ID: 996442309

View in Genome Browser
Species Human (GRCh38)
Location 5:123505947-123505969
Sequence TTGTGAGGCTCTCTAGCTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996442309_996442311 5 Left 996442309 5:123505947-123505969 CCTGAAGCTAGAGAGCCTCACAA No data
Right 996442311 5:123505975-123505997 AGACAGTCAAAGATTATGTTAGG No data
996442309_996442313 29 Left 996442309 5:123505947-123505969 CCTGAAGCTAGAGAGCCTCACAA No data
Right 996442313 5:123505999-123506021 TGAAGCCAAAGAAGTTAAACAGG No data
996442309_996442312 6 Left 996442309 5:123505947-123505969 CCTGAAGCTAGAGAGCCTCACAA No data
Right 996442312 5:123505976-123505998 GACAGTCAAAGATTATGTTAGGG No data
996442309_996442314 30 Left 996442309 5:123505947-123505969 CCTGAAGCTAGAGAGCCTCACAA No data
Right 996442314 5:123506000-123506022 GAAGCCAAAGAAGTTAAACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996442309 Original CRISPR TTGTGAGGCTCTCTAGCTTC AGG (reversed) Intergenic
No off target data available for this crispr