGGCACTTGTCTGGG - Intergenic
964032368 3:152152734-152152756 GCAGGGGGTGGCGCTCCTCGGGG - Intergenic
964037585 3:152217617-152217639 GCAGGAGGCGGCGCTGGTCGGGG - Intergenic
964117929 3:153155793-153155815 GCAGGGGGCGGCGCTCCTAGGGG + Intergenic
964129312 3:153269037-153269059 GCAGGGGGCGACGCCCATCGGGG - Intergenic
964138303 3:153369796-153369818 GCAGGGGGCGGTGCCCGTCAGGG + Intergenic
964139174 3:153378380-153378402 GCAGGGGGTGGTGCTCGTCAGGG + Intergenic
964198187 3:154088287-154088309 GCAGGGGGCGGCACTCGTCGGGG - Intergenic
964375092 3:156041593-156041615 GCAGGGGGCAGCACTTGTCGGGG - Intronic
964381137 3:156099740-156099762 GCAGGGGGCTGTGCTCGTCCGGG - Intronic
964393738 3:156223955-156223977 GCAGGGGGCAGCGCTCATCAGGG + Intronic
964444048 3:156740893-156740915 GCAGGGGGTGGCACTCGTCGGGG - Intergenic
964751908 3:160060845-160060867 GCAGGGGGCGGCACTCGTGGCGG - Intergenic
964802850 3:160574033-160574055 GCAGGGGGTGGCACTCGTCGGGG + Intergenic
964974220 3:162600018-162600040 ACAGGGGGCGGCGCTCGTCAGGG - Intergenic
964977801 3:162640387-162640409 GCAGGGGGCGGTGCTTGTCGGGG - Intergenic
964982461 3:162702964-162702986 GCAGGGGGTGCTTCTCGTCCAGG + Intergenic
964983110 3:162710552-162710574 GCAGGGGGCGGTGCTTGTCAGGG + Intergenic
965003566 3:162987636-162987658 GCAGGGGACGGTGCTCGTCGGGG - Intergenic
965044090 3:163552366-163552388 GCAGGGGACGGCGCTCGTGGAGG + Intergenic
965078038 3:164003284-164003306 GCAGGGGGTGGTGCTCGTCGGGG - Intergenic
965092289 3:164179562-164179584 GCAGGGGGCGGCGCTCATCAGGG - Intergenic
965109377 3:164401934-164401956 GCAGGGGGCGACGCTCGTCGGGG + Intergenic
965200300 3:165649361-165649383 GCAGGGGGTGGCGCTCGTGGAGG + Intergenic
965220168 3:165918490-165918512 GCAGGGGGCGGCGCTCGTCTGGG + Intergenic
965220853 3:165924381-165924403 GCAGGGGGCGGCGCTCGTCGGGG + Intergenic
965245193 3:166258512-166258534 GCAGAGGGTGGTGTTCGTCGAGG + Intergenic
965288088 3:166843128-166843150 GCAGGGGGCGGCGCTCATCTGGG - Intergenic
965298174 3:166976149-166976171 GCAGTGGGCGGCGCTCATCGGGG - Intergenic
965728626 3:171746193-171746215 GCAGGGGGTGGTGCCCGTGGAGG - Intronic
965753182 3:171998915-171998937 GCAAGGGGTGGTGCTCGTCGGGG + Intergenic
965837418 3:172867098-172867120 GCAGGGGGCGGTGCTCGTCCGGG - Intergenic
965943434 3:174212016-174212038 GCAGGGGGTGGTGTTCGCCCGGG + Intronic
966076108 3:175937688-175937710 GCAGGGGGCGGCGCTTGTGGGGG - Intergenic
966096739 3:176213460-176213482 GCAGGGGGCGGCGCTCATGCAGG + Intergenic
966108167 3:176362269-176362291 GCAGGGGGCGGCGCTGGTCGGGG + Intergenic
966182985 3:177203919-177203941 GCAGGGGGCGGCACCCGTCTTGG + Intergenic
966190969 3:177271773-177271795 GCAGGGGGTGGCGCTCGTCGGGG + Intergenic
966246031 3:177808987-177809009 GCAGGGGGCGGTGCTCCTCTGGG + Intergenic
966353561 3:179056609-179056631 GCATGGGCTGGCGCTCGCCCCGG - Intronic
966372382 3:179263097-179263119 GCAGGGGGCAGCGCTCATCAGGG + Intronic
966425429 3:179775563-179775585 GCAGGGGGCGGTGCCCCTCGGGG + Intronic
966725050 3:183101213-183101235 GCAGGGGGTGGCGCTCATCGGGG - Intronic
967234059 3:187367620-187367642 GCAGGGGGTGGCACTCGTCGGGG + Intergenic
967448550 3:189596440-189596462 GCAGGGGGTGGCGCTTGTCGAGG - Intergenic
967499106 3:190177093-190177115 GCAGGGGGTGGCGCTTGTCGAGG + Intergenic
967594871 3:191317057-191317079 GCAGGGGGTGGTGCCCGTCAGGG + Intronic
967718403 3:192789348-192789370 GCAGGGCGCGGCGCTCGTCAGGG - Intergenic
968181547 3:196599081-196599103 GCAGGGGGTGGCGCTCGTCGGGG + Intergenic
968469720 4:773844-773866 GCACGGGGCAGTGCTCGTCGGGG - Intergenic
968702354 4:2063010-2063032 CCAGGAGGTGGCGGTCGTGGGGG - Intronic
968716207 4:2161583-2161605 GCAGGGGGCGGCGCTCATCAGGG - Intronic
969017741 4:4115670-4115692 GCAGGGGGCGGTGCTCGTCGGGG - Intergenic
969240372 4:5893105-5893127 GCGGGGCGTGGCGCGCGCCGGGG + Intergenic
969303111 4:6309080-6309102 GCAGGGGGCGGCGCTTGTCGGGG + Intergenic
969362402 4:6673040-6673062 GCAGGGGGTGGTGCTCGTCGAGG - Intergenic
969440787 4:7215445-7215467 GCAGGGGGTCGCGCTCGTCAGGG - Intronic
969654931 4:8491454-8491476 GCAGGGGGTGGTGCTCGTCGGGG + Intronic
969736249 4:8992942-8992964 GCAGGGGGCAGTGCTTGTCGGGG + Intergenic
969814966 4:9680156-9680178 GCAGGGGGCGGTGCTCATGGGGG - Intergenic
970182637 4:13415699-13415721 GCAGGGGATGGTGCTCGTTGGGG - Intronic
970272157 4:14358936-14358958 GCAGGGGGTGGCGCTTGTCAGGG - Intergenic
970391262 4:15615230-15615252 GCAGGGGGTAGTGCTCGTTGGGG - Intronic
970408598 4:15786773-15786795 GCAGGGCGCGGTGCTCGTCGGGG + Intronic
970615713 4:17766853-17766875 GCAGGGGGCAGCGCTCATTGGGG + Intronic
970649280 4:18159314-18159336 GCAGGGGGCGGCGCTCGTCAGGG + Intergenic
970803574 4:20004331-20004353 GCAGGAGGCGGCGCTTGTCGGGG - Intergenic
970817837 4:20179055-20179077 GCAGGGGGCGGCGCTTTTCAGGG + Intergenic
971280490 4:25239286-25239308 GCAGGGGGTGGCGCTTGTTGGGG + Intronic
971281636 4:25246668-25246690 GCAGAGGGTGGTGCTTGTTGGGG + Intronic
971552993 4:27978379-27978401 GCAGGGGGTGGTGCTCGTCGGGG + Intergenic
971563607 4:28113094-28113116 GCAGGGGGCGGTGCTCGTCGGGG - Intergenic
971639869 4:29117670-29117692 GCAGGGGACGGCGCTCATCCGGG - Intergenic
971792306 4:31185013-31185035 GCAGGGGGCGGCACTCGTTGGGG + Intergenic
971811998 4:31438968-31438990 GCAGGGGGTGGTGCTCATCGGGG - Intergenic
971852152 4:31996734-31996756 GCAGGGGGCGGCGCTCGTTGGGG - Intergenic
971905147 4:32716269-32716291 GCAGGGGGCGGTGCTCATCGGGG + Intergenic
972022744 4:34335685-34335707 GCAGGGGGCGGCGCTCATCGGGG + Intergenic
972034756 4:34506665-34506687 GCAGGGGGCGGCATTCATCGGGG + Intergenic
972173419 4:36375264-36375286 GCGGGGGGCAGCGCTCGTCAGGG - Intergenic
972344689 4:38182886-38182908 GCAGGGGGCGGAGCTCATTGGGG - Intergenic
972778691 4:42266332-42266354 GCAGGGGGTGGCGCCCGTCGGGG - Intergenic
972890511 4:43551528-43551550 GCAGGGGGCGGTGCTCATCGGGG - Intergenic
972900173 4:43672674-43672696 GCAGGGGGTGGTGCTCGTCGGGG - Intergenic
973039894 4:45457161-45457183 GCAGGGGGCGGCACTCATCGGGG + Intergenic
973041761 4:45477395-45477417 GCAGGGCGCGGCGCTCATCAGGG + Intergenic
973048619 4:45567369-45567391 GCAGGGGGTGGGGCTCGTTGGGG - Intergenic
973142132 4:46781976-46781998 GCAGGGGGCGGCGCCCATCAGGG - Intronic
973144222 4:46804874-46804896 GCAGGGGGCTGTGCACGTCGGGG + Intronic
973146368 4:46831364-46831386 GCCGGGGGTGGCACTCGTTGAGG - Intronic
973190266 4:47378087-47378109 GCAGGGGGTGGCGCTTGTCAGGG + Intronic
973308125 4:48675657-48675679 GCAGGGAGTGGTGCTCGTCGGGG - Intronic
973587718 4:52409790-52409812 GCAGGGGGTGGTGCTCGTCGGGG + Intergenic
973765046 4:54155168-54155190 GCAAGGGGCAACGCTCGTCGGGG + Intronic
973817633 4:54632852-54632874 GCAGGGGTCAGCGCTCGTGGGGG - Intergenic
973878154 4:55241772-55241794 GCAGGGGGCGGTGCTCATTGGGG - Intergenic
974147465 4:57965741-57965763 GCAGGGGGTGGTGCTCGTTGGGG - Intergenic
974484740 4:62491941-62491963 GCAGGGGGTGGCGCTCCTCGGGG + Intergenic
974641700 4:64640517-64640539 GCAGGGGGTAGTGCTCCTCCGGG + Intergenic
974781700 4:66561536-66561558 GCAGGGGGCGGTGCTCGTCGGGG + Intergenic
974792723 4:66712461-66712483 GCAGGGGGTGGTGCTGGTCGGGG + Intergenic
974804431 4:66860485-66860507 GCAGGGGGTGGTGCTCGTCGGGG - Intergenic
974807522 4:66899505-66899527 GCAGGGGGTGGTGTTCATTGGGG + Intergenic
974819285 4:67045742-67045764 GCAGGGGGTGGGGGTCATGGGGG - Intergenic
974827808 4:67152196-67152218 GCAGGGGGCAGCGCTCTTCCAGG - Intergenic
974838190 4:67275294-67275316 GCAGGGGGTGGCGCCCATCAGGG + Intergenic
974992827 4:69115288-69115310 GCAGGGGGCGGCACTCGTCGGGG + Intronic
975028013 4:69576416-69576438 GCAGAGGGTGGCGCTCCCTGGGG + Intergenic
975055447 4:69924207-69924229 GCAGGGGGCAGCGCTCATCTGGG - Intergenic
975439905 4:74399108-74399130 GCAGGGGGCGGCGCTCTTTGGGG + Intergenic
975595142 4:76043339-76043361 GCAGGGGGTGGCACTCGTCAGGG + Intronic
975596319 4:76050701-76050723 GCAGGGGGTGGCACTTGTCGCGG + Intronic
975898481 4:79122249-79122271 GCAGGGGGCGGCGTTCGTCGGGG - Intergenic
975994976 4:80303111-80303133 ACAGGGGGCGGCGCTCCTTGGGG - Intronic
976406426 4:84665007-84665029 GCAGGGGGTGGCGCTCATCGGGG - Intergenic
976520584 4:86021651-86021673 GCAGGGGGTGGTGCTCGTCGGGG + Intronic
976565569 4:86547571-86547593 GCAGGGGGCGGCGCTCTTAGGGG - Intronic
976646823 4:87395990-87396012 GCAGGGGTTGGTGCTCCTTGGGG + Intergenic
976846107 4:89490319-89490341 GCCGGGGGCAGCGCTCGTGGGGG - Intergenic
976980249 4:91218014-91218036 GCAGGGGGTGGTGCTTGTCGGGG + Intronic
977206572 4:94170161-94170183 GCAGGGGGCGGCGCTCGTCTGGG - Intergenic
977400127 4:96521441-96521463 GCAGGGGGTAGCACCCGTCAGGG - Intergenic
977416701 4:96742835-96742857 GCAGGGGACGGCGCTCATCGGGG - Intergenic
977470653 4:97438126-97438148 GCAGGGGGCAGCGCTCATCAGGG + Intronic
977507737 4:97923337-97923359 GCAGGGGGCGGCACTTGTCGGGG - Intronic
977750919 4:100608809-100608831 GCAGGGGGTGGTGCTCGTCGGGG + Intronic
978030646 4:103937111-103937133 GCAGGGAGCGACGCTCATCGGGG - Intergenic
978080298 4:104582297-104582319 GCAGGGGGTGGCGCTCGTCCAGG - Intergenic
978207149 4:106092443-106092465 GCAGGGGGCAGCACTCGTTGGGG + Intronic
978241840 4:106525389-106525411 GCAGGGGGCGGCGCTCATCGAGG + Intergenic
978285629 4:107073511-107073533 GCAGGGGGTAGCGCTCCTCGGGG - Intronic
978466303 4:109012788-109012810 GCAGGGGGCGGCACCCGTCAGGG - Intronic
978917935 4:114148624-114148646 GCAGGGGGCAGTGCTCGTCAGGG + Intergenic
978997999 4:115179475-115179497 GCAGGGGGTGGCGCTTGTTGGGG + Intergenic
978999532 4:115200238-115200260 GCAGGGGGCAGCGCTCATCAGGG + Intergenic
979224237 4:118265870-118265892 GCAGGGGGCGGCGCTCGTTGGGG - Intergenic
979290770 4:118977094-118977116 GCAGGGGGTGGTGCTCGTCAGGG + Intronic
979308370 4:119174102-119174124 GCAGGAGGTGGCACTCGTCGGGG - Intronic
979424705 4:120550781-120550803 GCAGGGGGTGGCACTCGTCGGGG + Intergenic
979678564 4:123435408-123435430 GCAGGGGTCAGCGCCCGTCGGGG + Intergenic
979688639 4:123538233-123538255 GCAGGGGGTGGCACTCATAGAGG - Intergenic
979755910 4:124339328-124339350 GCAGGGGGCGGCACTCCTTGGGG - Intergenic
979825658 4:125229626-125229648 GCAGCGGGTGGCACTCATCGGGG + Intergenic
979899661 4:126201335-126201357 GCAGGCGGCGGCGCTCATCGGGG + Intergenic
979949468 4:126874499-126874521 GCAGGGGGTGGTGCTTGTAGGGG + Intergenic
979991509 4:127380251-127380273 GCAGGGGGTGGCACTTGTCGGGG - Intergenic
980043332 4:127964281-127964303 GTAGGGAGCGGCGCTCATCGGGG + Intronic
980051884 4:128047603-128047625 GCAGGGGGCGGCGCTCGTCGGGG + Intergenic
980228027 4:130013096-130013118 GCAGGGGGCGGTGCTCGTCGGGG - Intergenic
980230211 4:130038590-130038612 GCAGGGGGCGGCGCTTGTCGGGG + Intergenic
980470183 4:133240451-133240473 GCAGGGGGTGGTGCTCGTCGGGG + Intergenic
980563059 4:134502112-134502134 GCAGGGGGCGGTGCCCGTCAGGG - Intergenic
980595388 4:134948195-134948217 GCAGGGGGTGGCGCCTGTCGGGG + Intergenic
980628638 4:135406935-135406957 GCAGGGGGTGGTGCTCGTCGGGG - Intergenic
980698793 4:136395633-136395655 GCAGGCGGCGGCGCTCATCTGGG - Intergenic
980799807 4:137734052-137734074 GCAGGGGGTGGCACTGGTTGGGG - Intergenic
980815603 4:137942387-137942409 GCAGGGGGTGGCGCTCGTCGGGG - Intergenic
980824069 4:138052989-138053011 GCAGGGGGCGGCGCTCCTAGGGG + Intergenic
980827284 4:138088633-138088655 GCAGGGGGCGGCGCTCGTTGGGG + Intergenic
981136245 4:141213863-141213885 GCATGGGGTGGCGCCTGTCGGGG - Intergenic
981146675 4:141333062-141333084 GCAGGGGATGGCGCTCCTCGAGG + Intergenic
981169523 4:141605476-141605498 GCAGGGGGTGGTGCTCCTCGGGG + Intergenic
981176544 4:141689902-141689924 GCAGGGGGCGGTGCTCATCGGGG + Intronic
981275860 4:142897813-142897835 GCAGGGGGCGGCGCTCATCGGGG - Intergenic
981280642 4:142954577-142954599 GCAGGGGGTGGCGCCCGCTGGGG - Intergenic
982408273 4:155044619-155044641 GCAGGGGGTGGTGCTCGTTGGGG - Intergenic
982728235 4:158928018-158928040 GCAGGGGGCGGCGCTCATTGAGG - Intronic
982768982 4:159378408-159378430 GCAGGGGGTGGTGCCTGTCAGGG - Intergenic
982814534 4:159869076-159869098 GCAGGGGGTGGCGCTCGTCAAGG + Intergenic
982863437 4:160482085-160482107 GCAGGGGGCGGCCCTCGTCGGGG - Intergenic
982868756 4:160550151-160550173 GCAGGGGGCGGTGCTCATGGGGG + Intergenic
982921312 4:161277544-161277566 GCAGGGGGCGGCGCTCGTCGGGG - Intergenic
983026144 4:162739857-162739879 GCAGGGGGTGGCACTCGTCGAGG - Intergenic
983060382 4:163153162-163153184 GCAGGGGGTGGTATTCGTCCGGG - Intronic
983064043 4:163189759-163189781 GCAGGGGGTGGCGCTCGTCGGGG + Intergenic
983134980 4:164068670-164068692 GCAGGGGGCGGCACTCGTCAGGG - Intronic
983230615 4:165125983-165126005 GCAGGGGGCGGCGCTTGTCGGGG + Intronic
983238717 4:165207726-165207748 GCAGGTGGTGGCGCGCGGTGAGG + Intronic
983290626 4:165799440-165799462 GCAGGGTGTGGGGCTCGTCGAGG + Intergenic
983369722 4:166842883-166842905 GCAGGGGATGGTGCCCATCGAGG + Intronic
983425752 4:167581872-167581894 GCAGGGGGTGGCGCCCCTCAGGG - Intergenic
983553009 4:169035879-169035901 GCAGGGGGTGGTGCTCGTCAGGG + Intergenic
983656784 4:170091547-170091569 GCAGGGGGCGGCACTCGTCAGGG - Intronic
983734759 4:171043474-171043496 GCAGGGGGCGGCGCTCGTCCGGG - Intergenic
983752890 4:171298594-171298616 GCAGGGGGCGGCGCTCGTCGCGG - Intergenic
983834193 4:172369517-172369539 GCAGGGGGTGGCACCCGTCGGGG + Intronic
983843134 4:172481930-172481952 GCAGGGGGCAGTGCCCGTCGGGG + Intronic
984192789 4:176625209-176625231 GCAGGGGGCGGCGCTCATCAGGG + Intergenic
984238770 4:177193240-177193262 GCAGGGGGTGGCGCTCGTCGAGG + Intergenic
984241796 4:177227609-177227631 GCAGGGGGTGGCCCTCGTCGGGG + Intergenic
984265707 4:177495908-177495930 GCAGGGGGTGGCGCTCATCCGGG - Intergenic
984662294 4:182386866-182386888 ACAGGGGGCGGCATTCGTCGGGG - Intronic
984728695 4:183045382-183045404 GCAGGGGGCAGCGCTTGTTGGGG - Intergenic
984770612 4:183433461-183433483 GCAGGGGGCGGTGCTCGTTGGGG - Intergenic
984776066 4:183482736-183482758 GCAGGGGGTGGAGCTCGTCAGGG + Intergenic
984901788 4:184592182-184592204 GCAGGGGGCGGCTCTCGTCGGGG - Intergenic
984918151 4:184741520-184741542 GCAGGGGGTGATGCTTGTCGGGG - Intergenic
985145473 4:186890431-186890453 ACATGGGGCAGCGCTCGTCGGGG - Intergenic
985195068 4:187420666-187420688 GCAGGGGGTGGTGCTCGTCGGGG + Intergenic
985403558 4:189615262-189615284 GCAGGGGGCGGCGCTCATCAGGG + Intergenic
986152050 5:5138102-5138124 GCAGGGGGTGGCGCTCCTTGGGG - Intergenic
986626220 5:9725644-9725666 GCAGGGGGCGGTGCTCGTCGGGG - Intergenic
986661801 5:10065820-10065842 GCAGGGGGCAGCGCTCCTCGGGG - Intergenic
986698042 5:10375473-10375495 GCAGAGGGTGGTGCTCGTCGGGG - Intronic
986912338 5:12573988-12574010 GCAGGGGGTGGCGCTCGCCGGGG + Intergenic
986912496 5:12574558-12574580 GCAGGGGGCGGCGCTCGTCGGGG + Intergenic
986919072 5:12662220-12662242 GCAGGGGGCGGCGCCCATCAGGG - Intergenic
986963636 5:13244502-13244524 GCAGAGGGTGGCGCTTGTCGGGG - Intergenic
986993318 5:13578788-13578810 GCAGGGGGCGGCGCTCGTCCGGG - Intergenic
987146204 5:14993850-14993872 GCAGGGGGCGGCGCTCATCGGGG + Intergenic
987283776 5:16436497-16436519 GCAGGGGGTGGTGCTCATTGGGG - Intergenic
987315340 5:16718268-16718290 GCAGGGGGCGGTGCTCGTCAGGG - Intronic
987352241 5:17032472-17032494 GCAGGGGGCGGTGCTCGTCGCGG + Intergenic
987355885 5:17062506-17062528 GCAGGGGGCGGCGCTCCTCGGGG - Intergenic
987383964 5:17311817-17311839 GCAGGGGGTGGCGCTCGTCGGGG + Intergenic
987476637 5:18399704-18399726 GCAGGGGGCGGCGCTCATCGGGG + Intergenic
987532735 5:19142814-19142836 GCAGGGGGTGACACTCGTCGGGG + Intergenic
987543878 5:19288061-19288083 GCAGAGGGCGGCGCTCATCGGGG - Intergenic
987876996 5:23691441-23691463 GCAGGGGGTGGTGCTCGTCAGGG - Intergenic
987896336 5:23951613-23951635 GCAGGGGGCGGCGCTCATCCGGG - Exonic
988132205 5:27120216-27120238 GCAGGGGGTGGTGCTCGTCCGGG - Intronic
988155006 5:27439494-27439516 GCAGGGGGTGGTGCTCGTCGGGG + Intergenic
988177317 5:27743778-27743800 GCAGGGGGTGGTGCTCGTCGAGG - Intergenic
988201736 5:28077712-28077734 GCAGGGGGCGGGGCTCGTCCGGG + Intergenic
988279510 5:29127666-29127688 GCAGAGGGCGGCTCTCATCGGGG + Intergenic
988291721 5:29296535-29296557 GCAGGGGGCGACGCTCGTCGGGG + Intergenic
988369310 5:30346069-30346091 GCAGGGGGTGGCGCTCATCGGGG - Intergenic
988489101 5:31692057-31692079 GCACGGGGTGGCGCTCATTGGGG + Intronic
988500190 5:31777432-31777454 GCAGGGGGCGGCGCCCGTCGGGG - Intronic
988883641 5:35531944-35531966 GCAGGGGGCGGTGCTCGTCGGGG - Intergenic
988915852 5:35892911-35892933 GCAGGGGGTGGTGCTCGTTGGGG + Intergenic
989003246 5:36782897-36782919 GCAGGGGGCGGCTCTCATCGGGG - Intergenic
989346841 5:40438976-40438998 GCAGGGGGTGGTGCTCGTTGGGG - Intergenic
989750188 5:44883973-44883995 GCAAGGGGTGGCGCTCCTTGGGG + Intergenic
989957972 5:50377147-50377169 GCAGGGGGTGGCGATCATCGGGG - Intergenic
989965871 5:50465330-50465352 GCAGGGGGCGGTGCTGGTCCGGG - Intergenic
990323129 5:54649062-54649084 GCAGGGGGCGGTGCTCCTCGGGG + Intergenic
990345314 5:54865393-54865415 GCAGGGGGCGGCTCTCATCGAGG - Intergenic
990419013 5:55613667-55613689 CCAGGGAGCGGCGCTCGTCGGGG - Intergenic
990665674 5:58069181-58069203 GCAGGGGGCAGCGCTTGTCGGGG + Intergenic
990869514 5:60415732-60415754 GCAGGGGGCAGCGCTTGTCAGGG - Intronic
990880271 5:60530614-60530636 GCAGGGAGTGGCGCTCCTCGTGG - Intergenic
991330191 5:65485517-65485539 GCAGCGGGCAGTGCTCGTCGGGG + Intergenic
991427125 5:66503551-66503573 GCAGGGGGTGGCGCTCGTCGGGG - Intergenic
991567515 5:68020446-68020468 GCAGGGGGCGGCGCTCATCGGGG + Intergenic
992048915 5:72925807-72925829 GCAGGGGGCGGCACCCGTCGAGG - Intergenic
992050404 5:72935554-72935576 GCAGGGGGTGGTGCCCGTCGGGG - Intergenic
993031919 5:82715006-82715028 GCAGGGGGCGGTGCTTGTTGAGG - Intergenic
993320889 5:86466725-86466747 GCAGGGGGTGGTGCTCGTCGGGG + Intergenic
993328526 5:86569565-86569587 GCAGGGGGCGGTGCTCGTCGGGG + Intergenic
993529144 5:89003667-89003689 AGCGGGGGCGGCGCTCGTCGGGG + Intergenic
993678561 5:90847561-90847583 GCAGGGGGAGGTGCTTGTCAGGG + Intronic
993770338 5:91917591-91917613 GCAGGGGGCGGCGCCCATCGGGG - Intergenic
993822083 5:92631648-92631670 GCAGGGGGCGGCGCTCATCGGGG - Intergenic
994096385 5:95851483-95851505 GCAGGGGGCGGCGCTCGTCGGGG - Intergenic
994167062 5:96618826-96618848 GCAGGGGGCAGCGCCTGTCGGGG - Intronic
994210730 5:97085272-97085294 GCAGGGGGTGGCGCCTGTCAGGG + Intergenic
994230013 5:97301465-97301487 GCAGGGGGCAGTGCTCATCGCGG - Intergenic
994254750 5:97580038-97580060 GCAGGGGGTGGCGCTACTCGGGG + Intergenic
994507162 5:100657079-100657101 GCAGGGGGCGGCGCTCATCCGGG - Intergenic
994509795 5:100688912-100688934 GCAGGGACCGGCGCTCGTCGGGG + Intergenic
994605555 5:101962489-101962511 GCAGGGGGTGGTGCTCGCTGGGG + Intergenic
994647721 5:102491435-102491457 GCAGGGGGCGGCACTCGTTGGGG + Intronic
994669801 5:102752390-102752412 GCAGGGGGCAGCGCTAGTCTAGG - Intergenic
994701655 5:103142078-103142100 GCAGGGGGTGGTGCTCGTTGGGG + Intronic
994769742 5:103966369-103966391 GCGGGTGGGGGCGCTCATCGGGG + Intergenic
994932399 5:106206133-106206155 GCAGGGGGCGGCACTCGTAGGGG + Intergenic
994935325 5:106246527-106246549 GCAGGGGGCGGCGCTCGTCGGGG - Intergenic
995206615 5:109487893-109487915 GCAGGGGGCGGCGCTTGTCGCGG + Intergenic
995388287 5:111612195-111612217 GCAGGGGGTGGCGCTACTCAGGG + Intergenic
995529182 5:113075352-113075374 GCAGGGGGCGGCACCCATCGGGG - Intronic
995596410 5:113753162-113753184 GCAGGGGGTGGTGCTCGTCGGGG + Intergenic
995656553 5:114432997-114433019 GCAGGGGGTGGCGCTCATCAGGG - Intronic
995679826 5:114704332-114704354 GTAGGGGGTGGTGCTCGTCGGGG + Intergenic
995700446 5:114929223-114929245 GCAGGGGGCAGCGCTCCTAGGGG - Intergenic
995975874 5:118034142-118034164 GCAGGGGGCGGTGCTCGTCGGGG - Intergenic
995988390 5:118207992-118208014 GCAGGGGGCAGCACTCATCGGGG + Intergenic
996107090 5:119517421-119517443 GCAGGGGGTGGCACTCCTCAGGG - Intronic
996234267 5:121107493-121107515 GCAGGGGGCAGTGCTCATCGGGG - Intergenic
996435740 5:123430866-123430888 GCAGGGGGTGGCGCTCGTCGAGG - Intergenic
996478655 5:123949233-123949255 GCAGGGGGTGGCACTCCTCAGGG + Intergenic
996586028 5:125088971-125088993 GCAGGGGGCGGAGCTTGTCGGGG - Intergenic
996815612 5:127569729-127569751 GCAGGGGACGCCGCTCGTCGGGG - Intergenic
997158147 5:131580080-131580102 GCAGGGGGTGGCACCCATTGGGG + Intronic
997282145 5:132656127-132656149 GCAGGGGCTGCCGCTCGGCCGGG + Intergenic
997375550 5:133394667-133394689 GCAGGTGGCGGCGCTCGTTGGGG - Intronic
997466378 5:134090666-134090688 GCAGGGGGTGGGGCTGGGGGTGG - Intergenic
997760607 5:136444531-136444553 GCAGGGGGCGGTGCTCATCAGGG - Intergenic
999348587 5:150845743-150845765 GCAGGGAGCGGCGCTCATAGGGG - Intergenic
999406227 5:151309509-151309531 GCAGGGGGCAGCGCTCATCGGGG - Intergenic
999696311 5:154190893-154190915 GCAGGCGGTGGCGCTGGTGCTGG + Exonic
999855238 5:155586796-155586818 GCAGGGGGCGGTGCTCGTTGGGG + Intergenic
1000066082 5:157694155-157694177 GCAGGGGGCGGCGCTCATCAGGG - Intergenic
1000084791 5:157879594-157879616 GCAGGGGGTGGCACCTGTTGGGG - Intergenic
1000329142 5:160193940-160193962 GCAGGGGGCGGCGCTCGTCGGGG + Intronic
1000345694 5:160312062-160312084 GCAGGAGGGGGCGCCCGCCGGGG - Intronic
1000547659 5:162622162-162622184 GCAGGGGGCAGCGCTCGTCAGGG - Intergenic
1000609181 5:163356130-163356152 GCAGGGGGTGGCACTTGTTGGGG - Intergenic
1000889284 5:166784585-166784607 GCAGGAGGCGGCACTCGTCGGGG + Intergenic
1001636490 5:173213748-173213770 GCAGGGGGCGGCGCTCGTCGGGG - Intergenic
1001841590 5:174880988-174881010 GCAGGGGGAGGCACTTGTCGGGG - Intergenic
1001843610 5:174901835-174901857 GCAGGGGGAGGTGCTTGTCAGGG - Intergenic
1002004588 5:176222069-176222091 GCAGGGGGCGGTGCTCGTCGGGG + Intergenic
1002221790 5:177688551-177688573 GCAGGGGGCAGTGCTCGTCGGGG - Intergenic
1002556499 5:180045998-180046020 GCAGGGGGCAGCGCTCGCCGGGG + Intronic
1002616500 5:180459491-180459513 GCACGGGGTGGCGCTCGTCAGGG - Intergenic
1002789333 6:426244-426266 GCACGGGGCGGCGCTCATCGGGG + Intergenic
1002793247 6:450285-450307 GCAGGGGGCAGCGCTCGTCGGGG - Intergenic
1002817746 6:694898-694920 GCAGGGGGCAGCGCTCGTCGGGG - Intergenic
1002906982 6:1457014-1457036 GCAGGGGGTGGCGCTCGTCGGGG + Intergenic
1003060771 6:2860457-2860479 GCAGGGGGTGGTGCTTGTCGGGG - Intergenic
1003069717 6:2936135-2936157 GCAGGGGGCGGTGCTCGTTGGGG - Intergenic
1003081958 6:3028018-3028040 GCAGGAGGCGGCGCTCTTGGGGG - Intergenic
1003100239 6:3171081-3171103 GCAGGGGGCGGCGCTCATCGGGG - Intergenic
1003111318 6:3253882-3253904 GCAGGGGGTGGCACTTGCCGGGG - Intronic
1003170803 6:3720808-3720830 GCAGGGGGTGGTGCTCGTCGGGG + Intergenic
1003176905 6:3758434-3758456 GCAGGGCGCGGCGCTCGTCGGGG - Intergenic
1003178521 6:3771908-3771930 GCAGGGTGCGGTGCTCGTCGGGG - Intergenic
1003284810 6:4725374-4725396 GCAGGGGGCGGCGCTCGTGGGGG + Intronic
1003489188 6:6606517-6606539 GCAGGGGGCGGCGCTCGTCGGGG + Intronic
1003506641 6:6745760-6745782 GCAGGGAGCGGCGCTTGTCGGGG + Intergenic
1003508791 6:6762524-6762546 GCAGGGGGTGGCACTCGTTGGGG + Intergenic
1003531422 6:6940406-6940428 GCAGAGGCCGGCGCTCGACGGGG - Intergenic
1003578074 6:7315491-7315513 GCAGGGGGTGGCGCTGGTCGGGG - Intronic
1003578276 6:7316867-7316889 GCTGGGGGTGGCGCTCGTCGGGG + Intronic
1003581487 6:7344532-7344554 GCAGGGGGCGGCGCTCATCCAGG - Intronic
1003589642 6:7426054-7426076 GCAGGGGGCGGTACTCGTCGGGG - Intergenic
1003591658 6:7441536-7441558 GTAGGGGGCGGCGCTCGTCCGGG - Intergenic
1003671584 6:8164650-8164672 GCAGGGGGTGGCACTAGTCGGGG - Intergenic
1003717617 6:8665823-8665845 GCAGGGGGTGGTGCTCGTCGAGG + Intergenic
1003717750 6:8666285-8666307 GCAGGGGGTGGTGCTCGTCGAGG - Intergenic
1003748059 6:9024583-9024605 GCAGGGGGCGGCGCTCATCGGGG - Intergenic
1003749609 6:9041007-9041029 TCAGGGGGCTGCGCTCGTCGGGG - Intergenic
1003770107 6:9290487-9290509 GCAGGGGGCAGCGCTCACCGGGG + Intergenic
1003824968 6:9942510-9942532 GCAGGGGGCGGCGCTCGTGGGGG - Intronic
1003836171 6:10074753-10074775 GCAGGGGGTGGCGCTCGCCGGGG + Intronic
1003845774 6:10172041-10172063 GCAGGGGGTGGCGCTCGTTGGGG - Intronic
1003862840 6:10337728-10337750 GCAGGGGGTGGTGCTCGTAGGGG - Intergenic
1003882026 6:10487841-10487863 GCACGGAGTGGTGCTCATCGGGG + Intergenic
1003896979 6:10617103-10617125 GCAGGGAGGGGTGCTCGTTGGGG + Intronic
1003908177 6:10720906-10720928 GCAGGGGGTGGTGCTCATCAGGG - Intergenic
1003947325 6:11087534-11087556 GCAGTGGGTGGCGCTCACTGGGG - Intergenic
1003983924 6:11417040-11417062 GCAGGGGGCGGTGCCCGTTGCGG + Intergenic
1004037016 6:11933398-11933420 GGAGGGGGCAGCGCTCATCGGGG - Intergenic
1004045318 6:12017966-12017988 ACAGGGGGCAGCGCTCATCGGGG + Intronic
1004053105 6:12108433-12108455 GCAGGGGGCGGCGCTCATCGGGG + Intronic
1004196539 6:13511079-13511101 GCAGGGGGCGGCGCTCGTCAGGG + Intergenic
1004200312 6:13541857-13541879 GCAGGGGGCGGCGCTCGTTGAGG - Intergenic
1004220664 6:13743526-13743548 ACAGGGGGCGGCGCTCGTCGGGG - Intergenic
1004224439 6:13772806-13772828 GCAGGGGGTGGCGCTCATTGGGG - Intergenic
1004235499 6:13871965-13871987 GCAGGGGGCGGCGCTCGTCGGGG + Intergenic
1004250357 6:14018313-14018335 GCAGGGGGCGGCGCTCATCAGGG - Intergenic
1004338179 6:14783647-14783669 GCAGGGGGCGGCGCTCGTCGGGG + Intergenic
1004452344 6:15758801-15758823 GCAGGGGGCGGCACTCGTTTGGG + Intergenic
1004486226 6:16069244-16069266 GTAGGGGATGGCGCTCGTGGGGG + Intergenic
1004497730 6:16180764-16180786 GCAGGGGGCGGCGCTCGTTCGGG + Intergenic
1004499630 6:16198144-16198166 GCAGGAGGCGGCGCTCGTCGGGG + Intergenic
1004501942 6:16217143-16217165 GCAGGGGGCTGTGCTTGTCGGGG - Intergenic
1004503141 6:16226914-16226936 GCAGGGGGCGGCACTCTTCGGGG + Intergenic
1004511694 6:16288572-16288594 GCAGGGGGCGGCGCTCATTAGGG - Intronic
1004519347 6:16347156-16347178 GCAGGGGGCGGCGCTCGTCGGGG - Intronic
1004647952 6:17580936-17580958 GCAGGGGGCGGCGATCGTCAGGG - Intergenic
1004663358 6:17729071-17729093 GCAGGGGGCGGCGCTTGTCGGGG - Intergenic
1004665487 6:17745351-17745373 GCAGGGGGTGGCACTCGTAGGGG + Intergenic
1004689046 6:17976231-17976253 GAAGGGGCCGGCGCTCGTCAGGG + Intronic
1004694282 6:18019720-18019742 GCAGAGGGCGGCGATTGTCGGGG + Intergenic
1004905464 6:20233490-20233512 GCAGGGGGTGGCACTCGTCAGGG - Intergenic
1004906251 6:20239333-20239355 GCAGGGGGCAGCGCTCCTCGGGG - Intergenic
1004906890 6:20244814-20244836 GCAGGAGGTGGGGCTCGTTGGGG + Intergenic
1004912671 6:20301569-20301591 GCAGGGGGCGGCGCTCGTCAGGG - Intergenic
1004914482 6:20319196-20319218 GCAGGGAGCGGCGCTCGTAGGGG - Intergenic
1005035522 6:21552326-21552348 GTAGGGGGTGGTGCTCGTCGGGG + Intergenic
1005114226 6:22318469-22318491 GCAGGGGGTGGTGCCCATTGGGG + Intergenic
1005117679 6:22356440-22356462 GCAGGGGGTGGGGCTGGTGGGGG + Intergenic
1005332832 6:24765979-24766001 GCAGGAGGTGGTGCTCGTCGGGG + Intergenic
1005561475 6:27045549-27045571 GTAGGGGGCGGCGCTCGTCGGGG - Intergenic
1005596164 6:27381111-27381133 GCAGGGGGCGGCGCTCATCGGGG + Intronic
1005600821 6:27424871-27424893 ACAGGGGGTGGCGCTCGTCGGGG + Intergenic
1005707400 6:28469397-28469419 GCAGCGGGCGGCGCTCGTCGGGG + Intergenic
1005712050 6:28512103-28512125 GCAGGGGGCGGTGCTCGTCGGGG - Intronic
1005725019 6:28639828-28639850 GCAGGGGGCGGCTCTAGTCTGGG + Intergenic
1005749035 6:28866527-28866549 GCAGGGGGCGGCGCTCGTCGGGG + Intergenic
1005749875 6:28872635-28872657 GCAGGGGGTGGCGCTCGTCCGGG + Intergenic
1005751260 6:28885178-28885200 GCAGGGGGCGGCGCCCATCAGGG + Intergenic
1005758849 6:28949837-28949859 GCAGGGGGCGGCGCTCGTCGGGG + Intergenic
1005759852 6:28958161-28958183 GTAGGGGGTGGTGCTCGTCCGGG - Intergenic
1005766360 6:29015395-29015417 GCAGGGGGCGGCAATCGTCGGGG - Intergenic
1005976960 6:30807485-30807507 GCAGGGGGTGGTGCTCGTCGGGG + Intergenic
1005978189 6:30816341-30816363 GCAGGGGGCGGCGCTCGTCGGGG + Intergenic
1006005820 6:31000782-31000804 GCAGGGGGTGGCACTCGTCGGGG - Intergenic
1006007868 6:31017115-31017137 GCAAGGGGCAGCGCTCGTCTGGG - Intronic
1006008353 6:31021037-31021059 GCAGGGGGCGGCGCTCATCGGGG - Intronic
1006033683 6:31195778-31195800 GCAGGGGGTGGTGCTCGTCGAGG - Intergenic
1006127995 6:31852332-31852354 GCAGGGGGTGGCGCTCGTCGGGG - Intergenic
1006227021 6:32547967-32547989 GCAGGGGGTGGTGCTCGTCCGGG + Intergenic
1006351048 6:33521553-33521575 GCAAGGGGCGGCGCCCGTCGGGG + Intergenic
1006352690 6:33532707-33532729 GCAGGGGGTGGTGCTCGTCCGGG - Intergenic
1006477878 6:34269343-34269365 GCAGGGGGTGGTGCTCGTTGGGG - Intergenic
1006696053 6:35931587-35931609 GCAGGGGGCGGCACTCATCGGGG - Intergenic
1006748853 6:36364275-36364297 GCAGGGGGTGGCGCTCGTCGGGG + Intronic
1006978319 6:38124372-38124394 GCAGGGGGCGGCGCTCCTAGGGG + Intronic
1007738770 6:43998373-43998395 GCAGGGGGTGGCGCTCGTCGGGG - Intergenic
1008005544 6:46405810-46405832 GCAGGGGGTGGTGCTCCTCTGGG + Intronic
1008038833 6:46774915-46774937 GCAGGGGGCGGGGCTTGTCGGGG - Intergenic
1008254114 6:49275760-49275782 GCAGGGGGCGGCACTCATCGGGG - Intergenic
1008270140 6:49481870-49481892 GCAGGGGGCAGCACTCATCGGGG + Intronic
1008270449 6:49483465-49483487 GCAGGGGGCGGCGCTCATGGGGG + Intronic
1008284294 6:49629593-49629615 GCAGGGGGTGGCGTTCATCGGGG + Intronic
1008567871 6:52786801-52786823 GCAGGGGGCAGCGCTCGTTGGGG - Intergenic
1008771043 6:54979553-54979575 GCAGGGGGTGGTGCTCGTCGGGG - Intergenic
1009402652 6:63275027-63275049 GCAGGGGGCGGCCCTCGTCTGGG + Intergenic
1009407062 6:63326494-63326516 GCAGGGGGTGGCGCTTGTTGAGG + Intergenic
1009431643 6:63572608-63572630 GCAGGAGGCGGCGGTGGTCGTGG - Exonic
1009470313 6:64024051-64024073 GCAGGGGGTGGCACTCATCGGGG - Intronic
1009510766 6:64547769-64547791 GCAGGGGGCGGCGTTGGTCGGGG + Intronic
1009587694 6:65627858-65627880 GCAGGGGGTGGTGCTCGCTGGGG - Intronic
1009800759 6:68533707-68533729 GCAGGGAGCGGCACTCCTCGGGG - Intergenic
1010199268 6:73268917-73268939 GCAGGGGGTGGTGCTCGTCGGGG + Intronic
1010235599 6:73572579-73572601 GCAGGGGGTGGCACTTGTCGGGG + Intergenic
1010617430 6:78030119-78030141 GCAGGGGGCGGCATTCGTCGGGG - Intergenic
1011129284 6:84037522-84037544 GCAGGGGGCGGCGCCCGTTGGGG + Intronic
1011143738 6:84189685-84189707 GCAGGGGGTGGTGCTCGTCGGGG - Intronic
1011178157 6:84587703-84587725 GCAGGGGGTGGTGCTCATCGGGG - Intergenic
1011246567 6:85326285-85326307 GCAGGGGGCGGCATTCGTCAGGG - Intergenic
1011601631 6:89065230-89065252 GCAGGGGGCGGCATTTGTCGGGG - Intergenic
1011603454 6:89080915-89080937 GCAGCGGGAGCCGCTCGTCCTGG + Exonic
1011620057 6:89234532-89234554 GCAGGGGGCGGTGCTCGTTGGGG + Intergenic
1011870039 6:91881937-91881959 GCAGGGGGTGGTGCTTGTCGGGG + Intergenic
1011974804 6:93282922-93282944 GAAGGGGGCAGCGCTCCTCGGGG - Intronic
1012145065 6:95670359-95670381 GCAGGGGGTGGCGCTAGTCGGGG - Intergenic
1012189297 6:96260989-96261011 GCAGGGGGCGGCGCTTGTCGGGG + Intergenic
1012578185 6:100829275-100829297 GCAGGGGGCGGCGCTCATGGAGG + Intronic
1012598444 6:101066714-101066736 GCAGGGGGTGGCACCTGTCAGGG + Intergenic
1012598901 6:101070577-101070599 GCAGGGGGCAGTGCTCGTCGGGG - Intergenic
1012760455 6:103294447-103294469 GCAGGGGGTGGCGCTCATCTGGG + Intergenic
1012851031 6:104446604-104446626 GCAGGGGGTGGCGCTCGTCGGGG - Intergenic
1013025671 6:106269450-106269472 GCAGAGGGCGGCACTCGTCAGGG + Intronic
1013081436 6:106816805-106816827 GCAGGGGGTGGTGCTCGTCGGGG + Intergenic
1013143518 6:107364288-107364310 GTAGGGAGTGGTGCTGGTCGGGG + Intronic
1013410736 6:109881187-109881209 GCAGGGGGTGGCACTCGTCAGGG + Intergenic
1013694764 6:112689410-112689432 GCAGGGGGCAGCGCTCGTCCGGG + Intergenic
1013955299 6:115834643-115834665 GCAGGGGGTGGCACTCGTCGGGG + Intergenic
1013960127 6:115889371-115889393 GCAGGGGGCGGCGCTCGAAGGGG - Intergenic
1013963406 6:115928125-115928147 GCAGGGGGCGGCGCTCCTCTAGG + Intergenic
1014240791 6:119015641-119015663 GCAGGGGGCAGCATTCGTCGGGG - Intronic
1014460224 6:121686498-121686520 GCAGGGGGCGGTGCTCGTCGGGG + Intergenic
1014499238 6:122165170-122165192 AGCGGGGGAGGCGCTCGTCGAGG + Intergenic
1014507806 6:122280897-122280919 GCAGGGGGCGGTGCTCGTCGGGG - Intergenic
1014586350 6:123202274-123202296 GCAGGGTGCGGCGCCCGTTGGGG - Intergenic
1014788519 6:125644769-125644791 GCAGGGGGTGGCCCTCGTGGAGG - Intergenic
1014921026 6:127214633-127214655 GCAGGGGGTGGCGCTCGTCGGGG + Intergenic
1015572203 6:134633587-134633609 GCAGGGGGCGGCGCTCGTCTGGG + Intergenic
1015600394 6:134905047-134905069 GCAGGGGGCGGCGCTCGTCGGGG - Intergenic
1016067321 6:139697958-139697980 GCAGGGGGCGGTGCTGATCGGGG + Intergenic
1016069843 6:139726391-139726413 GCAGCGGGTGGTGCTCGTTGGGG + Intergenic
1016092781 6:139999627-139999649 GCAGGGGGTGGCACTCGTCCGGG + Intergenic
1016172894 6:141041667-141041689 GCAGGGGGTGGCACCCATCAGGG + Intergenic
1016217251 6:141618531-141618553 GCAGTGGGCGGTGCTCGTCAGGG - Intergenic
1016482270 6:144495193-144495215 GCAGGGGGTGGCACTCATCAGGG + Intronic
1016858875 6:148698089-148698111 GCAGGGGGCGGGGCTGGTCAGGG + Intergenic
1017299028 6:152834661-152834683 GCAGGGGGTGGTGCTCGTCTGGG - Intergenic
1017325137 6:153133939-153133961 GCAGGGGGTGGCGCTCGTCGGGG - Intergenic
1017383466 6:153856973-153856995 GCAGGGGGCAGCGCCCATCGGGG + Intergenic
1017537420 6:155363388-155363410 GCAGGGGGTGGCACTCGTCGGGG - Intergenic
1017581169 6:155866798-155866820 GCAGGGGGTGGCACTCGTCGGGG + Intergenic
1017839449 6:158209794-158209816 GCAGGAGGCGGCGCTCATCGGGG + Intergenic
1017900566 6:158715642-158715664 GCAGGGGGTGGGGGTGGTGGGGG - Intronic
1018064187 6:160114545-160114567 GCAGGGGGTGGTGCTCATCCGGG + Intergenic
1018551297 6:165001673-165001695 TCAGGGGGCGGCGCTCGTTGGGG + Intergenic
1018624598 6:165765330-165765352 GCAGGGGGCGGCGCTCCTCGGGG + Intronic
1018696148 6:166393395-166393417 GCAGGGGGCGGCGCTCATCAGGG + Intergenic
1018839022 6:167505884-167505906 GCAGGGGGTGGCGCACACAGGGG + Intergenic
1019000216 6:168743827-168743849 GCAGGGGGTGGTGCTCGTCGGGG + Intergenic
1019086276 6:169480357-169480379 GCAGGGGGTGGTGCCCGTCAGGG - Intronic
1019944219 7:4313981-4314003 GCAGGGGGCGGCGCTCGTCAGGG + Intergenic
1019965709 7:4496974-4496996 GCAGGGGGTGGCGCTCGTCGGGG + Intergenic
1020163959 7:5793810-5793832 GCAGGGGACGGCACTCGTCGGGG - Intergenic
1020316542 7:6909404-6909426 GCAGGGTGTGGCTCACGACGGGG - Intergenic
1020552237 7:9621526-9621548 GCAGGGGGCGGCGTTCGTCGGGG + Intergenic
1021133919 7:16943303-16943325 GCAGGGGGCAGTGCTTGTCGGGG - Intergenic
1021324172 7:19245801-19245823 GCAGGGGGTGGTGCTCGCTGGGG - Intergenic
1021359364 7:19692294-19692316 GCAGGGGGTGTTGCCCGTTGGGG + Intergenic
1021513757 7:21461241-21461263 GCAGGGGGCGGTGCTTGTTGGGG + Intronic
1021520669 7:21536632-21536654 GCAGGGGGCGGCACTTGTTGGGG + Intergenic
1021567849 7:22032410-22032432 GCAGGGGGCAGCGCTCGTAGGGG + Intergenic
1021573950 7:22090743-22090765 GCACGGGGTGGCGCCTGTTGGGG - Intergenic
1021686722 7:23193776-23193798 GCAGGGGGTGGCGCTCCTCGTGG + Intronic
1022088975 7:27095684-27095706 GCTGGGGGTGGCGATGGTGGTGG + Exonic
1022174103 7:27857099-27857121 GCAGGGGGCGGCGCTCGTCGGGG + Intronic
1022750480 7:33219290-33219312 GCACGGGGCGGCGCTCACCGGGG - Intronic
1023127983 7:36974055-36974077 ACAGGGGGCGGCGCTCATCAGGG - Intronic
1023378030 7:39577715-39577737 GCAGGGGGTGGTGCTCGTTGGGG - Intronic
1024269123 7:47628793-47628815 GCAGGGGGTGGCGCTCGTCGGGG - Intergenic
1024335590 7:48202957-48202979 GCAGGGGGCGGCGCTCGTCGGGG + Intronic
1024465949 7:49711570-49711592 GCAGGGGGCGGCACTCATTGGGG - Intergenic
1024691330 7:51806151-51806173 GCAGGGGGCGGCGGTCGTCGGGG - Intergenic
1024735768 7:52302937-52302959 GCAGGGGGCAGTGGTCGTCGGGG + Intergenic
1024748158 7:52431285-52431307 GCAGGGGGTGGCGCCCGTCAGGG + Intergenic
1024825382 7:53385204-53385226 GCAGGGGGTGGTGCTCGTCGGGG + Intergenic
1024834094 7:53495338-53495360 GCAGGAGGTGGTGCTCGTCGGGG - Intergenic
1025962030 7:66231404-66231426 GCAGGGGGTGGCACTTGTCAGGG + Intronic
1026098291 7:67364573-67364595 GCAGTGGGCGGCGCCCGTCGAGG + Intergenic
1026187046 7:68090457-68090479 GCAGGGGGTGGTGCTCGTCGGGG + Intergenic
1026202994 7:68231349-68231371 GCAGGGGGCGGCACTCGTCGGGG - Intergenic
1026335938 7:69394143-69394165 GCAGGGGGCGGCGCTCGTCGGGG - Intergenic
1026512388 7:71037911-71037933 GCAGGGGGTGGCGCTCATCGGGG - Intergenic
1026596514 7:71738123-71738145 GCAGGGGGCGGCGCTCGTCTGGG + Intergenic
1027237977 7:76309523-76309545 GCAGGGGGCGGTGCTTGTCAGGG + Intergenic
1027561717 7:79739618-79739640 GCAGAGGGCAGCGCTCATCGGGG - Intergenic
1027563996 7:79768008-79768030 GCAGGGGGCGGCGCTCATTGGGG + Intergenic
1027665939 7:81043025-81043047 GCAGGGGGTGGTGCTCGTTGGGG - Intergenic
1027674518 7:81142055-81142077 GCAGGGGGCGGCGCTTGTCGGGG - Intergenic
1027698237 7:81437133-81437155 GCATGGGGCGGCACTCATCGGGG + Intergenic
1027778994 7:82499887-82499909 GCAGGGGGCGGTGCTCATCGGGG - Intergenic
1027868144 7:83673628-83673650 GCAGGGGGCGGCGCTCCTCGGGG - Intergenic
1027956084 7:84880844-84880866 GCAGGGGGTGGCGCTCGTCGCGG - Intergenic
1028070145 7:86440884-86440906 GCAGGGGGTGGCGCTCGTCGGGG - Intergenic
1028303256 7:89228811-89228833 GCAGGGGGTGGCACTCGTTGGGG + Intronic
1028557998 7:92143414-92143436 ACCGGGGGCGGCACTCGTCGGGG + Intronic
1028719373 7:94011911-94011933 GCAGGTGGCGGGGCTCGTCGGGG + Intergenic
1028778368 7:94705810-94705832 GCAGGGGGTGGTGCTCATCGGGG - Intergenic
1028852471 7:95552509-95552531 GCAGGGGACGGCGCTTGTCGGGG + Intergenic
1028857210 7:95605580-95605602 GCAGGGGGTGGCGCTTGTCAGGG - Intergenic
1028913036 7:96229024-96229046 GCAGGGGGCGGCACCCGTTGGGG - Intronic
1028989554 7:97034663-97034685 GCAGGGGGCTGCGCTCATTGGGG - Intergenic
1029076185 7:97936199-97936221 GCAGGGAGCGGTGTTCGTCGGGG - Intergenic
1029407147 7:100382049-100382071 GCAGGGGGCGGCGCTCCTCGTGG - Intronic
1029567553 7:101348892-101348914 GCAGGGGGTGGTGCTCGTCGGGG - Intergenic
1029809590 7:103034287-103034309 GCGGGGGGCGGCGCTTGTAGGGG + Intronic
1029832330 7:103274968-103274990 GCAGGGGGTGGTGCTCGTCGGGG + Intergenic
1029988213 7:104940470-104940492 GCAGGTGGCGGCACTCGTCGGGG - Intergenic
1030102092 7:105955853-105955875 GCAGGGGGTGGCGCTGGTCGGGG + Intronic
1030215685 7:107042405-107042427 GCAGGGGGCGGCGGTCGTCGGGG + Intergenic
1030366978 7:108657304-108657326 GCAGGGGGCGGAGCTCGTCGGGG + Intergenic
1030599936 7:111581987-111582009 GCAGGAGGTGGCGCTCATCGGGG + Intergenic
1030733530 7:113017660-113017682 GCAGGGGGTGGCGCTCATCCGGG - Intergenic
1030772176 7:113488178-113488200 GCAGGGGGTGGCACCCGTCGGGG + Intergenic
1030780460 7:113593635-113593657 GCAGGGGGCGGCGCTCCTCGGGG - Intergenic
1030819268 7:114076894-114076916 GCAGGAAGCGGCGCTCGTCGGGG + Intergenic
1030980649 7:116182026-116182048 GCAGGGGGCGGCGCTCCTCGGGG + Intergenic
1031253089 7:119413389-119413411 GCAGGGGGCGGTGCTCGTTGTGG + Intergenic
1031292215 7:119951554-119951576 GCAGGGGGTGGTGCTCGTCGGGG + Intergenic
1031378836 7:121060252-121060274 GCAAGGGGCGGCGCTCATCAGGG - Intronic
1031409253 7:121422044-121422066 GCAGGGGGCGGTGCTTGTCCGGG - Intergenic
1031605491 7:123763259-123763281 GCAGGGGGCGGCGCTCGTCAGGG + Intergenic
1032248116 7:130230339-130230361 GCAGGGGGTGGTGCTCGTTGGGG - Intergenic
1032339695 7:131059078-131059100 GCAGGGGGCAGCGCTCATTGGGG - Intergenic
1032561559 7:132898650-132898672 GCAGGGGGTGGCGCTCGTCGAGG + Intronic
1033065120 7:138146438-138146460 GCAGGGGGTGGCGCTCGCCGGGG - Intergenic
1033312386 7:140271388-140271410 GCAGGGGGCGGTGCTCGTCGGGG + Intergenic
1033394048 7:140956998-140957020 GCAGGGGGCGGCGCTCATCGGGG + Intergenic
1033664058 7:143424441-143424463 GCAGGGGGCGGCATTCGTCGGGG + Intergenic
1033705669 7:143882944-143882966 CCAGGGGGCGGCGCTTGGCGGGG + Intronic
1033758573 7:144418013-144418035 GTAGGGGGTGGTGCTTGTCGGGG + Intergenic
1033839864 7:145360639-145360661 GCAGGAGGTGGTGATCGTCAGGG + Intergenic
1033866604 7:145697456-145697478 GCAGGGGGCGGCGCTCGTCAGGG + Intergenic
1034091093 7:148364125-148364147 GCAGGGGGTGGCGCTCGTCGGGG - Intronic
1034097961 7:148426725-148426747 GCAGGGGGCAGTGCTCGTTGGGG - Intergenic
1034155063 7:148949398-148949420 GCAGGGGGTGGTGCTCGTTGGGG - Intergenic
1034167712 7:149038742-149038764 GCAGGGGGTGGCGCTCGTCGGGG + Intergenic
1034441388 7:151087516-151087538 CCGGAGGGTGGCGCTCGCCGCGG + Intronic
1034632097 7:152538931-152538953 GCAGGGGGCGGTGCTCATCGAGG + Intergenic
1034655993 7:152730319-152730341 GCAGGGGGTGGTGCTCGTCGGGG + Intergenic
1034900890 7:154907218-154907240 GCAGGGGGTGGTGCCGGTAGGGG - Intergenic
1035151141 7:156874049-156874071 GCAGGGGGTGGTGCTCGTCGGGG + Intronic
1035325458 7:158062886-158062908 GCAGGGGGCGGCGCTTGTCGGGG - Intronic
1035791775 8:2312874-2312896 GCAGGGAGTGGCGCCCATGGCGG + Intergenic
1035801030 8:2408831-2408853 GCAGGGAGTGGCGCCCATGGCGG - Intergenic
1035999285 8:4583144-4583166 GCAGAGGATGGTGCTCGTTGGGG - Intronic
1036194155 8:6699455-6699477 GGAGGGGGTGGCCCTCGGAGTGG + Intergenic
1036260506 8:7235967-7235989 GCAGGGGGCGGTGCTCATCGGGG - Intergenic
1036306107 8:7603555-7603577 GCAGGGGGCGGTGCTCATCGGGG + Intergenic
1036312543 8:7694523-7694545 GCAGGGGGCGGTGCTCATCGGGG - Intergenic
1036356953 8:8051540-8051562 GCAGGGGGCGGTGCTCATCGGGG + Intergenic
1036378303 8:8219189-8219211 GCAGGGGGTGGTGCCCATTGGGG - Intergenic
1036440983 8:8781435-8781457 GCAGGGGGCGGCGCTCATCGGGG + Intergenic
1036554619 8:9847843-9847865 GCAGGGAGCGGCGCTCGTCGGGG + Intergenic
1036801408 8:11795080-11795102 ACAGGGGGTGGCGCTCGTCGGGG - Intergenic
1036831396 8:12022919-12022941 GCAGGGGGCGGTGCTCATCTGGG - Intergenic
1036851271 8:12203428-12203450 GCAGGGGGCTGTGGTCGTCGGGG + Intergenic
1036872635 8:12445702-12445724 GCAGGGGGCTGTGGTCGTCGGGG + Intergenic
1036910493 8:12754452-12754474 GCGGGGAGGGGCGCTCGGCGCGG - Intronic
1036915023 8:12796580-12796602 GCAGGGGGCGGCGCCCTTCCGGG - Intergenic
1037239464 8:16760584-16760606 GCAGGGGGCGGTGCTCCTCAAGG + Intergenic
1037241597 8:16784223-16784245 GCAGGGGGTGGTGCTCGTCGGGG - Intergenic
1037263799 8:17036861-17036883 GCAGGGGGTGGTGCTCGTTGGGG + Intronic
1037417526 8:18667723-18667745 GCAGGGGGCGGTACTCGTCAGGG + Intronic
1037425562 8:18751087-18751109 GCAGGGGGCGGTGCTCTTCGGGG + Intronic
1037558980 8:20055042-20055064 GCAGGGGGCGGCGCTCAGGGAGG - Intergenic
1037811022 8:22086872-22086894 GCAGGGGGCGGCGCTCGTCGGGG - Intergenic
1037819873 8:22130453-22130475 GCGGGCGGTGGCGGTCGTCGTGG + Exonic
1037957509 8:23070837-23070859 GCAGGGGGAGGTGCTCGTCGGGG + Intergenic
1037971296 8:23173843-23173865 GCAGGGGGAGGTGCTCGTCGGGG + Intergenic
1037983570 8:23272433-23272455 GCGGGGGGTGGTGCTAGTCGGGG - Intronic
1038174112 8:25164812-25164834 GCAGGGGGTGGCGCTCGTCAGGG - Intergenic
1038638322 8:29304570-29304592 GCAGGGGACGGCGCTCATCAGGG - Intergenic
1038639448 8:29311782-29311804 GCAGGGGGCGGCACTCATCGGGG - Intergenic
1038870747 8:31490184-31490206 GCAGTGGGCAGCGCTCGTCGGGG - Intergenic
1039061350 8:33574220-33574242 GCAGAGGGTGGCGCTCGTCGGGG - Intergenic
1039069062 8:33633871-33633893 GCAGGGGGTGGTGCTCATTGGGG + Intergenic
1039587651 8:38720113-38720135 GCAGGGGGCGGCGCTCGTCGGGG - Intergenic
1039637350 8:39180444-39180466 GCAGGGGGCAGCGCTCGTCGGGG - Intronic
1040003646 8:42600100-42600122 GCAGGGGGTGGTGCCTGTCGGGG + Intergenic
1040014523 8:42689829-42689851 GCAGGGGGCAGCGCTGGTCGAGG - Intergenic
1040027740 8:42796928-42796950 GCAGGGGGCGGCACTTGTTGGGG - Intergenic
1040323993 8:46332006-46332028 ACAGGGGGCGGTGCTCGTCAGGG - Intergenic
1040351315 8:46571842-46571864 GCAGGTGGCGGGGCTCATCGGGG - Intergenic
1040723166 8:50350234-50350256 GCAGGGGGCGGCACTCGTCAGGG - Intronic
1040791050 8:51230918-51230940 GCAGGGAGCGGCGCTCATCAGGG - Intergenic
1040804386 8:51377831-51377853 GCAGGCAGTGGCGCTCCTCCGGG - Intronic
1040952665 8:52952900-52952922 GCAGGGGGTGGTGCTCCTTGGGG + Intergenic
1041034615 8:53775944-53775966 GCAGGGGGCGGTGCTCATCAGGG + Intronic
1041636623 8:60153011-60153033 GCAGGAGGCGGCACTTGTCGGGG + Intergenic
1041914565 8:63126390-63126412 GCAGGGGGTGGCGCTCGTTGGGG - Intergenic
1041918973 8:63162306-63162328 GTAGGGGGTGGTGCTCGTTGGGG - Intergenic
1042512526 8:69626528-69626550 GCAGGGGGTGGTGCTCGTCGGGG + Intronic
1042948713 8:74179575-74179597 GCAGGGTGTGGCCCTCATCGGGG + Intergenic
1043102190 8:76060496-76060518 GCAGAGGGCAGCGCTCGTCCGGG + Intergenic
1043110145 8:76169887-76169909 GCAGGGGGCTGCGCTCGTCGGGG - Intergenic
1043129889 8:76447657-76447679 GCAGGGGGCAGTGCTCGTCGGGG + Intergenic
1043346504 8:79303811-79303833 GCAGGGGGTGGCGCTCGTGGAGG - Intergenic
1043352442 8:79377247-79377269 GCAGGGGGCAGCGCTCGTCCGGG + Intergenic
1043620989 8:82192300-82192322 GAAGGGGGTGGCACCAGTCGGGG + Intergenic
1043640202 8:82441694-82441716 GCAGGGGGCGGCGTTGGTGGGGG - Intergenic
1043701170 8:83290667-83290689 GCAGGGGGTGGCACTCGTCGAGG - Intergenic
1043709930 8:83403263-83403285 GCAGGGGGTGGCGCTCGTCGGGG - Intergenic
1043725950 8:83611208-83611230 GCAGGGGGTGGCACCTGTTGGGG + Intergenic
1043731906 8:83694041-83694063 GCAGGGGGTGGTGCTTGTTGGGG + Intergenic
1044075868 8:87821151-87821173 GCAGGGGGTGGCGCTCGTGGAGG - Intergenic
1044088526 8:87971432-87971454 GCAGGGGGTGGCGCTCGTTGGGG - Intergenic
1044404926 8:91816638-91816660 GCAGGGGGCGGCGCTCGTCGGGG - Intergenic
1044633430 8:94300377-94300399 GCAGGGGGTGGCGCTCATTGGGG + Intergenic
1044788729 8:95823955-95823977 GCAGGGGGTGGCGCTCGTCGGGG - Intergenic
1044853609 8:96452597-96452619 GCATGGGGCAGCGCTCGTTGGGG - Intergenic
1044862113 8:96533890-96533912 GCAGGGGGCGGCGCTCGTTGGGG + Intronic
1044880622 8:96719130-96719152 GCAAGGGGTGGCACTCATTGGGG + Intronic
1045131900 8:99163443-99163465 ATAGGGGGTGGTGCTCGTTGGGG + Intronic
1045232285 8:100316818-100316840 GCAGGGGGTGGTGCTCCTGGGGG + Intronic
1045306004 8:100957228-100957250 GCAGGGAGTGGTGCTCGGTGGGG + Intergenic
1045467717 8:102485557-102485579 GCAGGGGGCAGCGCTCGTCGGGG + Intergenic
1045743301 8:105387375-105387397 GCAGGCGGCAGCGCTCGTCGGGG + Intronic
1045933776 8:107655915-107655937 GCAGGGGGTGGTGCCCATGGGGG - Intergenic
1046061437 8:109144653-109144675 GCAGGGGGTGGGACTCTTGGGGG - Intergenic
1046149303 8:110202619-110202641 GCAGGGGGCGGTGCTCGTCCGGG + Intergenic
1046208843 8:111040881-111040903 GCAGGGGGCGGCGCTCATCGGGG + Intergenic
1046251925 8:111643143-111643165 GCAGGGGGCGGTGCTCGTCGGGG - Intergenic
1046265349 8:111823336-111823358 GCAGGGGGTGGTGCTCGTAGGGG + Intergenic
1046285010 8:112083063-112083085 GCAGAGGGTGGCGCTCATCGGGG + Intergenic
1046288954 8:112133008-112133030 GCAGGAGGTGGCGCTCATCCGGG - Intergenic
1046445383 8:114311667-114311689 GCAGGGGGTGGCGCTCATCAGGG - Intergenic
1046521349 8:115330610-115330632 GCAGGGGGTGGCTCCCGTAAGGG + Intergenic
1046621251 8:116531361-116531383 GCAGGGGGCAGCACTCGTAGGGG - Intergenic
1046661156 8:116949793-116949815 GCAGGGGGCGGCGCTCGTCGGGG + Intergenic
1046895175 8:119464001-119464023 GCATGGGGTCGCGCTGGTGGTGG - Intergenic
1047124802 8:121948396-121948418 GCAGGGGGTGGCACTCATCGGGG - Intergenic
1047358034 8:124141762-124141784 GCAGGAGGTGGCGCCTGTCGGGG + Intergenic
1048112896 8:131487345-131487367 GCAGGGGGCGGTGCTCGTCGGGG - Intergenic
1048186846 8:132249702-132249724 GCAGGGGGCGGTGCTCGTTGGGG + Intronic
1048575994 8:135690502-135690524 GCAGGGAGCGGCGCTTGTCAGGG + Intergenic
1048655375 8:136530496-136530518 GCAGGGGGCGGCGCTCGTCGGGG + Intergenic
1048676920 8:136793846-136793868 GCAGGGGGCGGGGCTTGTCGGGG + Intergenic
1048757455 8:137755164-137755186 GCAGGGGGTGGTGCTCGTCTGGG + Intergenic
1049087592 8:140490559-140490581 GCAGGGGGCGGCAGTCGTCGGGG + Intergenic
1049157735 8:141076957-141076979 ACAGGGGGCGGCACTCGTCAGGG - Intergenic
1049500360 8:142959793-142959815 GCAGGGGACGGCAGTCGTCGGGG - Intergenic
1049685291 8:143936944-143936966 GCAGGGGGTGGGGGTCCTGGGGG + Intronic
1049944468 9:580815-580837 GCAGGGGGCGGTGCTCGTTGGGG + Intronic
1050249987 9:3734083-3734105 GTAGGGGGCGGCGCTCGTCGGGG - Intergenic
1050920658 9:11197182-11197204 GCAGGGGGTGGTGCTCGTCGGGG - Intergenic
1051314135 9:15810442-15810464 GCAGGGGGTGGCGCCTGTCGGGG + Intronic
1051383350 9:16480824-16480846 GCAGGGGGTGGCACTTGTCGGGG - Intronic
1051419678 9:16877133-16877155 GCTGGGAGTGGTGCTCGTCAGGG + Intergenic
1051439898 9:17072919-17072941 GCAGGGGGTGGTGCTCGTGGGGG - Intergenic
1051459300 9:17294719-17294741 GCAGGGGGCAGAGCTCGTCGGGG + Intronic
1051463841 9:17354251-17354273 GCAGGGGGTGGTGCTCGTCGGGG - Intronic
1051892739 9:21959567-21959589 GCAGGGGGTGGTGCTCGTCGGGG - Intronic
1052056635 9:23914503-23914525 GCAGGGGGAGGTGCTCATCAGGG + Intergenic
1052075491 9:24135383-24135405 GCAGGGGGCGGTGCTCATCGTGG - Intergenic
1052313464 9:27092927-27092949 GCAGGGGGCTGCGCTCCTCGGGG - Intergenic
1052576615 9:30299581-30299603 GCAGGGGGCGGCACTTGTCGGGG - Intergenic
1052979594 9:34438261-34438283 GCAGGGGGTGGCGCTCATTGGGG - Intronic
1052985303 9:34482808-34482830 GCAGAGGATGGTGCTCGTCGGGG + Intronic
1053027239 9:34740280-34740302 GCAGGGGGCGGCGCTAGTCAGGG + Intergenic
1053436130 9:38075640-38075662 GCAGGGGGCGGCACTCCTCAGGG - Intergenic
1053475280 9:38377847-38377869 GCAGGGGGCGTTGCTCGTCAGGG - Intergenic
1053547870 9:39042401-39042423 GCAGGGGGTGGTGCTCGTCGGGG + Intergenic
1053811993 9:41862442-41862464 GCAGGGGGCGGTGCTCGTCAGGG + Intergenic
1054618602 9:67324997-67325019 GCAGGGGGCGGTGCTCGTCAGGG - Intergenic
1054722500 9:68617340-68617362 GCAGGGGGCCGCGCTCATCGGGG - Intergenic
1055049403 9:71963854-71963876 GCAGGGGGTGGCGCTGGTAGGGG - Intronic
1055102528 9:72480283-72480305 GCAGGGGGCGGCACTCATCAGGG + Intergenic
1055461419 9:76523773-76523795 GCAGGGGGCGGTGCTTGTCGGGG + Intergenic
1055557539 9:77490428-77490450 GCAGGGGGCAGCATTCGTCGGGG + Intronic
1055651416 9:78410311-78410333 GCAGGTGGTGGCACTCATCGGGG - Intergenic
1055654981 9:78442390-78442412 GCAGGCGGTGGCGCTCCTCGGGG - Intergenic
1055925670 9:81507685-81507707 GCAGGGGATGGCGCCAGTTGGGG - Intergenic
1055985483 9:82054425-82054447 GCAGGGGGCGGTGCTCATTGGGG + Intergenic
1056080917 9:83093341-83093363 GCAGGGGGTGGCACTTGTCGGGG + Intergenic
1056216325 9:84408797-84408819 GCAGGGGGTGGCGCTCGTCAGGG - Intergenic
1056677207 9:88685968-88685990 ACAGGGGGTAGCACTTGTCGGGG + Intergenic
1056743795 9:89282741-89282763 GCAGGGGGCGGCACTTATCGGGG - Intergenic
1056771350 9:89480462-89480484 GCAGGGGGTGGCTCTCGTCGGGG + Intronic
1056799575 9:89681568-89681590 GCAGGGGGTGGTGCTCGTTGGGG - Intergenic
1057118211 9:92545562-92545584 GCAGGGGGCAGAGCTCGTCGGGG - Intronic
1057257953 9:93566599-93566621 GGAGGGGCTGGCGCTCGCCCGGG + Intergenic
1057300741 9:93880220-93880242 GTGGGGGGGGGCACTCGTCGGGG - Intergenic
1057383878 9:94591188-94591210 GCGGGGGGTGGCGCTCGTCGGGG + Intronic
1057511177 9:95680647-95680669 GCAGGGGGCCGCACTCATCGGGG - Intergenic
1057543817 9:96001763-96001785 GCAGGGGGTGGCGCTCGTCGGGG + Intronic
1057628588 9:96700932-96700954 GCAGGGGGTGGTGCTTGTCGGGG + Intergenic
1057721588 9:97535963-97535985 GGAGGGGGTGGGGCTCTTAGAGG + Intronic
1057726950 9:97574490-97574512 GCAGGGGGCGGCGCTTGTCGGGG - Intronic
1057896522 9:98913234-98913256 CCAGGGGATGGCGCTAGTCAGGG + Intergenic
1058174824 9:101724159-101724181 GCAGGGGGTGGCGTTCGTCGAGG + Intronic
1058235652 9:102487027-102487049 GCAGGGGGCTGCGCTCATCTGGG + Intergenic
1058286607 9:103187208-103187230 GCAGGGGGCGGAGGTCGTCAGGG - Intergenic
1058365224 9:104200910-104200932 GCAGGGGGCAGTGCTCCTCGGGG - Intergenic
1058379529 9:104362946-104362968 GCAGGGGGCGGCGCTCATTGGGG + Intergenic
1058585337 9:106501383-106501405 GCAGGGAGCGGTGCTCGTCGGGG + Intergenic
1058727571 9:107818119-107818141 GCAGGGGGCGGCGCTCGTCGGGG - Intergenic
1058786540 9:108393830-108393852 GCAGGGGGCGGCGCTCGTCGGGG - Intergenic
1058799410 9:108530459-108530481 GTAGGGGGCAGCGCTCGTCGGGG - Intergenic
1059791113 9:117642809-117642831 GCAGGGGGTGGCGCTCGTCAGGG + Intergenic
1059991519 9:119870326-119870348 ACAGGGGGTGGTGCTCGTCTGGG + Intergenic
1060091386 9:120746661-120746683 GCAGGGGGCAGCGCTCGTCAGGG - Intergenic
1060305337 9:122406243-122406265 GCAGGGGGTGGCGCTCGACGGGG + Intergenic
1060594188 9:124838778-124838800 CGAGGGGGCGGCGCTCATCGGGG + Intergenic
1061297730 9:129686123-129686145 GTAGTGGGTGGGGCTCGTAGGGG + Intronic
1061483874 9:130910438-130910460 GCAGGGGGTGGCGCTCGTCAGGG - Intronic
1061792504 9:133066212-133066234 GGAGGGGGTGGTGTTTGTCGGGG - Intronic
1062146169 9:134991077-134991099 GCAGGGGGCGGCGCTCGTCGGGG + Intergenic
1062382433 9:136292941-136292963 GCAGTGAGTGGCGCTCATCCAGG + Intronic
1062397432 9:136358133-136358155 GCAGCGGGTGGACCTCGCCGGGG + Exonic
1203429840 Un_GL000195v1:80636-80658 GCAGGGGGCGGCACTCATCCAGG - Intergenic
1203460392 Un_GL000220v1:31069-31091 ACAGGGGGTGGAGCTCGTTGGGG + Intergenic
1185889877 X:3814555-3814577 GCAGGGGCTGCCGCTCGCGGGGG + Intergenic
1186282052 X:8003361-8003383 GCAGGGGGCAGTGCTCGTCGGGG + Intergenic
1186323211 X:8452535-8452557 GCAGGGGGTGGTGCTCGTTGGGG + Intergenic
1187139096 X:16575768-16575790 GCAGGGGGCGGCGCTCGTCAGGG - Intergenic
1187304652 X:18084119-18084141 GCAGGGGGTGGTGCTCGTCAGGG - Intergenic
1187557532 X:20366894-20366916 GCAGGGGGTGGTGCTCGTCGGGG + Intergenic
1187904057 X:24050008-24050030 GCAGGGGGTGGTGCTCCTCGGGG - Intergenic
1188112042 X:26205075-26205097 GCAGGGGGCGGCGCTCGTCGGGG - Intergenic
1188166920 X:26873745-26873767 GCAGGGGGCGGCCCTCGTCGGGG + Intergenic
1188189570 X:27157319-27157341 GCAGGGGGCGGCATTCGTCGGGG - Intergenic
1188242717 X:27809607-27809629 GCGGGGGGCGGCGCTCGTCAGGG - Intronic
1188881876 X:35499595-35499617 GCAGGGGGCGGCGCTCCTCGGGG - Intergenic
1189209873 X:39275896-39275918 GCAGGGGGCAGCGCTCGTCGGGG - Intergenic
1189896805 X:45664862-45664884 GCAGGGGGCGGAGCTCATCGGGG + Intergenic
1190045827 X:47111048-47111070 GCAGGGGGCGGTGCTCATCGGGG + Intergenic
1190413923 X:50163375-50163397 GCAGGGGGCAGTGCTCGTCGGGG + Intergenic
1191053871 X:56222648-56222670 GCAGGGGGCGGCGCTCGTTGGGG + Intergenic
1192186794 X:68952430-68952452 GCAGGGGGCAGCGCTTGTCAGGG - Intergenic
1192869620 X:75173642-75173664 GCAGGGGGAAGTGCTCGTCGGGG + Intergenic
1192870528 X:75179562-75179584 GCAGGGGGTGGTGCTCGTCGGGG + Intergenic
1193040165 X:76996703-76996725 GCAGGGGGTGGTGCTCATCGGGG + Intergenic
1193271108 X:79530899-79530921 GCAGGGGGCGGTGCTCCTCGGGG - Intergenic
1193538116 X:82738248-82738270 GCAGGGGGTGGTGCTCATCGGGG + Intergenic
1193708929 X:84856689-84856711 GCAGGGGATGGCGCTCCTCGGGG + Intergenic
1193803997 X:85972403-85972425 GCAGGGGGCGGCATTTGTCGGGG + Intronic
1194025555 X:88746416-88746438 GCAGGGAGCAGCGCTCGTGGGGG + Intergenic
1194071559 X:89331074-89331096 GCAGGGGGTGGCGCTCGTCAGGG + Intergenic
1194121170 X:89965691-89965713 GCAGGGGGTGGTGCTCGTCGGGG + Intergenic
1194166387 X:90521651-90521673 GCAGGGGGTGGTGCTCGTCGGGG - Intergenic
1194650781 X:96512296-96512318 GCAGGGGGTGGTGCTCGTCGGGG + Intergenic
1194890448 X:99372116-99372138 GCAGGGGGCGGCGCTCGTCGGGG + Intergenic
1195256349 X:103094393-103094415 GCAGGGGGCGGCGCTCGTTGGGG - Intergenic
1195257996 X:103107394-103107416 GCAGGGGGTGGCGCTCGTCAGGG + Intergenic
1195460229 X:105115794-105115816 GCAGAGAGCGGCGCTCGTCCGGG + Intronic
1195909565 X:109875939-109875961 GCAGGGGGTGGCGCTCCTCCGGG + Intergenic
1196197888 X:112854943-112854965 GCAGGGGTCGGCGCTCATCGGGG + Intergenic
1196319490 X:114270605-114270627 GCAGGAAGCGGCGCTCATCGGGG + Intergenic
1196616189 X:117769349-117769371 GCAGGGGGCGGCGCTCGTCGGGG - Intergenic
1196662489 X:118282786-118282808 GCAGGGGGTGGTGCTCGTCGGGG + Intergenic
1196705869 X:118716981-118717003 GCAGGGGGTGGCATTCGTCGGGG + Intergenic
1196714657 X:118799272-118799294 GCAGGGGGTAGTGCTCGTCCGGG - Intergenic
1196728889 X:118922028-118922050 GCAGGGGGTGGTGCTCGTCGGGG + Intergenic
1196741554 X:119029830-119029852 GCAGGGGGTGGTGCTCATCGGGG - Intergenic
1196761934 X:119208517-119208539 GCAGGGGGTGGTGCTCATTGGGG + Intergenic
1196762306 X:119210924-119210946 GCAGGGGGTGGTGCTCTTTGGGG + Intergenic
1196771540 X:119299997-119300019 GCAGGGGGCGGTGCTCGTTGGGG - Intergenic
1196775243 X:119332190-119332212 GCAGGGGGTGGTGCTTGTCGGGG - Intergenic
1196781426 X:119387629-119387651 GCAGGGGGTGGTGCTCGTCGGGG + Intergenic
1196793942 X:119487908-119487930 GCAGGGTGTGGTGCTCGTTGGGG + Intergenic
1196827228 X:119750866-119750888 GCAGGGGGTGGTGCTCGTCGGGG + Intergenic
1196860818 X:120025813-120025835 GCAGGAGGCGGCGCTCGTCGGGG + Intergenic
1197000246 X:121431573-121431595 GCAGGGGGTGGCGCTCATCGGGG + Intergenic
1197177644 X:123502232-123502254 GCAGTGGGTGGTGCTCTTCCTGG - Intergenic
1197331135 X:125155513-125155535 GCAGGGGGTGGCGCTCGTCGGGG + Intergenic
1197340093 X:125255963-125255985 GCAGAGGGCGGTGCTCGTCGGGG - Intergenic
1197344791 X:125319107-125319129 GCAGGGGGTGGTGCTCGTTGGGG + Intergenic
1197376757 X:125690624-125690646 GCAGGGGGCGGCGCTCGTCGGGG + Intergenic
1197533742 X:127663058-127663080 GCAGCAGGCGGCACTCGTCGGGG + Intergenic
1197607981 X:128606941-128606963 GCAGGGGGCAGCGCTTGTCAGGG - Intergenic
1197978798 X:132194401-132194423 GCAGGTGGCGGTGCTCGTCGGGG - Intergenic
1198060959 X:133044695-133044717 GCAGGGGGTGACGCTCGTCGGGG - Intronic
1198300029 X:135325770-135325792 GCAGGGGGTGGCGCCTCTCAGGG - Intronic
1198468144 X:136921679-136921701 GCAGGGGGCGGCGCTCGTCGGGG - Intergenic
1198664272 X:139004070-139004092 GCAGGGGGTGGTGCTCGTCGGGG + Intronic
1198872270 X:141188583-141188605 TCAGGGGGCGGCGCTCCTCAGGG + Intergenic
1198972549 X:142298290-142298312 GCAGGGGGTGGCGCTCGTCGGGG + Intergenic
1199009899 X:142745768-142745790 GCAGGGGGTGGTGCTCTTTGGGG + Intergenic
1199028759 X:142972181-142972203 GCAGCGGGTGGTGGTCGTTGGGG + Intergenic
1199050189 X:143228736-143228758 GCAGGGCGCGGCGCTCCTCGGGG + Intergenic
1199094795 X:143726279-143726301 GCAGGGGGTGGTGCCCGTTGGGG + Intergenic
1199134134 X:144231296-144231318 ACAGGGGGCGGTACTCGTCGGGG + Intergenic
1199175580 X:144783934-144783956 GCAGGGGGCGGCATTCGTCGGGG - Intergenic
1199285058 X:146046230-146046252 GCAGGGGGCAGCGCTCGTCGGGG + Intergenic
1199356204 X:146866927-146866949 GCAGGGGGCGGCGCTCATCGGGG + Intergenic
1199628147 X:149758841-149758863 GCAGGGAGTGGCGCTCGTCCAGG - Intergenic
1199831241 X:151551231-151551253 GCAGGGGGTGGTGCTCGTTGGGG + Intergenic
1199831755 X:151555236-151555258 GCAGGGAGCAGTGCTCGTCGGGG + Intergenic
1199832994 X:151562888-151562910 GCGGGGGGTGTCGGTGGTCGGGG + Intergenic
1200423521 Y:2998420-2998442 GCAGGGGGTGGTGCTCGTCCGGG + Intergenic
1200470854 Y:3584135-3584157 GCAGGGGGCGGCGCTCACCGGGG + Intergenic
1200474024 Y:3623142-3623164 GCAGGGGGTGGTGCTCGTCGGGG + Intergenic
1200512655 Y:4099432-4099454 GCAGGGGGTGGTGCTCGTCGGGG - Intergenic
1200725797 Y:6666803-6666825 GCAGGGGGTGGCGCTCGTCAGGG + Intergenic
1200824253 Y:7622261-7622283 GCAGGGGGTGGTGCTCATCGGGG + Intergenic
1200873587 Y:8128561-8128583 GCAGTGGGCGGCGCTCCTCCAGG + Intergenic
1200888713 Y:8298933-8298955 ACAGGGGGAGGTGCTCGTCGGGG - Intergenic
1201232603 Y:11879603-11879625 GCAGGGGGTGGCACCCGTCAGGG + Intergenic
1201260918 Y:12158487-12158509 GCAGGGGGTGGCACCCATCAGGG + Intergenic
1201285437 Y:12375054-12375076 GCAGGGGGCGGCGCTCATCAGGG + Intergenic
1201423006 Y:13820250-13820272 GCAGGGGGTGGCACTTATTGGGG + Intergenic
1201424292 Y:13831659-13831681 GCAGGGGGCGGTGCCCGTCAGGG - Intergenic
1201479977 Y:14428406-14428428 GCAGGGGGTGGCGCTCGTCGGGG - Intergenic
1201487109 Y:14505966-14505988 GCAGGGGGTGGCACTAGTCGGGG - Intergenic
1201495653 Y:14589828-14589850 GCATGGGGTGGTGCTCCTTGGGG + Intronic
1201499532 Y:14627342-14627364 GCAGGGGGCGGTGCCCGTTGGGG + Intronic
1201573068 Y:15434159-15434181 GCAGGGGGTGGCATTCATCAGGG - Intergenic
1201715845 Y:17043428-17043450 GCAGGGGGTGGCGCTCGTTGGGG - Intergenic
1201901072 Y:19046616-19046638 GCAGGGGGCGGCGCTCGTTGGGG + Intergenic
1201982581 Y:19923761-19923783 GCAGGGGGTGGTGCTCGTTGGGG + Intergenic
1202100545 Y:21303618-21303640 GCAAGGGCTGGCACCCGTCGAGG + Intergenic
1202235801 Y:22708826-22708848 GCAGGGGGTGGTGCTCATCGGGG - Intergenic
1202271450 Y:23078384-23078406 GTAGGGGGTGGCGCTCGTCCAGG + Intergenic
1202294576 Y:23342298-23342320 GTAGGGGGTGGCGCTCGTCCAGG - Intergenic
1202307362 Y:23487342-23487364 GCAGGGGGTGGTGCTCATCGGGG + Intergenic
1202424445 Y:24712128-24712150 GTAGGGGGTGGCGCTCGTCCAGG + Intergenic
1202446344 Y:24957957-24957979 GTAGGGGGTGGCGCTCGTCCAGG - Intergenic
1202563443 Y:26183244-26183266 GCAGGGGGTGGTGCTCATCGGGG - Intergenic