ID: 996443488

View in Genome Browser
Species Human (GRCh38)
Location 5:123517423-123517445
Sequence GCGTTTGTATGAGAACCAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 52
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 48}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996443488 Original CRISPR GCGTTTGTATGAGAACCAAT TGG Intronic
910143033 1:84047583-84047605 GGGTTTGAATGAGATCCAAAAGG - Intergenic
917190336 1:172410712-172410734 GAGTTTGTATTGGAACAAATAGG - Exonic
917265005 1:173211460-173211482 GAGTTTGGATTAGAAGCAATAGG - Intergenic
918163668 1:181924415-181924437 GCATTTGAATGAGAACACATGGG + Intergenic
918455094 1:184703135-184703157 ACGTTTCTATGAGAATTAATGGG - Intronic
918545468 1:185678823-185678845 GCATTTTTCTGAGATCCAATTGG + Intergenic
919329707 1:196155709-196155731 GCTTTAGTATTAGAAACAATAGG - Intergenic
1086981192 11:93199081-93199103 GTGTATGTATGTGAACAAATTGG - Intergenic
1096746946 12:53735205-53735227 GTGTTTGTATTAGTACCAAGAGG + Intergenic
1110961768 13:81635568-81635590 GCTTTTGTATGATATCCAAAAGG + Intergenic
1111655101 13:91141844-91141866 ACGTTTTTATGAGGACCCATGGG + Intergenic
1115030662 14:28789459-28789481 GAGTATGTAAGAGAACCAAAGGG + Intronic
1116205393 14:41858911-41858933 GGATTTGTATGGGAACCATTTGG - Intronic
1128263713 15:66251144-66251166 GCCTTTGTGTGAGAATCACTAGG - Intronic
1131000465 15:88935963-88935985 GAGTTTTTAGGAGAACAAATAGG - Intergenic
1137900770 16:52266353-52266375 GCGTTTGTACAAAAACCAACAGG + Intergenic
1148464920 17:47859192-47859214 GGGTTTGTATGAGGACCAGCGGG - Intergenic
927277618 2:21275003-21275025 GCGTCCTTATGAGAAACAATAGG + Intergenic
927461161 2:23299358-23299380 GCGTTTGTATGAATACCATCCGG - Intergenic
930864188 2:56106526-56106548 AGGTTAGTATTAGAACCAATGGG + Intergenic
936840358 2:116760814-116760836 GCTTTTGTTGGAAAACCAATAGG + Intergenic
937420878 2:121754367-121754389 AAGTTTGTATGAGAACAAATAGG + Intronic
938697069 2:133843982-133844004 GCCTTAGGAAGAGAACCAATTGG + Intergenic
940736280 2:157456352-157456374 GCATGTGTATGAGAACTGATAGG - Intronic
944902288 2:204227961-204227983 GGGTTTCTATTAGAACCAAATGG - Intergenic
1170025191 20:11881631-11881653 GGGTTTCTAGGAAAACCAATGGG - Intergenic
1172492323 20:35350029-35350051 GAGTTAGAATCAGAACCAATGGG + Intronic
1175150557 20:56930690-56930712 ACGTTTGTATTAGCAACAATGGG + Intergenic
1183323716 22:37180365-37180387 GAGTCTGCATGAGCACCAATGGG + Exonic
949385788 3:3501124-3501146 GCGTTGGTCTGAGAACCAGGTGG - Intergenic
958997735 3:100925180-100925202 ACGTCTGTATGAGAAACAAGAGG + Intronic
965986213 3:174756782-174756804 GAGCATGTATGAGAACAAATAGG - Intronic
966709534 3:182956572-182956594 GGGTTGTTATGAGAACCAAATGG + Intronic
982907736 4:161097575-161097597 GCGGCTGTATGTGAACCATTAGG - Intergenic
991505036 5:67315731-67315753 GAGTTTGTATGAGAAACAAGAGG - Intergenic
996443488 5:123517423-123517445 GCGTTTGTATGAGAACCAATTGG + Intronic
998807256 5:145930733-145930755 GCGTTAGAATGAGAACCATCTGG + Intergenic
1004292665 6:14382656-14382678 GAGTTTGTATGAGAAATCATTGG + Intergenic
1005220661 6:23584713-23584735 GTTTTTGTATGAAAACCATTTGG - Intergenic
1005355672 6:24981103-24981125 GAGTTTGGATGAAAACCAACAGG + Intronic
1014652108 6:124052656-124052678 GTGTTTGTATGAGGAACTATGGG + Intronic
1018183129 6:161242120-161242142 GGGTTTTTGTGAGAACTAATGGG - Intronic
1020580142 7:9987548-9987570 GAATTTGTATGAGACCCAAGAGG + Intergenic
1023309797 7:38873602-38873624 GCGTTTCTATGACAACCTAGTGG + Intronic
1030105889 7:105986971-105986993 ACGTTTGTATAAGAACCAGTGGG + Intronic
1038621492 8:29147504-29147526 GCTTATGTATGAGCACGAATTGG - Exonic
1041962161 8:63630731-63630753 GCATTTGTATGTGAACAAAGTGG - Intergenic
1047203336 8:122783664-122783686 GCGTTTGGATGACGACCAAGTGG + Intronic
1050260845 9:3839306-3839328 GCCTTTGTATTAAAACAAATGGG + Intronic
1054942755 9:70761354-70761376 GCGTTTGGATGAGCTCCAAAAGG + Intronic
1192102109 X:68275927-68275949 GCCTTTGTATGAGAACATCTTGG + Intronic
1202082266 Y:21095776-21095798 GAGTTTTTATGAGCACCACTGGG - Intergenic