ID: 996435748

View in Genome Browser
Species Human (GRCh38)
Location 5:123430890-123430912
Sequence GCCGATGGGACTGGGCGCCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996435748_996435764 17 Left 996435748 5:123430890-123430912 CCACGGCGCCCAGTCCCATCGGC No data
Right 996435764 5:123430930-123430952 GAGGAGTGCGGGCGCACGGCGGG No data
996435748_996435766 19 Left 996435748 5:123430890-123430912 CCACGGCGCCCAGTCCCATCGGC No data
Right 996435766 5:123430932-123430954 GGAGTGCGGGCGCACGGCGGGGG No data
996435748_996435763 16 Left 996435748 5:123430890-123430912 CCACGGCGCCCAGTCCCATCGGC No data
Right 996435763 5:123430929-123430951 TGAGGAGTGCGGGCGCACGGCGG No data
996435748_996435752 -9 Left 996435748 5:123430890-123430912 CCACGGCGCCCAGTCCCATCGGC No data
Right 996435752 5:123430904-123430926 CCCATCGGCGCCCAGTCCCAAGG No data
996435748_996435765 18 Left 996435748 5:123430890-123430912 CCACGGCGCCCAGTCCCATCGGC No data
Right 996435765 5:123430931-123430953 AGGAGTGCGGGCGCACGGCGGGG 0: 50
1: 183
2: 307
3: 385
4: 397
996435748_996435759 6 Left 996435748 5:123430890-123430912 CCACGGCGCCCAGTCCCATCGGC No data
Right 996435759 5:123430919-123430941 TCCCAAGGGCTGAGGAGTGCGGG 0: 11
1: 755
2: 636
3: 267
4: 412
996435748_996435754 -8 Left 996435748 5:123430890-123430912 CCACGGCGCCCAGTCCCATCGGC No data
Right 996435754 5:123430905-123430927 CCATCGGCGCCCAGTCCCAAGGG No data
996435748_996435762 13 Left 996435748 5:123430890-123430912 CCACGGCGCCCAGTCCCATCGGC No data
Right 996435762 5:123430926-123430948 GGCTGAGGAGTGCGGGCGCACGG 0: 188
1: 447
2: 511
3: 294
4: 391
996435748_996435768 28 Left 996435748 5:123430890-123430912 CCACGGCGCCCAGTCCCATCGGC No data
Right 996435768 5:123430941-123430963 GCGCACGGCGGGGGACTGGCAGG No data
996435748_996435767 24 Left 996435748 5:123430890-123430912 CCACGGCGCCCAGTCCCATCGGC No data
Right 996435767 5:123430937-123430959 GCGGGCGCACGGCGGGGGACTGG No data
996435748_996435758 5 Left 996435748 5:123430890-123430912 CCACGGCGCCCAGTCCCATCGGC No data
Right 996435758 5:123430918-123430940 GTCCCAAGGGCTGAGGAGTGCGG No data
996435748_996435755 -2 Left 996435748 5:123430890-123430912 CCACGGCGCCCAGTCCCATCGGC No data
Right 996435755 5:123430911-123430933 GCGCCCAGTCCCAAGGGCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996435748 Original CRISPR GCCGATGGGACTGGGCGCCG TGG (reversed) Intergenic
No off target data available for this crispr