ID: 996435743

View in Genome Browser
Species Human (GRCh38)
Location 5:123430881-123430903
Sequence ACTGGGCGCCGTGGAGCAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2043
Summary {0: 300, 1: 613, 2: 404, 3: 272, 4: 454}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996435743_996435758 14 Left 996435743 5:123430881-123430903 CCCCCTGCTCCACGGCGCCCAGT 0: 300
1: 613
2: 404
3: 272
4: 454
Right 996435758 5:123430918-123430940 GTCCCAAGGGCTGAGGAGTGCGG No data
996435743_996435762 22 Left 996435743 5:123430881-123430903 CCCCCTGCTCCACGGCGCCCAGT 0: 300
1: 613
2: 404
3: 272
4: 454
Right 996435762 5:123430926-123430948 GGCTGAGGAGTGCGGGCGCACGG 0: 188
1: 447
2: 511
3: 294
4: 391
996435743_996435754 1 Left 996435743 5:123430881-123430903 CCCCCTGCTCCACGGCGCCCAGT 0: 300
1: 613
2: 404
3: 272
4: 454
Right 996435754 5:123430905-123430927 CCATCGGCGCCCAGTCCCAAGGG No data
996435743_996435764 26 Left 996435743 5:123430881-123430903 CCCCCTGCTCCACGGCGCCCAGT 0: 300
1: 613
2: 404
3: 272
4: 454
Right 996435764 5:123430930-123430952 GAGGAGTGCGGGCGCACGGCGGG No data
996435743_996435752 0 Left 996435743 5:123430881-123430903 CCCCCTGCTCCACGGCGCCCAGT 0: 300
1: 613
2: 404
3: 272
4: 454
Right 996435752 5:123430904-123430926 CCCATCGGCGCCCAGTCCCAAGG No data
996435743_996435755 7 Left 996435743 5:123430881-123430903 CCCCCTGCTCCACGGCGCCCAGT 0: 300
1: 613
2: 404
3: 272
4: 454
Right 996435755 5:123430911-123430933 GCGCCCAGTCCCAAGGGCTGAGG No data
996435743_996435765 27 Left 996435743 5:123430881-123430903 CCCCCTGCTCCACGGCGCCCAGT 0: 300
1: 613
2: 404
3: 272
4: 454
Right 996435765 5:123430931-123430953 AGGAGTGCGGGCGCACGGCGGGG 0: 50
1: 183
2: 307
3: 385
4: 397
996435743_996435763 25 Left 996435743 5:123430881-123430903 CCCCCTGCTCCACGGCGCCCAGT 0: 300
1: 613
2: 404
3: 272
4: 454
Right 996435763 5:123430929-123430951 TGAGGAGTGCGGGCGCACGGCGG No data
996435743_996435759 15 Left 996435743 5:123430881-123430903 CCCCCTGCTCCACGGCGCCCAGT 0: 300
1: 613
2: 404
3: 272
4: 454
Right 996435759 5:123430919-123430941 TCCCAAGGGCTGAGGAGTGCGGG 0: 11
1: 755
2: 636
3: 267
4: 412
996435743_996435766 28 Left 996435743 5:123430881-123430903 CCCCCTGCTCCACGGCGCCCAGT 0: 300
1: 613
2: 404
3: 272
4: 454
Right 996435766 5:123430932-123430954 GGAGTGCGGGCGCACGGCGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996435743 Original CRISPR ACTGGGCGCCGTGGAGCAGG GGG (reversed) Intergenic
Too many off-targets to display for this crispr