ID: 996435754

View in Genome Browser
Species Human (GRCh38)
Location 5:123430905-123430927
Sequence CCATCGGCGCCCAGTCCCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996435743_996435754 1 Left 996435743 5:123430881-123430903 CCCCCTGCTCCACGGCGCCCAGT No data
Right 996435754 5:123430905-123430927 CCATCGGCGCCCAGTCCCAAGGG No data
996435738_996435754 24 Left 996435738 5:123430858-123430880 CCGAGCCTCCTCGACGAGCGCCA No data
Right 996435754 5:123430905-123430927 CCATCGGCGCCCAGTCCCAAGGG No data
996435745_996435754 -1 Left 996435745 5:123430883-123430905 CCCTGCTCCACGGCGCCCAGTCC No data
Right 996435754 5:123430905-123430927 CCATCGGCGCCCAGTCCCAAGGG No data
996435739_996435754 19 Left 996435739 5:123430863-123430885 CCTCCTCGACGAGCGCCACCCCC No data
Right 996435754 5:123430905-123430927 CCATCGGCGCCCAGTCCCAAGGG No data
996435740_996435754 16 Left 996435740 5:123430866-123430888 CCTCGACGAGCGCCACCCCCTGC No data
Right 996435754 5:123430905-123430927 CCATCGGCGCCCAGTCCCAAGGG No data
996435744_996435754 0 Left 996435744 5:123430882-123430904 CCCCTGCTCCACGGCGCCCAGTC No data
Right 996435754 5:123430905-123430927 CCATCGGCGCCCAGTCCCAAGGG No data
996435748_996435754 -8 Left 996435748 5:123430890-123430912 CCACGGCGCCCAGTCCCATCGGC No data
Right 996435754 5:123430905-123430927 CCATCGGCGCCCAGTCCCAAGGG No data
996435746_996435754 -2 Left 996435746 5:123430884-123430906 CCTGCTCCACGGCGCCCAGTCCC No data
Right 996435754 5:123430905-123430927 CCATCGGCGCCCAGTCCCAAGGG No data
996435737_996435754 25 Left 996435737 5:123430857-123430879 CCCGAGCCTCCTCGACGAGCGCC No data
Right 996435754 5:123430905-123430927 CCATCGGCGCCCAGTCCCAAGGG No data
996435742_996435754 4 Left 996435742 5:123430878-123430900 CCACCCCCTGCTCCACGGCGCCC No data
Right 996435754 5:123430905-123430927 CCATCGGCGCCCAGTCCCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996435754 Original CRISPR CCATCGGCGCCCAGTCCCAA GGG Intergenic