ID: 996438652

View in Genome Browser
Species Human (GRCh38)
Location 5:123464001-123464023
Sequence AGATATAACAAGTGTCAGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996438652_996438654 14 Left 996438652 5:123464001-123464023 CCTCACTGACACTTGTTATATCT No data
Right 996438654 5:123464038-123464060 TAGTCATCCTAACAGGTGTGAGG 0: 12
1: 93
2: 481
3: 1013
4: 1758
996438652_996438653 7 Left 996438652 5:123464001-123464023 CCTCACTGACACTTGTTATATCT No data
Right 996438653 5:123464031-123464053 TTCATAGTAGTCATCCTAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996438652 Original CRISPR AGATATAACAAGTGTCAGTG AGG (reversed) Intergenic
No off target data available for this crispr