ID: 996435747

View in Genome Browser
Species Human (GRCh38)
Location 5:123430889-123430911
Sequence TCCACGGCGCCCAGTCCCAT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 3, 1: 7, 2: 4, 3: 6, 4: 130}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996435738_996435747 8 Left 996435738 5:123430858-123430880 CCGAGCCTCCTCGACGAGCGCCA No data
Right 996435747 5:123430889-123430911 TCCACGGCGCCCAGTCCCATCGG 0: 3
1: 7
2: 4
3: 6
4: 130
996435737_996435747 9 Left 996435737 5:123430857-123430879 CCCGAGCCTCCTCGACGAGCGCC No data
Right 996435747 5:123430889-123430911 TCCACGGCGCCCAGTCCCATCGG 0: 3
1: 7
2: 4
3: 6
4: 130
996435740_996435747 0 Left 996435740 5:123430866-123430888 CCTCGACGAGCGCCACCCCCTGC 0: 61
1: 283
2: 492
3: 471
4: 533
Right 996435747 5:123430889-123430911 TCCACGGCGCCCAGTCCCATCGG 0: 3
1: 7
2: 4
3: 6
4: 130
996435735_996435747 27 Left 996435735 5:123430839-123430861 CCGTGGGCTCCTGTGCGGCCCGA 0: 192
1: 439
2: 433
3: 309
4: 309
Right 996435747 5:123430889-123430911 TCCACGGCGCCCAGTCCCATCGG 0: 3
1: 7
2: 4
3: 6
4: 130
996435734_996435747 30 Left 996435734 5:123430836-123430858 CCTCCGTGGGCTCCTGTGCGGCC 0: 94
1: 282
2: 335
3: 234
4: 330
Right 996435747 5:123430889-123430911 TCCACGGCGCCCAGTCCCATCGG 0: 3
1: 7
2: 4
3: 6
4: 130
996435736_996435747 18 Left 996435736 5:123430848-123430870 CCTGTGCGGCCCGAGCCTCCTCG No data
Right 996435747 5:123430889-123430911 TCCACGGCGCCCAGTCCCATCGG 0: 3
1: 7
2: 4
3: 6
4: 130
996435739_996435747 3 Left 996435739 5:123430863-123430885 CCTCCTCGACGAGCGCCACCCCC No data
Right 996435747 5:123430889-123430911 TCCACGGCGCCCAGTCCCATCGG 0: 3
1: 7
2: 4
3: 6
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996435747 Original CRISPR TCCACGGCGCCCAGTCCCAT CGG Intergenic
901449313 1:9326340-9326362 TCCACGGGGCCCAGTCTGAGTGG - Intronic
905810100 1:40906384-40906406 GCCACCGCGCCCAGCCCCATTGG + Intergenic
908059979 1:60337190-60337212 GCCACCGCGCCCAGCCCCTTAGG - Intergenic
912499166 1:110110573-110110595 GCCACCGCGCCCGGCCCCATGGG + Intergenic
915687212 1:157645559-157645581 TCCACCGGGCCCAGTCACTTTGG - Intergenic
915939226 1:160108157-160108179 GCCACTGCGCCCAGCCGCATCGG - Intergenic
918659708 1:187073838-187073860 TCCACGGCGCCCAGTCCCATCGG - Intergenic
1064775015 10:18766852-18766874 GCCACTGCGCCCAGCCCCAATGG - Intergenic
1065877565 10:30010629-30010651 ACCACCGCGCCCAGCCCCACCGG - Intergenic
1072594233 10:96856345-96856367 GCCACGGCGCCCAGCCCTAATGG + Intronic
1073397270 10:103228504-103228526 GCCACCGCGCCCAGACACATTGG - Intergenic
1075882485 10:125865813-125865835 GCCACTGTGCCCAGCCCCATGGG + Intronic
1077444562 11:2584990-2585012 AGCAAGGGGCCCAGTCCCATGGG - Intronic
1078231944 11:9451637-9451659 GCCACCGTGCCCAGCCCCATTGG - Intergenic
1078783140 11:14459052-14459074 GCCACCACGCCCAGCCCCATTGG + Intronic
1080503033 11:32888233-32888255 TCCATGGCACCCAGTCCCATCGG - Intergenic
1081036065 11:38148286-38148308 GCCACGGCACCCAGCCTCATTGG + Intergenic
1083130159 11:60617644-60617666 GCCACCGCGCCCAGCCCAATAGG + Intergenic
1086319582 11:85630752-85630774 ACCAAGGAGCCCAGTGCCATGGG + Intronic
1087473532 11:98606527-98606549 GCCACCGCGCCCAGCCGCATTGG + Intergenic
1088495703 11:110429863-110429885 CCCACGCCGCCCGGTCCCATGGG - Exonic
1095589817 12:43890814-43890836 GCCACTGCGCCCAGCCCCAAGGG + Intronic
1096153980 12:49331680-49331702 TGGGCGGCTCCCAGTCCCATGGG - Exonic
1101022548 12:100567936-100567958 TACATGGCTCCCAGTCCCACTGG + Intergenic
1102327342 12:111998529-111998551 GCCACTGCGCCCAGCCTCATAGG - Intronic
1103222507 12:119257612-119257634 GCCATGGCGCCCAGGCCCACAGG - Intergenic
1104448739 12:128853259-128853281 TCCACGGGGACCAGGACCATCGG - Intergenic
1104688472 12:130806373-130806395 TCCACGGCCCCCAGTCTCATGGG + Intronic
1108142581 13:47440210-47440232 GCCACCGCGCCCAGCCCCAGTGG + Intergenic
1110774765 13:79394918-79394940 GCCACGGCACCCAGCCCCAAAGG + Intronic
1112328385 13:98459174-98459196 CCCACGGGGCCAACTCCCATGGG + Intronic
1115552665 14:34518615-34518637 GCCACTGCGCCCAGCCCCTTTGG + Intronic
1122649831 14:103220407-103220429 TCCCCGGCCCCCCATCCCATGGG + Intergenic
1124287699 15:28418313-28418335 GCCACGGCGCCCAGGCCATTTGG - Intergenic
1124288220 15:28424014-28424036 GCCACGGCGCCCAGGCCATTTGG - Intergenic
1124295005 15:28493313-28493335 GCCACGGCGCCCAGGCCATTTGG + Intergenic
1125027686 15:35046972-35046994 GCCATGGCGCCCAGCCCCTTCGG - Intergenic
1125094187 15:35831949-35831971 GCCACCGCGCCCAGCCTCATAGG - Intergenic
1127880885 15:63157625-63157647 TCCAGGGTGCCAAGTCCCGTGGG + Exonic
1128838343 15:70829423-70829445 GCCACCGTGCCCAGCCCCATAGG + Exonic
1132117193 15:99146016-99146038 TCCAGGTTGCCAAGTCCCATGGG + Intronic
1132155790 15:99494699-99494721 TCCACGGCGCCCGGTCCCATTGG - Intergenic
1132510052 16:335687-335709 TCCAAGGCACCCAGTACCACAGG + Intronic
1132975447 16:2709107-2709129 TCCAAGCCGCCCAGCCCCACTGG + Intergenic
1133746589 16:8691725-8691747 GCCACCGCGCCCAGTGCCAAGGG + Intronic
1135009768 16:18864761-18864783 ACCACCGCGCCCAGCCCCAAAGG + Intronic
1135064857 16:19300845-19300867 TCCATGGCTCCAACTCCCATAGG - Intronic
1136313471 16:29432392-29432414 GCCACCGCGCCCAGCCCCAAAGG + Intergenic
1136326913 16:29534158-29534180 GCCACCGCGCCCAGCCCCAAAGG + Intergenic
1136441604 16:30274142-30274164 GCCACCGCGCCCAGCCCCAAAGG + Intergenic
1138564411 16:57822413-57822435 GCCACCGCGCCCAGCCACATTGG - Intronic
1139888395 16:70227876-70227898 GCCACCGCGCCCAGCCCCAAAGG + Intergenic
1141099457 16:81186373-81186395 TCCACAGCGCCAAGTCCCTGTGG + Intergenic
1142148926 16:88504218-88504240 GCCAGGGCGCCCAGGCCGATAGG + Intronic
1142505887 17:362933-362955 TACACTGCGGCCAGTCCCCTGGG + Intronic
1143615910 17:8048984-8049006 GCCACTGCGCCCAGTCTCTTTGG - Exonic
1144354373 17:14430010-14430032 GCCACGGCGCCCAGCCCTCTTGG + Intergenic
1145090824 17:19984747-19984769 GCCACCGCGCCCAGCCCCCTTGG - Intergenic
1147364560 17:39951747-39951769 TCCACGGGGCCCTGTCCCTCTGG + Intergenic
1148870430 17:50656032-50656054 TCCCCAGGGCCCAGCCCCATCGG - Intronic
1149753319 17:59166875-59166897 GCCACCGCGCCCGGTCCTATAGG - Intronic
1150584311 17:66503606-66503628 TCCACGGAGTCCAGTCTCACAGG - Intronic
1151977307 17:77490068-77490090 CCCAAGGCGTCCAGTCCCATGGG + Intronic
1152344086 17:79741273-79741295 GCCACTGGGCCCAGTCCCTTGGG + Intronic
1152856663 17:82668528-82668550 TCAACAGCGCCCAGTCCCGAGGG + Intronic
1157597380 18:48871975-48871997 TCCACTGACCCCAGTCCCAGTGG - Intergenic
1159443449 18:68510393-68510415 TCCACGTTGCCCAGTTCCATAGG - Intergenic
1160687827 19:445063-445085 TCCACGGCGCCCAGTGCTGCCGG + Intronic
1160920257 19:1516229-1516251 TCCAGGGCCCTGAGTCCCATGGG - Intergenic
1160965949 19:1747042-1747064 TCCCCGCCGCCCAGTCCCTCGGG + Intergenic
1162072399 19:8161901-8161923 GCCACCGCGCCCGGTCCCAATGG - Intronic
1162288505 19:9760003-9760025 GCCACCACGCCCAGCCCCATAGG - Intronic
1165478750 19:36048649-36048671 GCCACCGCGCCCAGCCCAATGGG + Intronic
1165947131 19:39450425-39450447 GCCACTGCGCCCAGGCCCAGAGG + Intronic
1166045125 19:40225467-40225489 TCCATGGCTCCCAGTACCCTTGG + Intronic
1167221790 19:48204110-48204132 GCCCCGGCGCCCAGACCCTTTGG - Intronic
925302626 2:2827948-2827970 TCCCCGGCACCCAGCCCCAAGGG + Intergenic
928723066 2:34142556-34142578 TCCACAGCGCCCGGTCCCATCGG - Intergenic
932627883 2:73313459-73313481 GCCACCGCTCCCAGCCCCATGGG - Intergenic
934661574 2:96146098-96146120 TCCCCGGGGCCCAGGCCCCTGGG + Intergenic
938404163 2:131019124-131019146 GCCACTGCGCCCAGCCCCAGTGG - Intronic
941139776 2:161765318-161765340 GCCACCACGCCCAGCCCCATTGG - Intronic
944447315 2:199804740-199804762 TCCATTTCCCCCAGTCCCATTGG + Intronic
944547034 2:200809350-200809372 TGCACGGTGCCTATTCCCATGGG + Intergenic
947174323 2:227347678-227347700 GCCAAGGGGCCCCGTCCCATTGG + Intronic
948067402 2:235091475-235091497 GCCACTGTGCCCAGTCTCATTGG + Intergenic
948621197 2:239235751-239235773 GCCACCGCGCCCAGCCCCATAGG - Intronic
1171011890 20:21513509-21513531 TCCAGGGCGCCCTGCCCCAGCGG + Exonic
1172431798 20:34898823-34898845 CTCACGGCACCCAGTCCCATCGG - Intronic
1175931552 20:62496110-62496132 TCCACCTGGCCCCGTCCCATGGG + Intergenic
1178984536 21:37291486-37291508 GCCACCGCGCCCAGCCCCCTCGG - Intergenic
1183744861 22:39686316-39686338 GCCAAGGGGCCCAGGCCCATGGG - Exonic
950010082 3:9716754-9716776 GCCACGGCGCCCAGCCAAATGGG + Intronic
950069645 3:10141980-10142002 TCCTCGGCGCCCAGTTCCTCCGG - Exonic
956346177 3:68281742-68281764 GCCACCGCGCCTGGTCCCATGGG + Intronic
965032178 3:163385722-163385744 GCCACCGCGCCCAGCCACATTGG + Intergenic
966948005 3:184791031-184791053 GCCACTGCGCCCAGCCCGATCGG + Intergenic
970649272 4:18159291-18159313 TCCACGGCACCCAGTCCCATAGG - Intergenic
975755920 4:77571002-77571024 TCCACGGTGCCCAGTCCCATCGG + Intronic
984533226 4:180943723-180943745 GCCACTGCGCCCGGCCCCATAGG + Intergenic
985894068 5:2738864-2738886 GCCTCGGCGTCCAGGCCCATTGG - Intergenic
986687680 5:10288780-10288802 TCCACAGGGCACACTCCCATGGG + Intronic
991470550 5:66964513-66964535 GCCACCGTGCCCAGCCCCATAGG - Intronic
993715870 5:91275350-91275372 TCCACTGCGCCCAGCCTCAAGGG - Intergenic
996435747 5:123430889-123430911 TCCACGGCGCCCAGTCCCATCGG + Intergenic
996435754 5:123430905-123430927 CCATCGGCGCCCAGTCCCAAGGG + Intergenic
997550148 5:134745464-134745486 GCCACGGCGCCCAGCCTCAAAGG - Intronic
1000099417 5:158000912-158000934 GCCACTGCGCCCAGCCCCTTGGG - Intergenic
1000652833 5:163838030-163838052 TCAAAGGAGCCCAGTCTCATGGG + Intergenic
1002546182 5:179946838-179946860 GCCACCGCGCCCAGCACCATAGG + Intronic
1003284800 6:4725351-4725373 TCCACGGCGCCCAGTCCCATCGG - Intronic
1005712058 6:28512126-28512148 TCCACGCCGCCCAGTCCCATCGG + Intronic
1005749026 6:28866504-28866526 TCCACGGCGCCCAATCCCATCGG - Intergenic
1007636407 6:43302411-43302433 TCCGGTGAGCCCAGTCCCATAGG + Exonic
1012993593 6:105950413-105950435 TCTACGGGGATCAGTCCCATAGG - Intergenic
1012999460 6:106008084-106008106 GCCACCGCGCCCAGCCCCACTGG - Intergenic
1015337215 6:132053521-132053543 TGCATGGTGCCCAGTCACATGGG + Intergenic
1018041428 6:159926396-159926418 GCCACTGCGCCCAGCCCCTTGGG + Intergenic
1025899023 7:65728982-65729004 GCCACCGCGCCCAGCCCTATTGG - Intergenic
1027698228 7:81437110-81437132 TCCAGGGCGCCCAGTCCCATCGG - Intergenic
1029497096 7:100901732-100901754 GCCACTGCGCCCAGCCCCAGTGG + Intergenic
1032029503 7:128470821-128470843 GCTACTGTGCCCAGTCCCATTGG + Intergenic
1032350516 7:131158776-131158798 TCCAGGCTGCCCAGTGCCATTGG + Intronic
1035342785 7:158174964-158174986 TCCACCCAGCCCAGTCCCAAAGG + Intronic
1035776981 8:2195905-2195927 TCCACGAAGCCCTGTTCCATGGG - Intergenic
1037656470 8:20888256-20888278 TTCACTGCCCCCAGTTCCATGGG + Intergenic
1038188149 8:25294279-25294301 TCCATGGCGGCCAGACCCACAGG - Intronic
1038753315 8:30316825-30316847 GCCACCGCGCCCAGCCCCTTTGG + Intergenic
1038942089 8:32316189-32316211 GCCACCGCGCCCGGTCCCTTAGG - Intronic
1041974230 8:63778603-63778625 GCCACTGCACCCAGTCCCCTGGG - Intergenic
1042948706 8:74179552-74179574 TCCACAGCGCCCGGTCCCATCGG - Intergenic
1043075656 8:75695537-75695559 TCCATGCCTCCCATTCCCATGGG + Intergenic
1049531339 8:143157097-143157119 CCCACGGCACCCAGTCCCTCCGG + Intergenic
1049847951 8:144813029-144813051 GCCACTGCGCCCAGCCTCATTGG - Intergenic
1051419672 9:16877110-16877132 TCCATGGAGCCCAGTCCCGCAGG - Intergenic
1052982599 9:34459730-34459752 GCCACGGCGCCCAGCCTCAAAGG + Intronic
1056922770 9:90806519-90806541 TCCACTGTGCCCAGCCCTATGGG + Intronic
1056980280 9:91303611-91303633 GCCACTGCGCCCAGCCCCACAGG + Intronic
1060216972 9:121744241-121744263 TCCATGGGGCCCAGGCCCACTGG + Intronic
1062115409 9:134805748-134805770 TCCAGGGCCCCCATGCCCATGGG - Intronic
1062215857 9:135389442-135389464 GCCACGGTGCCCAGTGCCACGGG - Intergenic
1062579367 9:137222605-137222627 TCCCCGGCCCCCCGCCCCATGGG + Intergenic
1185878389 X:3718437-3718459 GCCACCGTGCCCAATCCCATTGG - Intergenic
1186826110 X:13341446-13341468 GCCACCGCGCCCAGCCCCCTTGG + Intergenic
1198800940 X:140446993-140447015 GCCACCGCGCCCAGCCCCAGTGG + Intergenic
1201469145 Y:14314789-14314811 TCCATGGCGCCCAGTCCCATCGG + Intergenic
1202271442 Y:23078361-23078383 TCCATGGTGCCTGGTCCCATCGG - Intergenic
1202294584 Y:23342321-23342343 TCCATGGTGCCTGGTCCCATCGG + Intergenic
1202424437 Y:24712105-24712127 TCCATGGTGCCTGGTCCCATCGG - Intergenic
1202446352 Y:24957980-24958002 TCCATGGTGCCTGGTCCCATCGG + Intergenic