ID: 996435746

View in Genome Browser
Species Human (GRCh38)
Location 5:123430884-123430906
Sequence GGGACTGGGCGCCGTGGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2238
Summary {0: 331, 1: 669, 2: 459, 3: 269, 4: 510}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996435746_996435759 12 Left 996435746 5:123430884-123430906 CCTGCTCCACGGCGCCCAGTCCC 0: 331
1: 669
2: 459
3: 269
4: 510
Right 996435759 5:123430919-123430941 TCCCAAGGGCTGAGGAGTGCGGG 0: 11
1: 755
2: 636
3: 267
4: 412
996435746_996435762 19 Left 996435746 5:123430884-123430906 CCTGCTCCACGGCGCCCAGTCCC 0: 331
1: 669
2: 459
3: 269
4: 510
Right 996435762 5:123430926-123430948 GGCTGAGGAGTGCGGGCGCACGG 0: 188
1: 447
2: 511
3: 294
4: 391
996435746_996435752 -3 Left 996435746 5:123430884-123430906 CCTGCTCCACGGCGCCCAGTCCC 0: 331
1: 669
2: 459
3: 269
4: 510
Right 996435752 5:123430904-123430926 CCCATCGGCGCCCAGTCCCAAGG No data
996435746_996435765 24 Left 996435746 5:123430884-123430906 CCTGCTCCACGGCGCCCAGTCCC 0: 331
1: 669
2: 459
3: 269
4: 510
Right 996435765 5:123430931-123430953 AGGAGTGCGGGCGCACGGCGGGG 0: 50
1: 183
2: 307
3: 385
4: 397
996435746_996435763 22 Left 996435746 5:123430884-123430906 CCTGCTCCACGGCGCCCAGTCCC 0: 331
1: 669
2: 459
3: 269
4: 510
Right 996435763 5:123430929-123430951 TGAGGAGTGCGGGCGCACGGCGG No data
996435746_996435766 25 Left 996435746 5:123430884-123430906 CCTGCTCCACGGCGCCCAGTCCC 0: 331
1: 669
2: 459
3: 269
4: 510
Right 996435766 5:123430932-123430954 GGAGTGCGGGCGCACGGCGGGGG No data
996435746_996435764 23 Left 996435746 5:123430884-123430906 CCTGCTCCACGGCGCCCAGTCCC 0: 331
1: 669
2: 459
3: 269
4: 510
Right 996435764 5:123430930-123430952 GAGGAGTGCGGGCGCACGGCGGG No data
996435746_996435767 30 Left 996435746 5:123430884-123430906 CCTGCTCCACGGCGCCCAGTCCC 0: 331
1: 669
2: 459
3: 269
4: 510
Right 996435767 5:123430937-123430959 GCGGGCGCACGGCGGGGGACTGG No data
996435746_996435758 11 Left 996435746 5:123430884-123430906 CCTGCTCCACGGCGCCCAGTCCC 0: 331
1: 669
2: 459
3: 269
4: 510
Right 996435758 5:123430918-123430940 GTCCCAAGGGCTGAGGAGTGCGG No data
996435746_996435755 4 Left 996435746 5:123430884-123430906 CCTGCTCCACGGCGCCCAGTCCC 0: 331
1: 669
2: 459
3: 269
4: 510
Right 996435755 5:123430911-123430933 GCGCCCAGTCCCAAGGGCTGAGG No data
996435746_996435754 -2 Left 996435746 5:123430884-123430906 CCTGCTCCACGGCGCCCAGTCCC 0: 331
1: 669
2: 459
3: 269
4: 510
Right 996435754 5:123430905-123430927 CCATCGGCGCCCAGTCCCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996435746 Original CRISPR GGGACTGGGCGCCGTGGAGC AGG (reversed) Intergenic
Too many off-targets to display for this crispr