ID: 996436463

View in Genome Browser
Species Human (GRCh38)
Location 5:123438530-123438552
Sequence GTTGACTGCCGTACTGAGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996436460_996436463 -4 Left 996436460 5:123438511-123438533 CCAGGCCCAGGAAACAAGTGTTG No data
Right 996436463 5:123438530-123438552 GTTGACTGCCGTACTGAGAATGG No data
996436461_996436463 -9 Left 996436461 5:123438516-123438538 CCCAGGAAACAAGTGTTGACTGC No data
Right 996436463 5:123438530-123438552 GTTGACTGCCGTACTGAGAATGG No data
996436459_996436463 0 Left 996436459 5:123438507-123438529 CCAACCAGGCCCAGGAAACAAGT No data
Right 996436463 5:123438530-123438552 GTTGACTGCCGTACTGAGAATGG No data
996436462_996436463 -10 Left 996436462 5:123438517-123438539 CCAGGAAACAAGTGTTGACTGCC No data
Right 996436463 5:123438530-123438552 GTTGACTGCCGTACTGAGAATGG No data
996436457_996436463 8 Left 996436457 5:123438499-123438521 CCTTTAAACCAACCAGGCCCAGG No data
Right 996436463 5:123438530-123438552 GTTGACTGCCGTACTGAGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996436463 Original CRISPR GTTGACTGCCGTACTGAGAA TGG Intergenic
No off target data available for this crispr