ID: 996435742

View in Genome Browser
Species Human (GRCh38)
Location 5:123430878-123430900
Sequence GGGCGCCGTGGAGCAGGGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2361
Summary {0: 281, 1: 577, 2: 425, 3: 307, 4: 771}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996435742_996435763 28 Left 996435742 5:123430878-123430900 CCACCCCCTGCTCCACGGCGCCC 0: 281
1: 577
2: 425
3: 307
4: 771
Right 996435763 5:123430929-123430951 TGAGGAGTGCGGGCGCACGGCGG No data
996435742_996435754 4 Left 996435742 5:123430878-123430900 CCACCCCCTGCTCCACGGCGCCC 0: 281
1: 577
2: 425
3: 307
4: 771
Right 996435754 5:123430905-123430927 CCATCGGCGCCCAGTCCCAAGGG No data
996435742_996435752 3 Left 996435742 5:123430878-123430900 CCACCCCCTGCTCCACGGCGCCC 0: 281
1: 577
2: 425
3: 307
4: 771
Right 996435752 5:123430904-123430926 CCCATCGGCGCCCAGTCCCAAGG No data
996435742_996435759 18 Left 996435742 5:123430878-123430900 CCACCCCCTGCTCCACGGCGCCC 0: 281
1: 577
2: 425
3: 307
4: 771
Right 996435759 5:123430919-123430941 TCCCAAGGGCTGAGGAGTGCGGG 0: 11
1: 755
2: 636
3: 267
4: 412
996435742_996435765 30 Left 996435742 5:123430878-123430900 CCACCCCCTGCTCCACGGCGCCC 0: 281
1: 577
2: 425
3: 307
4: 771
Right 996435765 5:123430931-123430953 AGGAGTGCGGGCGCACGGCGGGG 0: 50
1: 183
2: 307
3: 385
4: 397
996435742_996435762 25 Left 996435742 5:123430878-123430900 CCACCCCCTGCTCCACGGCGCCC 0: 281
1: 577
2: 425
3: 307
4: 771
Right 996435762 5:123430926-123430948 GGCTGAGGAGTGCGGGCGCACGG 0: 188
1: 447
2: 511
3: 294
4: 391
996435742_996435758 17 Left 996435742 5:123430878-123430900 CCACCCCCTGCTCCACGGCGCCC 0: 281
1: 577
2: 425
3: 307
4: 771
Right 996435758 5:123430918-123430940 GTCCCAAGGGCTGAGGAGTGCGG No data
996435742_996435755 10 Left 996435742 5:123430878-123430900 CCACCCCCTGCTCCACGGCGCCC 0: 281
1: 577
2: 425
3: 307
4: 771
Right 996435755 5:123430911-123430933 GCGCCCAGTCCCAAGGGCTGAGG No data
996435742_996435764 29 Left 996435742 5:123430878-123430900 CCACCCCCTGCTCCACGGCGCCC 0: 281
1: 577
2: 425
3: 307
4: 771
Right 996435764 5:123430930-123430952 GAGGAGTGCGGGCGCACGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996435742 Original CRISPR GGGCGCCGTGGAGCAGGGGG TGG (reversed) Intergenic
Too many off-targets to display for this crispr