ID: 996442912

View in Genome Browser
Species Human (GRCh38)
Location 5:123512271-123512293
Sequence CTGTCGCCACCGATGCAGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 70
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 67}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996442912_996442921 20 Left 996442912 5:123512271-123512293 CCGGGCTGCATCGGTGGCGACAG 0: 1
1: 0
2: 0
3: 2
4: 67
Right 996442921 5:123512314-123512336 CTCCGGCCAGCGGCGGCGGTAGG 0: 1
1: 0
2: 1
3: 14
4: 378
996442912_996442918 10 Left 996442912 5:123512271-123512293 CCGGGCTGCATCGGTGGCGACAG 0: 1
1: 0
2: 0
3: 2
4: 67
Right 996442918 5:123512304-123512326 GGCGGCGACTCTCCGGCCAGCGG 0: 1
1: 0
2: 0
3: 6
4: 65
996442912_996442916 -8 Left 996442912 5:123512271-123512293 CCGGGCTGCATCGGTGGCGACAG 0: 1
1: 0
2: 0
3: 2
4: 67
Right 996442916 5:123512286-123512308 GGCGACAGCAGAGGCTCGGGCGG 0: 1
1: 0
2: 1
3: 15
4: 281
996442912_996442917 3 Left 996442912 5:123512271-123512293 CCGGGCTGCATCGGTGGCGACAG 0: 1
1: 0
2: 0
3: 2
4: 67
Right 996442917 5:123512297-123512319 AGGCTCGGGCGGCGACTCTCCGG 0: 1
1: 0
2: 0
3: 4
4: 55
996442912_996442919 13 Left 996442912 5:123512271-123512293 CCGGGCTGCATCGGTGGCGACAG 0: 1
1: 0
2: 0
3: 2
4: 67
Right 996442919 5:123512307-123512329 GGCGACTCTCCGGCCAGCGGCGG 0: 1
1: 0
2: 0
3: 7
4: 58
996442912_996442920 16 Left 996442912 5:123512271-123512293 CCGGGCTGCATCGGTGGCGACAG 0: 1
1: 0
2: 0
3: 2
4: 67
Right 996442920 5:123512310-123512332 GACTCTCCGGCCAGCGGCGGCGG 0: 1
1: 0
2: 0
3: 9
4: 189
996442912_996442923 23 Left 996442912 5:123512271-123512293 CCGGGCTGCATCGGTGGCGACAG 0: 1
1: 0
2: 0
3: 2
4: 67
Right 996442923 5:123512317-123512339 CGGCCAGCGGCGGCGGTAGGAGG 0: 1
1: 0
2: 0
3: 12
4: 216

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996442912 Original CRISPR CTGTCGCCACCGATGCAGCC CGG (reversed) Intronic
903907485 1:26696764-26696786 CTGCCGCCACCGCCGCCGCCGGG - Exonic
904029665 1:27526241-27526263 CTGACACCACTGATGCAGGCAGG - Intergenic
905443990 1:38012929-38012951 CTGTCGCCACCGTGGGATCCGGG + Intronic
907409271 1:54273411-54273433 CAGCCGCCGCCGAGGCAGCCTGG + Intronic
907459578 1:54597394-54597416 ATGTGGCCACCATTGCAGCCAGG + Exonic
910759019 1:90717639-90717661 CCGCCGCCACCGCTGCCGCCCGG - Intergenic
912174684 1:107141230-107141252 CCGCCGCCACCGCCGCAGCCCGG - Intronic
924613358 1:245591825-245591847 CTGTCTCCATCCTTGCAGCCTGG + Intronic
1064645356 10:17454271-17454293 CCGCCGCCACCGCTGCTGCCGGG + Exonic
1066100228 10:32110998-32111020 CTGTGGCCGCCGCTGCTGCCTGG - Intergenic
1066275116 10:33861220-33861242 CTGCTGCCTCCCATGCAGCCAGG - Intergenic
1066659659 10:37727679-37727701 CTGCCGCCAGCAGTGCAGCCCGG - Intergenic
1076873236 10:133203716-133203738 CTGTCTGCACCGGTGAAGCCTGG + Intronic
1077169654 11:1160533-1160555 CTGCGGCCACAGATGCAGCATGG - Intronic
1091487657 12:905436-905458 CTGTCGCCCCTGATGCTGCGAGG - Intronic
1105295961 13:19088131-19088153 CTGTCTACACATATGCAGCCAGG - Intergenic
1122833742 14:104421059-104421081 CTGGAGCCTCCGACGCAGCCTGG + Intergenic
1141600948 16:85126118-85126140 GGGTTGCCCCCGATGCAGCCAGG - Intergenic
1141816976 16:86417590-86417612 CGGTGTCCACCCATGCAGCCAGG + Intergenic
1142239619 16:88939281-88939303 CTGTCACCACCTGTGAAGCCAGG - Intronic
1142560380 17:805992-806014 CTGTGGCCACCGATGCAAGACGG + Intronic
1142685902 17:1576792-1576814 CTGGCACCAACGGTGCAGCCCGG - Intronic
1144632025 17:16878710-16878732 CAGTGGCCACAGCTGCAGCCTGG + Intergenic
1145816591 17:27799192-27799214 CTGTGGCCAGTGATGAAGCCTGG - Intronic
1147742845 17:42678452-42678474 CTGTCCCCACCGCTCCAGCCTGG - Intergenic
1158511520 18:58094753-58094775 GTGCCGCCACCTATGCAGTCAGG - Intronic
1160788736 19:913168-913190 CTGTCGCCGCCGCCGCCGCCCGG + Exonic
1164977028 19:32581147-32581169 CAGGCGCCACCAATCCAGCCCGG - Exonic
925261277 2:2530553-2530575 CTCTGGCTGCCGATGCAGCCTGG + Intergenic
925913360 2:8587484-8587506 CTGTGGCCACCGCGGCAGCACGG + Intergenic
929777703 2:44939033-44939055 CGGTCGCCACCCAAGCAGGCGGG + Intergenic
936985303 2:118306427-118306449 TTGTCACCACCCAAGCAGCCGGG + Intergenic
1172336827 20:34123263-34123285 CTGTAGCCACAGCTGGAGCCTGG - Intergenic
1175179581 20:57136055-57136077 CTGTGGCCACCCAGGCAGCGTGG + Intergenic
1176546648 21:8205228-8205250 CTGGCGCCACCGGGCCAGCCGGG - Intergenic
1176554543 21:8249418-8249440 CTGGCGCCACCGGGCCAGCCGGG - Intergenic
1176565599 21:8388275-8388297 CTGGCGCCACCGGGCCAGCCGGG - Intergenic
1176573464 21:8432443-8432465 CTGGCGCCACCGGGCCAGCCGGG - Intergenic
1178063266 21:28875080-28875102 ATGAAGCCACCGATGCAGGCTGG + Exonic
1203251513 22_KI270733v1_random:121494-121516 CTGGCGCCACCGGGCCAGCCGGG - Intergenic
1203259563 22_KI270733v1_random:166576-166598 CTGGCGCCACCGGGCCAGCCGGG - Intergenic
953246610 3:41199430-41199452 CTGCCGCCACCGGCGCAGCGCGG - Exonic
961532530 3:127547977-127547999 CTCTCGCCCCCAGTGCAGCCCGG - Intergenic
969337637 4:6521108-6521130 CTGTGGCCACCGATGCTGTGTGG - Intronic
969442044 4:7222964-7222986 CTCCCTCCACCGACGCAGCCAGG - Intronic
969476518 4:7425303-7425325 CTGTCTCCACAGCCGCAGCCTGG + Intronic
995732846 5:115264653-115264675 TTGTAGCCACCGCTGGAGCCTGG + Intergenic
996442912 5:123512271-123512293 CTGTCGCCACCGATGCAGCCCGG - Intronic
997013382 5:129904560-129904582 CTGCCGCCACCGCCGCCGCCGGG + Exonic
1000052355 5:157574627-157574649 CTGGCTCCACCGCTGCAGACGGG - Intronic
1002638301 5:180618849-180618871 CGGCCGCCTCCGATCCAGCCTGG + Exonic
1004504732 6:16238659-16238681 CCGTCGCCGCCGCCGCAGCCAGG + Exonic
1006497303 6:34433037-34433059 CTGTGGCCAGCACTGCAGCCAGG + Intergenic
1010597844 6:77787148-77787170 CTGTGGACACTGAAGCAGCCAGG + Intronic
1017777391 6:157690905-157690927 CTGTCACCACCCATGAATCCTGG - Intergenic
1020756629 7:12211379-12211401 CTGTCCGCGCCGAAGCAGCCCGG + Exonic
1023923098 7:44645259-44645281 CTGTGGCCACAGATGCATCCTGG + Intronic
1035560622 8:601347-601369 CTGCCGCCTGCCATGCAGCCTGG + Intergenic
1035560644 8:601427-601449 CTGCGGCCAGCCATGCAGCCTGG + Intergenic
1035675469 8:1452710-1452732 CTGTCGCCTCCACAGCAGCCGGG + Intergenic
1035677884 8:1467815-1467837 CTGGCGCCACCCCTGCAGCAGGG - Intergenic
1035699455 8:1626951-1626973 CCATCGCCACCTATGCGGCCGGG - Intronic
1035731180 8:1854346-1854368 CTGTGGGCACCCATGCAGGCAGG + Intronic
1036641984 8:10590464-10590486 CTGACGCCCCCGGCGCAGCCTGG - Intergenic
1046163254 8:110394609-110394631 CTGGCGCTACCTATCCAGCCTGG + Intergenic
1049017941 8:139934658-139934680 CTGTGGCCACATGTGCAGCCTGG - Intronic
1056816114 9:89802436-89802458 CTGTCCCCAGAGCTGCAGCCGGG - Intergenic
1203467915 Un_GL000220v1:104645-104667 CTGGCGCCACCGGGCCAGCCGGG - Intergenic
1203475736 Un_GL000220v1:148617-148639 CTGGCGCCACCGGGCCAGCCGGG - Intergenic
1188834683 X:34942689-34942711 CTGACGCCACCTGCGCAGCCCGG - Intergenic