ID: 996447436

View in Genome Browser
Species Human (GRCh38)
Location 5:123571970-123571992
Sequence TTTTAAAGGAAAAATGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1243
Summary {0: 3, 1: 11, 2: 27, 3: 144, 4: 1058}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996447436 Original CRISPR TTTTAAAGGAAAAATGAGGA GGG Intronic
900788096 1:4662305-4662327 ATTTACAGGAATAGTGAGGATGG - Intronic
901280723 1:8032581-8032603 TTTTAAAGGAAACATGTCTATGG - Intergenic
902755254 1:18545244-18545266 TTTTCCAGGAAAAATAAAGAAGG - Intergenic
902914482 1:19628369-19628391 TTTTAAAGCAAATAGGAGGCTGG - Exonic
903311116 1:22457133-22457155 TTTTAAAGGAAAGAAGAAGAGGG + Intronic
903614934 1:24644462-24644484 TTTCAAAGGAAAAATTGGAAGGG + Intronic
903790371 1:25888831-25888853 TGTTCCAGGAAAAAGGAGGATGG + Intronic
903912206 1:26736016-26736038 TTTTAAAGGTAAAATAACAATGG - Intronic
904229753 1:29058706-29058728 TTTTTAAGGAAAAGGGAGTAAGG - Intronic
904395455 1:30218270-30218292 TTTTAAAAGAAAAATGGGGAGGG - Intergenic
904678533 1:32213190-32213212 TTTAAAAGAAAAAAGGAGGCCGG - Intronic
905196699 1:36284903-36284925 TTTCAAATGAAAAGTGTGGAAGG + Intronic
905228956 1:36500037-36500059 TTTTAAAAAAAAAATCATGAAGG + Intergenic
905321698 1:37122099-37122121 AATTAAAGCAAAAATGAGGGAGG + Intergenic
905503441 1:38457192-38457214 TCTTAAAGGAAACATGAAGCTGG - Intergenic
905856792 1:41319834-41319856 CTGTAAATGAAAAATGAGGAGGG - Intergenic
906163081 1:43665362-43665384 TTTTAAAAGAAAAAAAAAGAAGG - Intronic
906215870 1:44038301-44038323 TTTTAAAGCAAAATTGAGGCTGG - Intergenic
906395405 1:45459293-45459315 TTTCAAAGAAAAAAAAAGGAAGG + Intronic
906485764 1:46233581-46233603 TTTTAAAAATAAAATGAGGCTGG - Intergenic
906992026 1:50749335-50749357 TCTTAAAGGAAAAACAAGAAGGG + Intronic
907025298 1:51111956-51111978 TCTAAAAGGTAAAATGAGGATGG - Intronic
907502606 1:54893252-54893274 TTTTAAAGGAAAAAATAAGGAGG + Intergenic
907728256 1:57040716-57040738 TTTAAAAGGAAAAAGGAGATAGG - Intronic
907784781 1:57600767-57600789 CTTTAATGGAAAAATGAGATGGG + Intronic
907957258 1:59241665-59241687 TTTTAACTGAAAGATTAGGAAGG + Intergenic
908119843 1:60975677-60975699 TTCTGTAGGAACAATGAGGAGGG - Intronic
908336705 1:63132970-63132992 TTTCAAAGATAAAATGATGATGG + Intergenic
908341760 1:63188108-63188130 TGTTAATGGAAAAGTGAGTAAGG + Intergenic
908917470 1:69146413-69146435 TTATAAAGGAAAAAAGAGATTGG + Intergenic
909515067 1:76497813-76497835 TTCTATTGGAAAGATGAGGAAGG - Intronic
909723650 1:78808313-78808335 ATTTAAATGAAAAAGAAGGAAGG + Intergenic
909725845 1:78833924-78833946 TTTTGATGGAAAGATGAGGTTGG - Intergenic
909844618 1:80376344-80376366 TTTTAATGCAATATTGAGGAAGG - Intergenic
909919306 1:81360703-81360725 TATTAAAGGAAAGAAGAGAAGGG + Intronic
910502292 1:87906548-87906570 TTTTAAGGGAAAAATGTGGTAGG - Intergenic
910524974 1:88167066-88167088 TTTGAATGAATAAATGAGGATGG + Intergenic
910574743 1:88748371-88748393 TTTCAAAGGCAATATGCGGAGGG - Intronic
910717001 1:90243272-90243294 TTTTAAAGGCGAAATAAGGAAGG + Intergenic
910882855 1:91938148-91938170 TTTATAAGGTAAAATAAGGATGG - Intergenic
910887087 1:91975290-91975312 TTTTAAAAAAAAAGTGAGGTTGG + Intronic
911203214 1:95067343-95067365 TTTTAAAGCTAAAATGGGGAGGG - Intronic
911207692 1:95108902-95108924 TTTTAAAAGATCAGTGAGGAAGG - Intergenic
911819273 1:102396130-102396152 TTTGGAAGGGAAAATGTGGAGGG - Intergenic
911826711 1:102495827-102495849 TTTTAAAGCAAAAATAAATAGGG + Intergenic
911835709 1:102616292-102616314 ATTTAAAGGAAAAATGTGCCGGG + Intergenic
911836911 1:102631039-102631061 TTTTAAATGAATAATGACTAGGG + Intergenic
912134475 1:106643596-106643618 TTTTAAAGACAGAATGAGGCTGG + Intergenic
912747890 1:112260594-112260616 TTCAAAAGAAACAATGAGGAGGG - Intergenic
912882858 1:113435393-113435415 TTTTAAGAGTAAAATGAAGAAGG - Intronic
912884560 1:113456259-113456281 TATTAAAGAAAAAATGGGGCCGG - Intronic
914200893 1:145484377-145484399 TTTAACAGCGAAAATGAGGAAGG + Intergenic
914414334 1:147465283-147465305 TCTTACAGAAAAATTGAGGACGG - Intergenic
914480006 1:148057505-148057527 TTTAACAGCGAAAATGAGGAAGG + Intergenic
914932639 1:151948775-151948797 TTTTAAAGGATAAAAGAGGGGGG - Intergenic
915069873 1:153257872-153257894 TTTTAAAGGAAGAGGTAGGAAGG + Intergenic
915778576 1:158519701-158519723 TTCTAAAGAAAAACTGAAGATGG + Intergenic
915790686 1:158667136-158667158 TTCTAAACCAAAAATAAGGATGG + Intronic
915813350 1:158939587-158939609 TCCTAAAGGAAAAAGGAGCATGG - Intronic
915878008 1:159633441-159633463 TTTTAAAGGAAGAATGAGAAGGG - Intergenic
915956959 1:160228858-160228880 TTTCAAAGGAAGAATAAGAAAGG + Intronic
916437632 1:164791674-164791696 TTTAAAAGGAGAAATAAAGAGGG + Intronic
916912544 1:169366737-169366759 TTAGAAAGGAGAAATGAAGAGGG + Intronic
916915025 1:169397182-169397204 TTTTAAAATGAACATGAGGAAGG + Intronic
917191090 1:172420013-172420035 TTGTTAAGGAAAACTGAGTAAGG - Intronic
917227090 1:172795819-172795841 TTTCGAAGGAAAAATGAGGAGGG + Intergenic
917307195 1:173638707-173638729 TTTTAAATCAAAAAGCAGGAAGG + Intronic
917689153 1:177449672-177449694 TTTTAAAGGGAAAAAAGGGAGGG - Intergenic
917939363 1:179902598-179902620 ATTCATAGGAAAAATGAGGAAGG - Intronic
918001311 1:180500169-180500191 TGTTAAAGGAAAAATAAGTTGGG - Intronic
918046088 1:180941845-180941867 TGTTAAAAGAAGAATGAGGAGGG - Intronic
918333211 1:183480241-183480263 TTTTAAAGGAAAATTGAGATTGG - Intronic
918551913 1:185752501-185752523 TTTTAAAGAAATAGTTAGGATGG - Intronic
918743289 1:188164612-188164634 AATAACAGGAAAAATGAGGAAGG + Intergenic
919026523 1:192178428-192178450 GTTTAAGGGAAAGATGAAGAAGG + Intronic
919199560 1:194337279-194337301 TTTTAAAGTAAAGATGACCAAGG + Intergenic
919348150 1:196413045-196413067 TTTTAAGGGATAAACTAGGATGG + Intronic
919439689 1:197616115-197616137 TTTTAATAGAAAAATTAAGATGG + Intronic
919512530 1:198483656-198483678 TTTTAAATGAAATAAGAGGTAGG - Intergenic
919558043 1:199085838-199085860 TTTGAAAGGAAAATTGAAGAAGG + Intergenic
919825847 1:201502567-201502589 TTCTGAAGGAAACATGAGGTGGG - Intronic
920108688 1:203572205-203572227 TTTTGAGGGAAAAAAGAGGGGGG + Intergenic
920524096 1:206653312-206653334 ATTGAAAGAAAAAATGAGGCTGG - Intronic
920643684 1:207779854-207779876 GTTCAAAGGAGAAAAGAGGATGG - Intronic
920647659 1:207815216-207815238 TTAAAAATGAAAAATGATGACGG - Intergenic
920701936 1:208224511-208224533 ATTTAAAGGGAAAAGGGGGAGGG + Intronic
920761173 1:208784940-208784962 CTTAAATGGAAGAATGAGGATGG - Intergenic
921353809 1:214265344-214265366 TTTTAAAATAAAAATGAAAACGG + Intergenic
921444851 1:215233612-215233634 TTTTAAAAGAAAAATCAAGAGGG + Intronic
921666679 1:217881089-217881111 TTTAGAAGGAGAAATGAGAAGGG + Intergenic
921770653 1:219035384-219035406 ATTTAAAGGAAGAATTGGGAGGG + Intergenic
921878275 1:220224652-220224674 TTTTAAAGGCAAAACCAGTAAGG + Intronic
921956294 1:220986901-220986923 GCTTAAAGGAGAAATCAGGATGG + Intergenic
921965636 1:221085688-221085710 CTTTACATGAAAAATGAGGATGG + Intergenic
922321095 1:224487899-224487921 TTTTAAAGAAACAATAAAGAAGG - Intronic
922710081 1:227822016-227822038 TTAGAAAGGAAAAAAGAGGAAGG - Intronic
923089760 1:230731097-230731119 TTTTAAAGGAACAAAAAGGGAGG - Intergenic
923229180 1:231968468-231968490 TTTTAAAGCAAAAACAAGGGAGG + Intronic
923582154 1:235228134-235228156 ATTTAAAAGAAAAATCAGGCCGG - Intronic
923587170 1:235284031-235284053 TTTTAAATGTAGAATGAGGCTGG - Intronic
923729768 1:236538986-236539008 TGATAAATGAAAAATGGGGACGG + Exonic
923767482 1:236905851-236905873 TTTTACTTGAAAAGTGAGGAGGG + Intergenic
923903479 1:238355766-238355788 TTTTAAAAGAATAATTAGGCCGG + Intergenic
924044890 1:240018622-240018644 TTTTAAAGGCTAAATCATGAAGG - Intronic
924247779 1:242101649-242101671 ATTTAAAGGAAAGAAGAGGCAGG + Intronic
924513580 1:244748365-244748387 TTTTAAAGGCAAAAGGAACAAGG + Intergenic
924533983 1:244918642-244918664 GTTTAAAGAAATAATGAGGCCGG + Intergenic
1063045571 10:2388646-2388668 TTTTACAAGAAAAATAAGAAGGG - Intergenic
1063164814 10:3451679-3451701 ATTTAGAGGAAAGAGGAGGAGGG - Intergenic
1063276739 10:4577301-4577323 TTTTAAAGGAAAAATGAAGTGGG + Intergenic
1063303191 10:4872308-4872330 TTTTAAGGTGATAATGAGGAAGG + Intergenic
1063666635 10:8064856-8064878 TTTTAAAAGAATAATGAGAGAGG - Intronic
1063771533 10:9208535-9208557 TTTTTAAGGTAAAATAAAGAGGG - Intergenic
1063796061 10:9515565-9515587 TTTTAAAGAAGAAAGAAGGAAGG + Intergenic
1063878855 10:10510070-10510092 TTTCCAAGGAAAAAGGAGCAGGG - Intergenic
1063898814 10:10710804-10710826 TTTAAAAAAGAAAATGAGGAGGG - Intergenic
1063914486 10:10867688-10867710 GTTTAAAGAATAGATGAGGAAGG - Intergenic
1064000367 10:11658730-11658752 TTTTAAAGGAAGAAAGACGCAGG + Intergenic
1064813701 10:19232009-19232031 TTTTATAGAGAAAATAAGGATGG + Intronic
1064820347 10:19323063-19323085 TTAAAAAGGAAAAATAATGATGG - Intronic
1065828800 10:29596155-29596177 TTTTAAAGGACAAATTATGGTGG - Intronic
1066189574 10:33043580-33043602 TTTTAAAGAAAACATTAGGAAGG + Intergenic
1066516969 10:36173361-36173383 GTCTAAATGAAAAAAGAGGAAGG + Intergenic
1067410987 10:46064390-46064412 TCTTAAAGTCAAAAGGAGGAGGG + Intergenic
1067508878 10:46878495-46878517 TGTTTTAGGAAGAATGAGGAGGG + Intergenic
1068050138 10:51940200-51940222 TTTAAAAGGAAAAAAGACAAGGG - Intronic
1068353156 10:55876568-55876590 TTCTAAAGAAGAAATGAGAAGGG - Intergenic
1068392714 10:56419334-56419356 CTTTAAAGGAGAAAAGAGGAGGG - Intergenic
1069256773 10:66342463-66342485 AATTAATGTAAAAATGAGGAAGG + Intronic
1069291227 10:66782478-66782500 TTTTATAGCAAAATTGAGGAGGG - Intronic
1069931371 10:71884102-71884124 TTTTAAAGAAAAAAGCAGGCCGG - Intergenic
1070045801 10:72834946-72834968 TTTTAACAGATAAATGAGGCTGG - Intronic
1070410261 10:76133231-76133253 TCATAAAGGAAATATGAGGCTGG + Intronic
1070508584 10:77139141-77139163 TTTCAAAGGAAAAGTAAGAAGGG + Intronic
1070607537 10:77909500-77909522 TATTAAAAAAAAAATGAGGGTGG + Intronic
1070622755 10:78026369-78026391 TTGTGAAGGAAAAATGAGAGAGG - Intronic
1070858481 10:79629055-79629077 TTCTAAATGAGAAAAGAGGAAGG + Intergenic
1071110027 10:82144974-82144996 TTTTAAAAGAAAAAGTGGGATGG - Intronic
1071172755 10:82886288-82886310 TTGTAAAAGATAAATGAGTAAGG - Intronic
1071303785 10:84279351-84279373 TTGGAAAGGAAAAATAAAGAAGG + Intergenic
1071409751 10:85377496-85377518 TGTCAAATGAAAAATGAGGGCGG + Intergenic
1071686887 10:87767594-87767616 ATTTTAGAGAAAAATGAGGAAGG - Intronic
1071943814 10:90617820-90617842 TTTTAAAGGAAAAATGCAGGAGG + Intergenic
1072075782 10:91971846-91971868 TTTTAATGGAGAAAAGAGCAGGG + Intronic
1072173031 10:92885792-92885814 TTTAAAAGTAAAAAAGAGGGGGG - Intronic
1072508253 10:96091758-96091780 ATAGAAAGGAAAAATGAGAAGGG + Intergenic
1073370193 10:102981376-102981398 TAATATAGGAAAAAAGAGGAAGG - Intronic
1074730506 10:116368425-116368447 TTTTAAAGGAGAAATAAAAAGGG - Intronic
1074744150 10:116514889-116514911 TTTTAAATGAAGAATGAAGAAGG + Intergenic
1074762653 10:116678483-116678505 TTGTGAAGGAAAAACCAGGAGGG + Intronic
1075151307 10:119935162-119935184 TTTTAAAAGACAAAAGAGGCTGG + Intronic
1075394221 10:122114860-122114882 TTTTAAGAGAGAAAAGAGGACGG - Intronic
1075432494 10:122399923-122399945 TTTTTAAGCAAAAATGGGGCTGG - Intronic
1075496681 10:122926804-122926826 TTTCAAAAGATAAAGGAGGAAGG + Intergenic
1075515361 10:123104087-123104109 TTTAAAGGGAAAGATGGGGAGGG + Intergenic
1075526006 10:123187240-123187262 TTTTAAAGAAGAAATGAGTCAGG - Intergenic
1075896494 10:126000301-126000323 TTGTCAAGGAAGAATGTGGAAGG + Intronic
1076127619 10:127987818-127987840 CTTCAAATGAAAAATGAAGAGGG - Intronic
1076418370 10:130308974-130308996 TTTTAAAATAAAAATGATAAAGG + Intergenic
1077201785 11:1311209-1311231 TTTTAGCGTGAAAATGAGGAAGG - Intergenic
1077765486 11:5155431-5155453 TTTTGAAAGAAAAAGAAGGAAGG - Intronic
1078210129 11:9264219-9264241 TTTGAAAGGGAAAGTGATGAGGG - Intronic
1078265310 11:9751334-9751356 TTTGAAAGGAGTATTGAGGAAGG + Exonic
1078313486 11:10270695-10270717 TTTAAGAAGTAAAATGAGGACGG + Intronic
1078703333 11:13712428-13712450 TTTTAAAGGAAAGATGTTCATGG - Intronic
1079051522 11:17164860-17164882 TCTTGGAGGAATAATGAGGATGG - Intronic
1079557631 11:21780114-21780136 TTTGGAAGCAAAAATTAGGATGG - Intergenic
1080013675 11:27483033-27483055 TTGTGAAGGGAAAATGGGGAGGG + Intergenic
1080422382 11:32122014-32122036 TTTTAAAGGACAAATGCTGTAGG + Intergenic
1080521063 11:33068217-33068239 TTTTAAAAGAATAAAGAGGCCGG - Intronic
1080927981 11:36777867-36777889 TATTTAAGGAAAAATGTGGGTGG - Intergenic
1080971047 11:37277363-37277385 TTTAAAGGGAAAAAGAAGGAAGG - Intergenic
1081088904 11:38837069-38837091 TTTTAAACAAAAAATGAAAAAGG + Intergenic
1081101964 11:39013223-39013245 TTTTCAAAGAAAACTGAGGTTGG - Intergenic
1081496807 11:43619686-43619708 TTTGAAAGGAAAAGTGTGGCTGG - Intronic
1081722199 11:45298549-45298571 TTTTAATAAATAAATGAGGAGGG + Intergenic
1081837557 11:46168905-46168927 TTTTAAAAGTTTAATGAGGAGGG + Intergenic
1082195708 11:49302308-49302330 TTTTAAAGCAAAAAACAAGAAGG - Intergenic
1082251511 11:49986553-49986575 TTTTAAAGGCAGAATAAGAAAGG - Intergenic
1082621238 11:55424688-55424710 TTTGAAAGGAGAAATGCGGCTGG - Intergenic
1083375766 11:62219263-62219285 TTTTAAATCAAAAAGCAGGAAGG + Intergenic
1083904738 11:65662452-65662474 TTCTTAAGGAAAATTGAGGGAGG + Intronic
1084222328 11:67690628-67690650 TTTTAAAAGAAAAGTTAGGTTGG + Intergenic
1084906023 11:72348269-72348291 TTTTAAAGTAAAAATCACAATGG + Intronic
1084932659 11:72569531-72569553 TTTTAAAACAAAAATGAGGCTGG + Intergenic
1086084197 11:82938232-82938254 TTTAGAAGGAAACTTGAGGAAGG + Intronic
1086648119 11:89250260-89250282 TTTTTAAGGATTAAAGAGGATGG - Intronic
1086660228 11:89407267-89407289 TTTTAAAGCAAAAAACAAGAAGG + Intronic
1086842319 11:91702247-91702269 CTTCAAAGGAAAAATAGGGATGG + Intergenic
1086862842 11:91945456-91945478 TTTTAAAGTAAAAATTAGCGAGG + Intergenic
1087259764 11:95997959-95997981 TCTTAAATGACAGATGAGGATGG - Intronic
1087512266 11:99112293-99112315 TTTTAATGGAAAAATAAATAAGG + Intronic
1087575405 11:99983804-99983826 GTTCAAAGGATAAATTAGGAAGG + Intronic
1088185033 11:107157700-107157722 TTTTAAGGAAAAAATGAGGAGGG - Intergenic
1088565999 11:111173661-111173683 TTAAAAAGGAAGAAAGAGGAAGG + Intergenic
1088663391 11:112071038-112071060 TTTAAGAGAAAAAATGAGAAGGG - Exonic
1089023632 11:115244439-115244461 TCTTAAATGAGACATGAGGAAGG + Intronic
1089036536 11:115399680-115399702 TGTTAAAAAAAGAATGAGGATGG - Intronic
1089184798 11:116607474-116607496 TTTGAAAGGACAAATGTGCAGGG + Intergenic
1089372593 11:117971954-117971976 TTTAAAAGGAAAAAAGAAAAGGG + Intergenic
1090182230 11:124710289-124710311 TTTTAAAGTAAAAATCAGCCAGG + Intergenic
1090520610 11:127475121-127475143 CATTAAAGGGAAAATGATGAGGG - Intergenic
1090720255 11:129466336-129466358 TTTTAAAGGCAAAGTGAGGAGGG - Intergenic
1090950248 11:131466552-131466574 TTTCAAAGAGAAACTGAGGAAGG - Intronic
1091202046 11:133788494-133788516 TTATGAAGGAAAGATGAGGATGG - Intergenic
1091507227 12:1084360-1084382 TTTTAAATAAAATGTGAGGAAGG + Intronic
1091555257 12:1568303-1568325 TTTTAAAGGATAATTGTGCAGGG - Intronic
1092073177 12:5649986-5650008 TTGACAAGGAAAACTGAGGATGG + Intronic
1092499265 12:9029615-9029637 TATTAAACTTAAAATGAGGAGGG - Intergenic
1092518802 12:9244648-9244670 TTTTTAATAAAAAATGAGGATGG - Intergenic
1093184136 12:16000328-16000350 TTTTTAAGGAAATCTGATGAAGG + Intronic
1093349357 12:18079021-18079043 TTGAAAAGGGTAAATGAGGAAGG - Intergenic
1093349711 12:18083136-18083158 TTGAAAAGGGTAAATGAGGAAGG + Intronic
1093883113 12:24428458-24428480 TTTTAAAAGAAAAATGTAAATGG - Intergenic
1093886865 12:24471591-24471613 TTCTAAATGTTAAATGAGGATGG + Intergenic
1094083379 12:26562552-26562574 TTTGCAAGGCAAAATGAAGATGG + Intronic
1094231910 12:28115308-28115330 ATTTAAAAGACAAATCAGGAAGG - Intergenic
1094373038 12:29758969-29758991 TATGTAAGGAAAAAAGAGGATGG + Intronic
1094747445 12:33362019-33362041 TTTAAAAGGAAATATGAATATGG + Intergenic
1094799740 12:34019269-34019291 TTTTAAAAGAAAAATGAAGAGGG - Intergenic
1095112529 12:38313588-38313610 TTTTAAAAGAAAAATGAAGAGGG - Intergenic
1095232580 12:39759003-39759025 TTTTGAAACAAAAAAGAGGAAGG - Exonic
1095613274 12:44157574-44157596 TTTTAAAAAAATAATGAGGTCGG + Intronic
1095675344 12:44910827-44910849 TTTTAAAGAAAAAAGGATTATGG - Intronic
1096119855 12:49081327-49081349 TTTAAAAGGGAAACTGAGGCCGG - Intergenic
1096298797 12:50407495-50407517 TTTTAAAAGAGGAATGAAGATGG + Intronic
1096991525 12:55808184-55808206 TTTAAAAGGAAAATAGAGGCTGG + Intronic
1097647076 12:62249256-62249278 TTTTTTAGGAAAAAAAAGGAGGG - Intronic
1097778097 12:63670702-63670724 TGTTAAAGGAAAAAAGAAGCAGG + Intergenic
1097879886 12:64677120-64677142 GTGTAAATGAAGAATGAGGAAGG - Intronic
1097995815 12:65886923-65886945 TTATTAAGGGAAACTGAGGAAGG - Intronic
1099003060 12:77203783-77203805 TTTTAAAGAAAAAGTTAGGAAGG + Intergenic
1099310366 12:81012940-81012962 TTTTAAAGGAAAAAAGAAGAGGG - Intronic
1099356289 12:81639263-81639285 TTTTAAAAGAAAAAAAAGCAGGG - Intronic
1099726575 12:86437447-86437469 TATTAAAAAGAAAATGAGGAAGG + Intronic
1099984673 12:89649023-89649045 TTTCAAAGGAAATATCAGAAAGG + Intronic
1100276716 12:93078092-93078114 TTTTAGTGGAACAATAAGGAAGG + Intergenic
1100491116 12:95079012-95079034 TTTTAGAGGAAAAATGATATTGG - Exonic
1100494954 12:95116039-95116061 ATATAAAGGAAAAATGAAGTGGG + Intronic
1100519229 12:95357412-95357434 TAATAAATGAAAAATAAGGAAGG - Intergenic
1100811320 12:98341303-98341325 ATTTAAAGGGATAAGGAGGAAGG + Intergenic
1101145433 12:101836390-101836412 TTTTAAAAAGAAAGTGAGGATGG + Intergenic
1101322432 12:103684397-103684419 TGATAGAAGAAAAATGAGGAGGG + Intronic
1101390794 12:104298409-104298431 TTTTAAAGGTTAAATCAGTAAGG - Intronic
1101452128 12:104789375-104789397 TTTTAAAAAAGAAAAGAGGAAGG - Intergenic
1101546433 12:105717778-105717800 TTTTAAAGTAAAAATTAGGTTGG - Intergenic
1102115555 12:110400431-110400453 TTTTAAAGTATAAATCATGAAGG + Intronic
1102369088 12:112366357-112366379 TTTTAAATAAAAAATTAGTAAGG + Intronic
1102461433 12:113102086-113102108 TTTTACAGGAAGAAGGAGCACGG - Intronic
1102556381 12:113729459-113729481 TTTTAAAGGGAAGATGGTGAAGG + Intergenic
1102617194 12:114164971-114164993 TTATGAAGGAAAAATGAAGTGGG - Intergenic
1102866591 12:116379754-116379776 TGTTGGAGGGAAAATGAGGAAGG - Intergenic
1102946503 12:116993988-116994010 TTTTAAAGATACACTGAGGACGG - Intronic
1103141018 12:118548452-118548474 TTCTTATGGAAAAAGGAGGATGG + Intergenic
1103399590 12:120634224-120634246 TTTTAAAATAAAAATGAAAAGGG - Intergenic
1103795783 12:123502193-123502215 TTTTAAAGGAAAAAATAAGGAGG + Intronic
1103795784 12:123502194-123502216 TTTAAAGGAAAAAATAAGGAGGG + Intronic
1104011908 12:124937162-124937184 TTTTAAAAGAAAAATTAGGTTGG - Intergenic
1104496072 12:129240536-129240558 ATATAAAGGAAGAATGAAGAAGG + Intronic
1104558182 12:129821026-129821048 TTATATAGGAGAAAGGAGGAGGG - Intronic
1104832559 12:131763828-131763850 TTTTTAAAGAAAAATGAGGCCGG + Intronic
1105354189 13:19643544-19643566 CTTTAAAAGAAAAATCAGGTCGG - Intronic
1105374846 13:19834272-19834294 TTTTAAAAGAAAAAATAGGCTGG - Intronic
1105589851 13:21782100-21782122 TTTTAATGGAAAAATGAACTCGG + Intergenic
1106479050 13:30123305-30123327 TCTGAAAGGACACATGAGGATGG + Intergenic
1106498940 13:30308584-30308606 TTTAATAGAAAAAAAGAGGAAGG + Intergenic
1106645283 13:31627830-31627852 TTTAAAAGAAAAAATTAAGAAGG + Intergenic
1106787868 13:33124979-33125001 CTCTAAATTAAAAATGAGGAGGG + Intronic
1107327509 13:39260776-39260798 TTTCAAAGGGTAAATGTGGATGG - Intergenic
1107389252 13:39945915-39945937 GTTTAAAGGAAAAAAGAGACTGG - Intergenic
1107762487 13:43695412-43695434 TTTTAAAAGTAAAAGGAGAATGG - Intronic
1107975765 13:45687480-45687502 TTTGCAAGAAAAAATGAGGTGGG + Intergenic
1108136640 13:47370258-47370280 ACTGAAAGGAAAAATGGGGAGGG + Intergenic
1108317907 13:49255830-49255852 TTTTATTAGAAAAATGAAGAGGG + Exonic
1108812036 13:54239463-54239485 TTTTGAAGGTAGAATCAGGAGGG - Intergenic
1109036846 13:57273953-57273975 TTTTAAAGAATAAATGAGAAAGG + Intergenic
1109093196 13:58074188-58074210 TTTTTTAAGAAAAATTAGGAAGG - Intergenic
1109157445 13:58928287-58928309 TTTTAAAGGAACTAGGAGAATGG + Intergenic
1109269125 13:60234780-60234802 TTTTAAAGGTAAAATGAGGAGGG - Intergenic
1109864835 13:68249389-68249411 TTTTAAAATAAAAATGAAAAGGG + Intergenic
1109935984 13:69284946-69284968 TTTTCAAGGGAAGAAGAGGAAGG + Intergenic
1110018399 13:70438086-70438108 TTTAAAAAGAAAATAGAGGATGG + Intergenic
1110051395 13:70905099-70905121 TTTTAAAGGAAAACTGGTAAGGG + Intergenic
1110111782 13:71756430-71756452 TTTAAAAGGATAAATGAGGGTGG - Intronic
1110333053 13:74294807-74294829 TTGCAGGGGAAAAATGAGGAAGG - Intergenic
1110362917 13:74648078-74648100 TCTTAAAGGAAAAAAAAAGATGG - Intergenic
1110578531 13:77090495-77090517 TTTTAAATGAAAAAGAAGAAAGG + Intronic
1110580062 13:77111302-77111324 CTTTTAAGGAAAAATGAGTTCGG - Intronic
1110709236 13:78631799-78631821 TTTTAAGTTAAAATTGAGGAAGG + Intronic
1110782190 13:79479731-79479753 TTTAAAAAGAACTATGAGGAAGG + Intergenic
1110948661 13:81456931-81456953 TTTTAAGGGAAAAATGAACATGG - Intergenic
1111096223 13:83518544-83518566 ATGGAAAAGAAAAATGAGGAGGG + Intergenic
1111118543 13:83815081-83815103 TTTTAAAGGTAAAATGAAGAGGG - Intergenic
1111238133 13:85435937-85435959 TTTTAAAGCAGAAAAGATGATGG + Intergenic
1111501067 13:89120416-89120438 TTTTAAAGGAAAATTTATGAGGG + Intergenic
1111684921 13:91489952-91489974 TATTAAAAGAAAAAGGCGGAGGG + Intronic
1111946916 13:94675648-94675670 TTTTAAACCAAAATAGAGGAAGG + Intergenic
1111955086 13:94747817-94747839 TTAGAAAGAAAAAAAGAGGAGGG + Intergenic
1112187903 13:97145640-97145662 TTTCAACGGAAAAATAATGATGG - Intergenic
1112284009 13:98087950-98087972 TTTTACAGGTAAAAAGAGCAAGG - Intergenic
1112291553 13:98147815-98147837 TTTTAAAGAAAAAATTAGCTGGG - Intronic
1112311742 13:98323611-98323633 TTTTAAAGGAAAATTCTTGAAGG + Intronic
1112673834 13:101674307-101674329 TTTTAAAGGTAAAGTGAGGAGGG - Intronic
1112712242 13:102142878-102142900 TTTTAAAGGAAACATTGGAAGGG - Intronic
1112812204 13:103231888-103231910 TTTTAAAGACAAAATGTGGAGGG - Intergenic
1112922549 13:104633191-104633213 TTTAAAAGTAAAAATGTGTAAGG + Intergenic
1113196070 13:107808033-107808055 CTTTAAGAGAAAAATGAGGAGGG + Intronic
1113818241 13:113190722-113190744 TTTTAAAGCAAAAATAACAATGG + Intronic
1114890538 14:26916679-26916701 TTGGAAAGGAAAAATGAAGTGGG - Intergenic
1115129726 14:30040756-30040778 TAATAAAGGAAAAAGGTGGAAGG - Intronic
1115525449 14:34275605-34275627 CTTTAAAGAAAAAAAGGGGAGGG + Intronic
1115619516 14:35127545-35127567 TCTTAAGGGAAAAATCATGAGGG + Exonic
1115999512 14:39227955-39227977 ATTTAAAGAAAAAATAAAGAAGG - Intergenic
1116501328 14:45626465-45626487 TATAAAAGAAAAAATGAGAACGG + Intergenic
1116551180 14:46240796-46240818 TTTCAATGGACAAATGAAGAGGG - Intergenic
1116568564 14:46485171-46485193 TTTTCTAGGAAAATTTAGGATGG - Intergenic
1116596564 14:46855882-46855904 TTTTAGAAGAAAAATGAGACAGG - Intronic
1116662569 14:47730144-47730166 TTATAAAGGAAAAAGAAGGAAGG - Intergenic
1117290828 14:54330921-54330943 TTTCAGAGGTAAAGTGAGGAGGG - Intergenic
1117346793 14:54840638-54840660 ATTTTAAGGAAAACAGAGGAGGG + Intergenic
1117376049 14:55119345-55119367 TCTTAAAGGCAAAGTAAGGAAGG - Intergenic
1117386767 14:55222452-55222474 TTTTAAAAGAAGAATAAAGAAGG + Intergenic
1117489892 14:56236032-56236054 TTTTAAAGTAATAGTGGGGAGGG - Intronic
1117685183 14:58245502-58245524 TTGTATAGGAAAAACGAGAAAGG - Intronic
1118189757 14:63569872-63569894 TTTTATATAAAAAATGAAGATGG + Intergenic
1118292267 14:64538023-64538045 TTTTAAAGAAAATATTAGAAAGG - Intronic
1118351140 14:64972843-64972865 ATTTAAAGAAAAAATGGGGACGG - Intronic
1118577851 14:67261933-67261955 TTTTAAAGGCAAAAAAAGGATGG + Intronic
1118723602 14:68610783-68610805 ATTTTAAGGGAAAATGAGGCAGG - Intronic
1118960109 14:70521999-70522021 TTTCTAAGGAAAAATGAGGGTGG + Intergenic
1119104495 14:71911422-71911444 TTTCATAGGGAAAATGAGCAGGG + Intergenic
1119492071 14:75043718-75043740 TTTTAAAGAAAAAATTACCAAGG + Intronic
1119609562 14:76050219-76050241 TTTGACAGGACAAGTGAGGAAGG - Intronic
1119870457 14:78012398-78012420 TCTTGAAGATAAAATGAGGACGG - Intergenic
1120195242 14:81474966-81474988 TGCTAAAGGAAAAATGAGGGTGG + Exonic
1120286821 14:82513431-82513453 TTTCCTAGGAAAAGTGAGGAGGG + Intergenic
1120681228 14:87483197-87483219 TTTTAAAGAAAAAATTCTGATGG - Intergenic
1120778544 14:88464138-88464160 TATTTATAGAAAAATGAGGAAGG - Intronic
1120892248 14:89501556-89501578 TTTTAAAGGAAAAATCCAGAGGG + Intronic
1120974021 14:90233255-90233277 TGATAAAGGAAAAAGGAGGTAGG - Intergenic
1121647792 14:95532666-95532688 CTTTAAAGGAAAAATGAGGAGGG - Intergenic
1121767377 14:96499652-96499674 TTTTAAAAATAAAATGAGGCCGG - Intergenic
1121884622 14:97532184-97532206 TTCTAAAGATAAAATAAGGAAGG - Intergenic
1123159789 14:106267381-106267403 GAATAAAGGAAAAATGAGGAGGG + Intergenic
1123173355 14:106395429-106395451 GGTTTAAAGAAAAATGAGGAGGG + Intergenic
1123175079 14:106409292-106409314 GAATTAAGGAAAAATGAGGAGGG + Intergenic
1123201864 14:106673819-106673841 GAATTAAGGAAAAATGAGGAGGG + Intergenic
1123217592 14:106826261-106826283 TTTTAAAGAAAAAATGAGGAGGG + Intergenic
1123223487 14:106878310-106878332 TTTTAAAGTAAAAGGGAAGATGG + Intergenic
1202943606 14_KI270726v1_random:6485-6507 GAATTAAGGAAAAATGAGGAGGG - Intergenic
1123774362 15:23564273-23564295 TTATCAAGGAAAAATGAAGAAGG - Intergenic
1123907000 15:24931429-24931451 TTTTAAAGGAAGAATGAAGCTGG + Intronic
1124514985 15:30360234-30360256 TTTTAAAGCAAAAATGTGGGAGG + Intergenic
1124640670 15:31394116-31394138 AGTTAAAGGAAAAAAAAGGAAGG + Intronic
1124727937 15:32170528-32170550 TTTTAAAGCAAAAATGTGGGAGG - Intronic
1124990464 15:34668510-34668532 TTTTAAAGTACAAATGACCAAGG - Intergenic
1125202754 15:37114822-37114844 TTTTAGAGGAAAACAGAGGCAGG + Intergenic
1125263882 15:37856985-37857007 AAATAAAGGAAAAATGGGGAAGG + Intergenic
1125281205 15:38044292-38044314 TTTTTAAAGAAAAAGAAGGAAGG + Intergenic
1125291497 15:38153184-38153206 CTTTAAAAGAAAAATAAGGAGGG + Intergenic
1126194825 15:45920361-45920383 TTTTAAAGAGAAAGTGAGTAGGG + Intergenic
1126226560 15:46277428-46277450 TATCAAAGGAAAGATGAGCATGG - Intergenic
1126322556 15:47440992-47441014 TTTCAAAGGCAAAAGGAAGAAGG - Intronic
1126557151 15:50001835-50001857 TTTTATAGGGAAAATGAGAGGGG - Intronic
1126748819 15:51854663-51854685 TTTTAAAGGAAAAAAGCTGTCGG + Intronic
1127038155 15:54942705-54942727 TTTAAAAGGAAAAAGCAGGCTGG - Intergenic
1127099424 15:55550189-55550211 TTTGCAAGGAAAAAACAGGATGG - Intronic
1127789474 15:62386663-62386685 TTTTTAAGAAAAAAAGAGGCTGG - Intergenic
1128099976 15:64990360-64990382 TTTTAAGGGAAAAGTGATGAAGG - Intergenic
1128287160 15:66446772-66446794 TCTAAAAGGAAATATGTGGAAGG - Intronic
1128483814 15:68065289-68065311 CTTAAAAGGAAAAATAAGGCTGG + Intronic
1128491707 15:68153117-68153139 TTTTAAATGACAAATGAGATGGG - Intronic
1129091725 15:73157897-73157919 TTTTAAAAGAACAATGAGAAGGG - Intronic
1129132692 15:73514809-73514831 TTTAAAAGGAGAAAACAGGAAGG + Intronic
1129262249 15:74374881-74374903 CTTTAAGGGAAAGATGAGGATGG - Intergenic
1129437183 15:75550959-75550981 TTTTAAAGGAAAAGCCTGGAAGG + Intronic
1129713734 15:77834956-77834978 TTTTAAAGGCCTACTGAGGATGG - Intergenic
1130003116 15:80065227-80065249 TTTTTAAGGAAAAATAAGGGAGG - Intronic
1130170492 15:81507228-81507250 AGTGAAAGAAAAAATGAGGATGG - Intergenic
1130433447 15:83873006-83873028 TTTAAAAGGAAGAATGTGGCTGG + Intronic
1130573894 15:85073569-85073591 TTTTAGAAGAAAAATCAAGATGG - Intronic
1130942066 15:88519095-88519117 TTTCAAAGGTAAAATGATGGGGG + Intronic
1131029021 15:89170819-89170841 TTTTAAAAGACAAAAGAGGCCGG + Intronic
1131238932 15:90721617-90721639 TTTTAAAAGAAAAATTAGGCTGG - Intronic
1131920151 15:97317889-97317911 TTTTAAAGGAAGAATTAGATGGG + Intergenic
1133140668 16:3741506-3741528 TTTAAAAAGAAAAATGTGGCCGG + Intronic
1133346440 16:5074039-5074061 TTTTAAAGAAAAAGTGATCAAGG - Intronic
1133957877 16:10462061-10462083 TTCTAAAGGAATAATGAAAACGG - Intronic
1135229961 16:20697456-20697478 TTTTAGAGGCAAAATGACAATGG - Intronic
1135469228 16:22714269-22714291 TTTTGCAGGAGAAATGAGGGAGG + Intergenic
1135855012 16:26001699-26001721 TTTTAAAGGAAAGTTGAGAAAGG + Intronic
1136771488 16:32845555-32845577 TATTAAAGGAGAAATGAGTTGGG - Intergenic
1137333535 16:47525862-47525884 TTATAAAAGCATAATGAGGAAGG + Intronic
1137333649 16:47526661-47526683 TTTTCAAGAAAAAATGAAAATGG + Intronic
1137422389 16:48346607-48346629 TTTGAAAAGAAAAGTGAGAAGGG - Intronic
1137831300 16:51545846-51545868 TTTTAACAGAAAAATGAGCCAGG - Intergenic
1138501664 16:57449076-57449098 TTTCAAAGAAAAAATGAGGGAGG + Intronic
1138669230 16:58599552-58599574 ATTAAAAGGAAAAAGGAGGCTGG + Intronic
1138850711 16:60626618-60626640 TTTTAAAGGAAAACTTAGTATGG + Intergenic
1138962705 16:62046306-62046328 TCTCAAAGGAAAAATCTGGATGG + Intergenic
1139275699 16:65725571-65725593 TTTCAAAGGAAATATTTGGAAGG + Intergenic
1140021375 16:71242226-71242248 TTTTTCTGGAAAACTGAGGAAGG + Intergenic
1140119209 16:72068809-72068831 TTTTAAATAAAAAAGCAGGAAGG + Intronic
1140447552 16:75043356-75043378 CCTTAAAGTAAAACTGAGGAAGG - Intronic
1140528481 16:75644122-75644144 TATTAAAGAGAAAATGAGAAAGG + Intronic
1140758614 16:78091245-78091267 TTTGAAAGGAAAAAAGAAGATGG + Intergenic
1141258425 16:82426684-82426706 TTTTCTATGAAAAATGAGAAAGG + Intergenic
1141278951 16:82613379-82613401 TTGTAAAAGAAAAATGAGACCGG + Intergenic
1141493666 16:84391908-84391930 TTTTAAAAAAAAAAAGAGGAAGG - Intronic
1141739581 16:85882028-85882050 TTTGATAGGAAAGATCAGGAAGG - Intergenic
1141787019 16:86207855-86207877 TTATAAAGGAAAATGCAGGAAGG - Intergenic
1141948260 16:87324751-87324773 TTTTCAAGTCAAAATGGGGAGGG + Intronic
1203073912 16_KI270728v1_random:1107666-1107688 TATTAAAGGAGAAATGAGTTGGG - Intergenic
1142660871 17:1428428-1428450 TTCTAAGGGATAAATGAGTAGGG + Intronic
1142981175 17:3672862-3672884 TTTTAAAGGAAAATGTAAGAAGG - Intronic
1143241988 17:5451399-5451421 TTTAAAAAGAAAATTGAGGCTGG - Intronic
1143384387 17:6518993-6519015 TTTAAAAGGAAAAATAAGAAAGG + Intronic
1144513364 17:15896813-15896835 TTTAAAGGGAAAAAATAGGAGGG - Intergenic
1144543998 17:16175356-16175378 TTTTAAAAGACAAATGAGTCTGG - Intronic
1144789667 17:17850399-17850421 TTTTACATCAAAAATCAGGAAGG + Intronic
1145030047 17:19497920-19497942 TTTGAGAGGAGAAATGAGAAAGG + Intronic
1146091045 17:29878129-29878151 TTTTAAAAGAACAAAGAGGCCGG + Intronic
1146172397 17:30644109-30644131 AAATAAAGGAAAAATGGGGAAGG + Intergenic
1146206570 17:30910043-30910065 TTTAAAAGGAAACAGGAGGCTGG + Intronic
1146345851 17:32060120-32060142 AAATAAAGGAAAAATGGGGAAGG + Intergenic
1146640646 17:34538451-34538473 TTTTAAATAAAAAATAAGGCCGG + Intergenic
1146713735 17:35065781-35065803 TTTAAAAGGAAGAACTAGGATGG - Intronic
1147291055 17:39443321-39443343 ATTTAAAAGATAAATGATGAAGG - Intronic
1147291587 17:39447951-39447973 TTTGCAAGGAAAACTGTGGATGG - Intronic
1147592117 17:41690335-41690357 TTTTATAGGAAAAAGCAGAAGGG + Intronic
1147957754 17:44146344-44146366 TGTAAAAGCAAAAATCAGGACGG - Intronic
1148540314 17:48475079-48475101 TTTTTAAAGAAAAAGGTGGAGGG - Intergenic
1149106145 17:52968457-52968479 ATTTAAAGAAAAAATGATAAAGG - Intergenic
1149315050 17:55431161-55431183 TTTTAAAGGGAAAATAAGGGAGG - Intergenic
1149341445 17:55690619-55690641 TTCTAATGGAAAAAAGAGGGGGG - Intergenic
1149520106 17:57312331-57312353 TTGAAAAAGAAAAATTAGGAAGG - Intronic
1149900018 17:60467263-60467285 ATTTAAAAGAAAAACAAGGATGG + Intronic
1149924554 17:60690271-60690293 TTTTAAAGGCTGAATGAGGCAGG + Intronic
1150137784 17:62704958-62704980 TTTTAATGGAAAAAGGAACAGGG + Intronic
1151031873 17:70750059-70750081 TTTAAAAAAAAAAATGATGATGG - Intergenic
1151269723 17:72984818-72984840 TGTTAAATGAATAAGGAGGAAGG + Intronic
1152058401 17:78050464-78050486 TCTGAAAGGAAAAATGACAATGG + Exonic
1152974780 18:204772-204794 TTCTGAAGGAAAAATGAAGCAGG - Intronic
1153112263 18:1605962-1605984 TTTCACAGAAAAAATGAGGAAGG - Intergenic
1153853731 18:9123789-9123811 TTGTAAAAGAAAAATGAGGCAGG - Intronic
1154091317 18:11366294-11366316 TTTTAAGGCAAAAATGTGTATGG - Intergenic
1154243333 18:12672442-12672464 TTTTAAAACAAAAATCAGTATGG + Intronic
1154344383 18:13530250-13530272 TTTTAAAAGTAAGAAGAGGAAGG + Intronic
1154353025 18:13602742-13602764 TTTTAAATAAAAAATTAGGCCGG - Intronic
1154425638 18:14270051-14270073 TTTCAGGGGAAAACTGAGGAAGG + Intergenic
1154433328 18:14325292-14325314 TTTCAGGGGAAAACTGAGGAAGG + Intergenic
1154510175 18:15090963-15090985 TTTTAGAGGAAAAAGCAGAAGGG + Intergenic
1155175373 18:23297219-23297241 TTTAAAAATAAAAATGAGAAAGG + Exonic
1155351389 18:24910920-24910942 TTTTAAAGAAAGTATGAGAATGG + Intergenic
1155807782 18:30193253-30193275 TTTTAAAGGAAATAATATGAAGG - Intergenic
1155817811 18:30336272-30336294 TTTTACAGAAAATTTGAGGAAGG - Intergenic
1156217188 18:35011603-35011625 GTGTAAAGGAAAGATCAGGAAGG + Intronic
1156227260 18:35121494-35121516 TTTGAAAGGTAAAATTAGGGAGG + Intronic
1156429020 18:37050404-37050426 TTTTAAAGAGAAAATGAGACAGG - Intronic
1156980135 18:43277113-43277135 ATTTAAAAGGAAAATGAGAATGG - Intronic
1157154835 18:45255296-45255318 TTTAAAAGGAGCAATGAGGATGG - Intronic
1157466357 18:47949659-47949681 TTTTAAAGGCAAATGGGGGAGGG + Intergenic
1157541300 18:48512113-48512135 TTTTAAAAGAAATATGAGGCTGG + Intergenic
1157541543 18:48514423-48514445 TTTTAAAAGAAATATGAGGCTGG + Intergenic
1157719814 18:49915015-49915037 TTGCAAAGGAGCAATGAGGAGGG - Intronic
1157785572 18:50479049-50479071 TTTTAAAGGTAAAATGAGGAAGG + Intergenic
1157786477 18:50487889-50487911 TTTTAAAACAAAATTGTGGAAGG + Intergenic
1158236413 18:55321068-55321090 ATTTAAAGCCAAAATGGGGAAGG - Intronic
1158968108 18:62641075-62641097 TTTTAAAGAATAAATAAAGAGGG + Intergenic
1159314587 18:66755331-66755353 TTTCTGAGGAAAAATAAGGAGGG + Intergenic
1159317014 18:66788525-66788547 TTTTAAAAGGGGAATGAGGAAGG - Intergenic
1159745632 18:72231163-72231185 TATTAAATAAAAAATTAGGAAGG - Intergenic
1160018339 18:75161238-75161260 TTTTAAGGGAAGAAAGAGAAAGG + Intergenic
1160561560 18:79761259-79761281 TTTTAATGGAAAATGGAGGCTGG + Intergenic
1161158533 19:2748249-2748271 TCTTAAAGAAAAAAAGAAGAAGG + Intergenic
1161331991 19:3692835-3692857 TTTTAGAGGAACAGTGAGGAGGG - Intronic
1162051633 19:8037584-8037606 CTTTAAAAAAAAAATGAGCAGGG - Intronic
1162214669 19:9123601-9123623 TTTTAATGGAAAAATGAGGAAGG + Intergenic
1162257715 19:9505517-9505539 ATTTAAAGTAAAAATAAAGAAGG + Intergenic
1162436903 19:10666239-10666261 TTTAAAAAGAAAAAAGAGGCTGG - Intronic
1162519434 19:11170798-11170820 TTTTAAAGGAACAATTAGCCTGG - Intronic
1162912482 19:13856013-13856035 TTCTAAAATAAAAATGAGGCTGG + Intergenic
1162953642 19:14086188-14086210 TTTTAAAGAAAAAAAGAGGCTGG - Intergenic
1162990029 19:14295955-14295977 AAATAAAGGAAAAATGGGGAAGG - Intergenic
1163023987 19:14498948-14498970 CTTTAAAAGAAAAAAGAGGCCGG + Intergenic
1163183102 19:15617856-15617878 ATTTGAAGGAAAACTGAGGAAGG - Intronic
1163202061 19:15776675-15776697 ATTTGAAGGTAAACTGAGGAAGG + Intergenic
1163998898 19:21079092-21079114 TTTTAAAATAAAAGAGAGGATGG + Intergenic
1164038150 19:21471703-21471725 TTTTAAAGAAAAATTGAGGCCGG - Intronic
1164844076 19:31416955-31416977 TTTTAAGGGAAAAATGTTCACGG + Intergenic
1165103104 19:33450759-33450781 TTATAAAGTAAAACTGAGGCAGG + Intronic
1165578921 19:36845543-36845565 AAATAAAGCAAAAATGAGGATGG + Intronic
1165679126 19:37758302-37758324 TTTTAAAAAAAAAAAGAGGCTGG + Intronic
1165683214 19:37795591-37795613 TTTTAAATTAAAAATAAGAAAGG - Intronic
1166211118 19:41307052-41307074 TTTAAAAAGCAAAATGGGGAGGG + Exonic
1166610444 19:44188885-44188907 TTTATAAGGAAAAATGAAAAGGG + Intergenic
1166704085 19:44898832-44898854 TTTTAAAGAAAAAAAGAGGCTGG - Intronic
1167572729 19:50299596-50299618 TTTTAAAGGAATAAAAGGGATGG + Intronic
1168233115 19:55045590-55045612 TATTAAAGGAGAAATGGGGTAGG - Intronic
925059427 2:879727-879749 TTTTAAAGGAAAGTTGGGGAAGG + Intergenic
925174660 2:1774008-1774030 TTTTAAAGGAAAAAAGGAGGAGG + Intergenic
925632686 2:5911686-5911708 ATTGAAAGGAAAAATCAGAAAGG - Intergenic
925661067 2:6203275-6203297 TTATAAAAGATAAATGAGGTAGG + Intergenic
925723697 2:6852915-6852937 TTTGAAAGTACAAATGAGGAGGG - Intronic
926347250 2:11958742-11958764 ACTTATATGAAAAATGAGGAGGG + Intergenic
926812464 2:16767816-16767838 TTTGAAAGTCAAAATGAAGAAGG - Intergenic
927065961 2:19471373-19471395 TCTTAAAAGAAATATGAAGATGG - Intergenic
927151203 2:20197141-20197163 TTTTTCAGCAAAAATGAGGGAGG - Intergenic
927300900 2:21513075-21513097 TTCAAAAAGAAAAATGAGGAGGG - Intergenic
927985220 2:27405409-27405431 TTTTCATGGAGAAAGGAGGAAGG + Intronic
928029626 2:27767482-27767504 TTTTGAAGAAGAAAGGAGGAGGG - Intergenic
928160045 2:28914632-28914654 TTTAAAAGTAAAAATCAGGCCGG + Intronic
928377932 2:30791252-30791274 AATTAACGGAAAAATGATGAGGG + Intronic
928409791 2:31046116-31046138 TTTTATATGTAAAATGTGGATGG - Intronic
928540764 2:32281536-32281558 TTATAAAGAACAAATGAGGCTGG - Intronic
928612465 2:33004001-33004023 TTTTCAAGGAAAAATAAGGATGG - Intronic
928800982 2:35091450-35091472 TATTAAAAGATAAATGACGATGG + Intergenic
928903843 2:36350462-36350484 TTTAAAAGGAAAAATTGGGGTGG - Intergenic
928935551 2:36673562-36673584 TTTTAAAGAATAAATAACGATGG + Intergenic
929130285 2:38561165-38561187 TTTTAATTTATAAATGAGGAAGG - Intergenic
929357328 2:41041445-41041467 TTTTGAAGGAAGTGTGAGGAGGG + Intergenic
929368121 2:41186526-41186548 TTTTAACAGAATGATGAGGATGG - Intergenic
929464416 2:42131902-42131924 TTTTAAAGTGAAAATGCTGAAGG + Intergenic
929842041 2:45477176-45477198 TTTTAGAGGGATGATGAGGAGGG - Intronic
930055930 2:47252012-47252034 TTTTAAAGGTAACATGCGGCCGG + Intergenic
930057449 2:47263014-47263036 TTTCACAGGTAAAATGAGAATGG + Intergenic
930342770 2:50138150-50138172 TTGTAAATGAAATATGTGGAAGG - Intronic
930398944 2:50858723-50858745 TTTTAAATGAAAAATCAGGAGGG + Intronic
930407994 2:50985930-50985952 TCTCAAAGAAAAAATGAGCAGGG + Intronic
930422332 2:51168739-51168761 TTTGGTAGGAAATATGAGGAGGG + Intergenic
930513240 2:52372843-52372865 TTTGAAAGGAAAAAAGTGAAAGG + Intergenic
931394856 2:61878194-61878216 TTTAAAAGGAAAAAGGATTAGGG + Intronic
931718894 2:65052904-65052926 TTTTAAAAGATGACTGAGGATGG + Intergenic
931824191 2:65982607-65982629 TTAAAAAGGAAAAATCAAGAAGG - Intergenic
931886839 2:66626675-66626697 TTTGAAAGGTCAAAAGAGGACGG + Intergenic
932168538 2:69531866-69531888 CTTTAAGTGAAGAATGAGGAGGG - Intronic
932482363 2:72052722-72052744 TTTTAAAGCAAAAATATGGTTGG - Intergenic
932987082 2:76738977-76738999 TTTTAAATAGAAAATGAGGCTGG - Intergenic
933360670 2:81279592-81279614 TGTTAATGGAAAGTTGAGGAGGG + Intergenic
933486214 2:82927470-82927492 TTTAGAAGGTAAAATGCGGAAGG - Intergenic
933765181 2:85703158-85703180 GATTAAAGGAAAAATCAAGAGGG - Intergenic
933893718 2:86792016-86792038 TTTTAAAGAAACAAAAAGGAAGG - Intronic
933912378 2:86953759-86953781 TTTTAAAAGAAAAATGTTAAAGG - Intronic
933929307 2:87132140-87132162 TTTTAAAAGAAAAAGGAGATAGG - Intergenic
934000636 2:87707933-87707955 TTTTAAAAGAAAAAGGAGATAGG - Intergenic
934010617 2:87816138-87816160 TTTTAAAAGAAAAATGTTAAAGG + Intronic
934030122 2:88037456-88037478 TTTTAAAAAAAAAATAAAGATGG - Intronic
934714191 2:96533828-96533850 TTTCAAAGGAGAAATGAAGTGGG - Intergenic
934846979 2:97667765-97667787 TTTTAAAGAAAAAATGAAAAGGG - Intergenic
934956008 2:98620045-98620067 TTTCAAAGGAACAAACAGGAAGG - Exonic
935254363 2:101295991-101296013 ATTTAAAGAAAAAATGAGTTGGG + Intronic
935418188 2:102840600-102840622 AATTAAAACAAAAATGAGGAAGG + Intronic
935774192 2:106456840-106456862 TTTTAAAAGAAAAATGTTAAAGG + Intronic
935905875 2:107839073-107839095 TTTTAAAAGAAAAATGTTAAAGG - Intronic
936009847 2:108918572-108918594 TTTTAAAGTGAAAATGAGCGGGG + Intronic
936127672 2:109804240-109804262 TTTTAAAAGAAAAATGTTAAAGG - Intronic
936217025 2:110567245-110567267 TTTTAAAAGAAAAATGTTAAAGG + Intronic
936363633 2:111831241-111831263 TTTTAAAAGAAAAAGGAGATAGG + Intronic
936426164 2:112421829-112421851 TTTTAAAAGAAAAATGTTAAAGG + Intronic
936469527 2:112786533-112786555 TTTTAAAGGAAAACTAGGGTGGG + Intergenic
936661694 2:114550112-114550134 ATTTAAATGAAAAATGAGGGAGG - Intronic
936678669 2:114745255-114745277 TTCTAAAAGAAACATGTGGATGG + Intronic
936687072 2:114840273-114840295 TTTGAAAGGAAGAAGGAGTAAGG + Intronic
937102881 2:119285309-119285331 TGTTACAGGAAAAATAAGGAAGG - Intergenic
937451647 2:122007247-122007269 TTTCAAAGGAAGAAAGCGGAGGG - Intergenic
937546439 2:123027600-123027622 TTTGAAAGGAGAAATCAGGCAGG + Intergenic
937590925 2:123612266-123612288 TTTTAAAGAAATAACAAGGAGGG - Intergenic
937642788 2:124232609-124232631 CTCAAAAGGAGAAATGAGGAGGG - Intronic
937660494 2:124425001-124425023 TTTTAAAGGAAACCTGAAAAGGG + Intronic
937669931 2:124527751-124527773 AGTTAAAGCAAAAAGGAGGAAGG + Intronic
937965192 2:127501719-127501741 TTTGAAAAGAAAAATGGGGTGGG - Intronic
938033996 2:128020700-128020722 TTTTAAAGGTGAAATGGGGCCGG + Intronic
938505397 2:131875401-131875423 TTTTAGAGGAAAAAGCAGAAAGG + Intergenic
938581506 2:132650697-132650719 TTTTAAAGGAAGGAGGAGGAAGG - Intronic
938607698 2:132912873-132912895 TTTCAAAGCACAGATGAGGAGGG - Intronic
938828080 2:135026495-135026517 TTTTGAAAAAAAAAGGAGGAGGG - Intronic
938868054 2:135445145-135445167 TTTTAAAGGGAAAAATAGGCCGG + Intronic
938990814 2:136627721-136627743 TGTTAAAGGAACTAAGAGGAAGG - Intergenic
939423780 2:142008077-142008099 TTTTAAGGGCAAAAAGAAGAAGG + Intronic
939542356 2:143509678-143509700 TTTTAAAGGAAAAGAAAAGATGG + Intronic
939566633 2:143793300-143793322 TTTTAAAAGAAGATTGAGGGCGG - Intergenic
939727666 2:145743472-145743494 TTTTTAAGAAAGAAAGAGGAAGG + Intergenic
939797675 2:146667002-146667024 GTTTGAAGGAAAAATGAATAGGG + Intergenic
940072962 2:149710145-149710167 TTAAAAAGGAAAAGTGAGCAAGG + Intergenic
941081194 2:161062532-161062554 TTTTAAAGGAGAAAAGAAAATGG - Intergenic
941089897 2:161162258-161162280 TTGAAAAGGAAAAATGAAGAGGG - Intronic
941196637 2:162460369-162460391 TTTTAAAAAAATATTGAGGATGG + Intronic
941305823 2:163865460-163865482 TTTTAATGTAAAAATTAGAAAGG - Intergenic
941567971 2:167132120-167132142 TCTTAAAGAAAGAATGATGATGG - Intronic
941646355 2:168045831-168045853 TTATAAAGAAAATATGGGGAAGG + Intronic
941747723 2:169104716-169104738 TTTTAAAGGAAAAAATGAGAAGG + Intergenic
942045942 2:172099608-172099630 TTTTAAAGGAAAAAATAAAAAGG + Exonic
942111661 2:172688602-172688624 CTATAAAGGATAAAGGAGGAGGG + Intergenic
942446927 2:176084335-176084357 TGTCCAAGGAAAAATGAAGAAGG - Intergenic
942551218 2:177121251-177121273 TAATAAAGGGAAAATGAGAATGG - Intergenic
942627997 2:177924132-177924154 TTTTAAAGGAAAAATAAAAAAGG - Intronic
942668003 2:178342708-178342730 TTTTAAATGAAGTAAGAGGAAGG + Intronic
942702626 2:178730865-178730887 TTTTAAGGGAAGAAGGAGCATGG + Intronic
942761053 2:179398741-179398763 TTGTAAAGGAAAAAATGGGAGGG - Intergenic
942873378 2:180763307-180763329 TTTTAGAGGCAAAATGAGGCTGG + Intergenic
943013078 2:182475524-182475546 TATTAAAGTAATAATGAGAATGG - Intronic
943332260 2:186573523-186573545 ATTAAGAGGAAAAATGAGGAAGG + Intergenic
943405650 2:187480434-187480456 TTTCCAATGTAAAATGAGGATGG - Intronic
943428548 2:187768254-187768276 TTTTAATGGAAGAATGAATACGG + Intergenic
943939590 2:193974807-193974829 TATTAAAAAAAAAATCAGGATGG - Intergenic
943994505 2:194743526-194743548 TTTTAAAAAAAAAAGGAGAAAGG - Intergenic
944183629 2:196924997-196925019 TATTAAACCAAAAATAAGGAGGG + Intronic
945028936 2:205645649-205645671 TTTTTAAAGAAAAGTCAGGAAGG + Intergenic
945326878 2:208492416-208492438 TTTTAAAGGGAGAATGAGGGAGG + Intronic
945465235 2:210161824-210161846 TGTTCAAGGCAAAATGAGTAAGG + Intronic
945656472 2:212630384-212630406 TTTTAGAGAAAGAAAGAGGAGGG - Intergenic
945814979 2:214593701-214593723 TTTTAAAAGGAGAATGAGGAAGG + Intergenic
945871247 2:215228708-215228730 TGTTAAAGGAAAAAGTAGCATGG - Intergenic
945945050 2:215987582-215987604 TTTTAAAAGAAGAAAGTGGAAGG + Intronic
946037564 2:216756020-216756042 TTGTACAGATAAAATGAGGATGG + Intergenic
946063817 2:216968810-216968832 CTTTAAAGTAAAGATGAAGAGGG + Intergenic
946190576 2:218005783-218005805 TTTTGAAGGGAAAAGAAGGAAGG - Intergenic
946552246 2:220815470-220815492 ATTTAAAGGAAACATGGGAAAGG - Intergenic
946864056 2:224027015-224027037 AGTAAAAGAAAAAATGAGGACGG + Intronic
946992526 2:225351381-225351403 ATTTAAAGGAAAAATCAATAAGG + Intergenic
947341126 2:229140912-229140934 TTAAAAAGAAAAAATGAGTAGGG + Intronic
947379339 2:229530001-229530023 CTTTAAAAAAAAAATGAAGAAGG + Intronic
947632096 2:231660576-231660598 TTTAAAAAGAGAAATAAGGATGG + Intergenic
947907842 2:233778518-233778540 CTTTAAAGGAAAAGAGAGTATGG + Intronic
948181375 2:235983415-235983437 TCTTACAGGAAAAAGGAGAATGG - Intronic
948184205 2:236006761-236006783 CTTTAAAGGAAAAATGGAAAAGG + Intronic
948555158 2:238804472-238804494 TTTGAAAGGAAAAATCAGGCGGG + Intergenic
1169105889 20:2994170-2994192 TTATTAAGAAAAGATGAGGAGGG + Intronic
1169325881 20:4676124-4676146 TTTTAGAGGAAAAATAAGGAGGG - Intergenic
1169434686 20:5575547-5575569 TTTCATAGGAAAAAAGAGGGAGG + Intronic
1169529874 20:6473596-6473618 TTGTAAAGAAGAAATGATGATGG + Intergenic
1169727900 20:8755815-8755837 TTGTAAAGGATAAATGAGGAGGG + Intronic
1170034925 20:11980193-11980215 TTTAAAAGGAAAATACAGGAGGG + Intergenic
1170236720 20:14114591-14114613 TTTTATAAGAAGATTGAGGAAGG + Intronic
1170450162 20:16474642-16474664 TTTGTCAGGAAAAATGGGGAAGG - Intronic
1170519372 20:17168254-17168276 GTTGAAAGAAAAAAAGAGGAAGG + Intergenic
1170744752 20:19089621-19089643 TTTAAAAAGAAAAATGAGTCAGG - Intergenic
1171026073 20:21631556-21631578 TTTCAAAACAAAAATGTGGAAGG - Intergenic
1171108342 20:22457450-22457472 TGTTAAAGCAAAAGGGAGGAAGG + Intergenic
1171779582 20:29407356-29407378 TTCTAAAGGAAGAAAGAGAAAGG + Intergenic
1172226483 20:33308354-33308376 TGTTCCAGGAAAGATGAGGAAGG + Intronic
1172284265 20:33730203-33730225 TGTTAAAGAAAAAATTAGGCCGG - Intergenic
1172946003 20:38690005-38690027 TTTTAAAGTAAAAATAAAGATGG - Intergenic
1173117430 20:40258776-40258798 GTTTAAAGGAAAAATGATAATGG + Intergenic
1173266436 20:41487291-41487313 TTTTGAAGGGAAAAGGATGAAGG + Intronic
1173984572 20:47251027-47251049 TTTTGAAGGAAAAAAAAGGAGGG + Intronic
1174501219 20:50986126-50986148 TTTTAAAAGAAAAAAGAGGCGGG - Intergenic
1174683823 20:52434413-52434435 TTTCAAATAAAAAGTGAGGATGG - Intergenic
1174842052 20:53910232-53910254 TTTTAAAAGCAAAAAGAGGCCGG - Intergenic
1175090701 20:56501319-56501341 TTTTAATGAAAAAATAATGAAGG + Intronic
1175527177 20:59643204-59643226 TTTTAAAAGAAGAATTAGGCCGG - Intronic
1175636501 20:60588815-60588837 TTGTAAGGCAAAAATGAGGAAGG - Intergenic
1176276579 20:64274218-64274240 TTTCAAAGGAAAAATTTTGATGG + Exonic
1176843721 21:13860465-13860487 TTTCAGGGGAAAACTGAGGAAGG - Intergenic
1176846391 21:13879785-13879807 TTTCAGGGGAAAACTGAGGAAGG - Intergenic
1176905837 21:14500157-14500179 AGTGAAAGGAAAAATGAGAAGGG - Intronic
1177162134 21:17559338-17559360 TTTTAAAAAAAAAATTAGCAGGG - Intronic
1177361639 21:20080041-20080063 ATTTAATGGAAAGATGAGAATGG + Intergenic
1177432270 21:21005615-21005637 ATTTAAAGTATAAATGGGGATGG - Intronic
1177986862 21:27986924-27986946 TTTTGGAGGAAAAAGGAGAAGGG - Intergenic
1178066415 21:28909189-28909211 CTCTAAAGAAAAAATGAGGTGGG - Intergenic
1178127911 21:29535907-29535929 TGTTAGAGGAAAAATGAGTTTGG - Intronic
1178701625 21:34838392-34838414 TCTTAGCAGAAAAATGAGGAAGG + Intronic
1178880413 21:36445784-36445806 TTTTAAATGAAAGAAGAAGATGG + Intergenic
1179122392 21:38559977-38559999 TGTTAAAGAAAAGATGAGGCCGG - Intronic
1179210297 21:39319076-39319098 TTTCAAAGTAAAAATGAAGAAGG + Intronic
1179235606 21:39542819-39542841 TTTTAAAATAAAAATGGAGATGG + Intergenic
1180256689 21:46634890-46634912 TTTAAAAAAAAAAATGTGGAAGG - Intergenic
1180600343 22:17011263-17011285 TTTTAAAGGCAAAACAAGGTGGG - Intergenic
1180638507 22:17279557-17279579 TTTTAAAGGAAAGATGGGGATGG + Intergenic
1180886026 22:19244477-19244499 TTTTAACAGAAAAATGAGCATGG + Intronic
1182411234 22:30188738-30188760 TTTTAAAGGAAAAAATAAGGAGG - Intergenic
1182634248 22:31711875-31711897 TTCTACAGGAAAACTGAGCAGGG + Intronic
1182843136 22:33408296-33408318 TTTTAAAGGAAAAAATAAGGAGG + Intronic
1183503432 22:38194902-38194924 TTTTAGAGGGAAAATGATGGAGG + Intronic
1183643590 22:39108617-39108639 TTTTAAAACAAAATTAAGGACGG + Intergenic
1183760139 22:39808915-39808937 TTTTAAAGTAAAAAAGAGGGGGG + Intronic
1183818418 22:40323341-40323363 TTTAAAAGGAAAAAAGAAAACGG + Exonic
1183984085 22:41560051-41560073 TTTTAAAATAAAAAGGAGGTGGG - Intergenic
1183992218 22:41605165-41605187 TAATAATGGAAAAACGAGGACGG + Intronic
1184064634 22:42110825-42110847 TTTTAAATAAAAAAGCAGGAAGG - Intergenic
1184675978 22:46043824-46043846 TTTTTAAAGAAAAATGAACAAGG - Intergenic
1184980226 22:48090411-48090433 TTGTAAAAGAAGAATGAGAATGG + Intergenic
1185149177 22:49154347-49154369 TCTGAAAGGAAAAAAGAGAAGGG - Intergenic
949100475 3:138275-138297 TTTTAAAGGTAAAATGATGAGGG + Intergenic
949254849 3:2033787-2033809 TGTTAAAAGAAAAAAGAGGTTGG + Intergenic
949344738 3:3066268-3066290 ATTTAGGGGAAAAATGAGAAAGG + Intergenic
949381704 3:3454113-3454135 TTTTAGAAGAGAACTGAGGAAGG + Intergenic
950009497 3:9712803-9712825 TTCTACAGGAGCAATGAGGATGG + Exonic
950170285 3:10834381-10834403 TTTCATAGGAAAAGGGAGGAAGG + Intronic
950246663 3:11426437-11426459 TTTAAAAGGATAAATGAGAAGGG - Intronic
951065311 3:18257728-18257750 TTTTAAAGTAAATATGGAGAAGG + Intronic
951126289 3:18988156-18988178 TTTTATAGGAAAACAGATGACGG - Intergenic
951151325 3:19293393-19293415 TTTTAAATAACAAATGAGAATGG - Intronic
951160493 3:19413841-19413863 TTTTAAAGGGAAAATGTGAAAGG - Intronic
951650266 3:24943920-24943942 TTTCAAAGTGAAAGTGAGGAGGG + Intergenic
951673164 3:25207577-25207599 TAGTATAGAAAAAATGAGGAGGG - Intronic
951897862 3:27627539-27627561 TATTAAAAGAAAAAGGAGGCCGG + Intergenic
952055832 3:29444498-29444520 TTATAAAGGAACAATCAGTATGG + Intronic
952094671 3:29935401-29935423 TTTTAAAAAAAAATTGTGGATGG + Intronic
952120765 3:30241491-30241513 TATTAAAGAAATAATGAGGTTGG - Intergenic
952768803 3:36978375-36978397 TTTTTAAGAAAGAATGAGGATGG - Intergenic
952818045 3:37462669-37462691 TTTCTAAGGAAAAAGGAGAAGGG + Intronic
952953159 3:38540398-38540420 AGTTAAAGGAAAAATAAGGCTGG + Intronic
953776581 3:45822652-45822674 TTTAAAAAGACAAATGAGGCCGG + Intergenic
953857617 3:46512182-46512204 TTTTAAAGTAAAATTGACAAAGG + Intergenic
954003549 3:47576231-47576253 TTACAAAGGCAAAATGAGGCCGG - Intronic
954508842 3:51104053-51104075 TTTGATAGGATAAATGAGGAGGG + Intronic
954598394 3:51847490-51847512 TTTTAAAGGGAGAATGAGGGAGG + Intergenic
954827081 3:53383510-53383532 TTTGTAAGGAAACATGAGGGAGG + Intergenic
955021806 3:55129024-55129046 TTTTAAAAGAAAAAACAGGCTGG + Intergenic
955049578 3:55397023-55397045 TTTTAAAAGGACAATGAAGATGG + Intergenic
955361026 3:58275087-58275109 TTTTATAGCAGAAATGAAGATGG + Intronic
955568019 3:60270637-60270659 TTTTCCAGCAAAAATGAGGTAGG + Intronic
955592998 3:60557937-60557959 TTTCATTGCAAAAATGAGGAAGG + Intronic
956327227 3:68067315-68067337 ATTTAATGAAAAAATGATGAAGG - Intronic
956421217 3:69087669-69087691 ATTTGAAAGGAAAATGAGGAGGG - Intronic
957120728 3:76088005-76088027 ATTAAAAGTAAAAATTAGGATGG + Intronic
957130101 3:76213462-76213484 TGTGAAAAGAAAAATGAGAATGG + Intronic
957215894 3:77318577-77318599 TTTTAAAGTAAAACTGAAGTTGG + Intronic
957460115 3:80506063-80506085 TTTTAAACAAAAAATTAGGCAGG + Intergenic
957691859 3:83581061-83581083 GCCTAAAGAAAAAATGAGGATGG + Intergenic
957841933 3:85683214-85683236 TCTTGAAGGAAAAAAAAGGATGG + Intronic
957861963 3:85964574-85964596 TTTTAAAGGTGTAATTAGGAGGG - Intronic
957964340 3:87303487-87303509 TTTTACAGGGAAAATGTAGATGG - Intergenic
958067657 3:88564537-88564559 TTTTCAAGGAAAGATATGGAAGG - Intergenic
958794523 3:98692776-98692798 TAAAAAAGGAAAAATAAGGAGGG + Intergenic
958899899 3:99873470-99873492 ATTTAAAGGAAAAAGGAAGAGGG - Intronic
958935645 3:100252879-100252901 TTTCAAAAGAAAAAAGAAGAAGG - Intergenic
959204851 3:103293384-103293406 TTATTAAGGAAAAAGGAGGAGGG - Intergenic
959237095 3:103738279-103738301 TTTTAAGGGAAGAATCAGGCAGG + Intergenic
959248842 3:103912825-103912847 TTTCATAAGAAAAAAGAGGATGG + Intergenic
959511892 3:107222942-107222964 TTTTATAAGAAAAATCAGAAAGG + Intergenic
959604245 3:108224747-108224769 TTTTACAGGAAGAATGAACATGG - Intergenic
959675132 3:109026219-109026241 TGCAAAAGGAAAAAGGAGGATGG + Intronic
959916250 3:111819745-111819767 TTCTAAAGGACAAATAAGCAAGG - Intronic
960099339 3:113723312-113723334 TTTTTAAGGAATACTGAGAAAGG - Intronic
960237154 3:115296985-115297007 TTTTAAAGAAAAAATCAACAGGG + Intergenic
960245109 3:115391715-115391737 TGTTAAAGGAAGAAGAAGGAAGG - Intergenic
960452651 3:117829464-117829486 TTTTAAAGGAACTAACAGGAAGG - Intergenic
960910669 3:122645994-122646016 TTTTAAACCAAAAATTTGGAAGG + Intergenic
960964425 3:123094923-123094945 TTTTAAAGGGAAAAGCAGGGTGG - Intronic
961022989 3:123525219-123525241 TTGGAAAGGAAAAAGGTGGATGG + Intronic
962240880 3:133749858-133749880 TTTTAAAGGGAGAATGAGGGAGG + Intronic
963447630 3:145434991-145435013 TTTTAAGAGACAAATGAGAATGG - Intergenic
964151365 3:153528548-153528570 TTTTTAAGGGAGAATTAGGAAGG - Intergenic
964206604 3:154181917-154181939 TTTTAAATAAAAAATGATAAAGG - Intronic
964350984 3:155803878-155803900 TCTCAAAGGAAAAAAGAGGCCGG + Intronic
964869066 3:161293175-161293197 TTTTAAGGGAAAAATGAGGAGGG + Intergenic
965020758 3:163227432-163227454 ATTTAAAGATAAAATGAGAAGGG - Intergenic
965192987 3:165555493-165555515 TTTATAAGAAAAATTGAGGATGG - Intergenic
965289461 3:166860654-166860676 ATCTAAAGGCAAAATGATGATGG - Intergenic
965421193 3:168460912-168460934 TTTTAAAGAAAAACTGTGGCTGG + Intergenic
965441911 3:168724786-168724808 TTTGAAGGGAAAAAAGAAGATGG + Intergenic
965836250 3:172856397-172856419 TTTTATATGAAAGATGAGGCCGG + Intergenic
966058882 3:175731832-175731854 TTAAAAAAGAAAAAGGAGGAGGG - Intronic
966167457 3:177036417-177036439 TTTTAAAGCAAAAACTAGGATGG - Intronic
966566196 3:181384034-181384056 TTGAAAGGGAGAAATGAGGAGGG + Intergenic
966768796 3:183485757-183485779 TTTTAAAGGGAGAATAAGGGAGG - Intergenic
966808129 3:183821955-183821977 TTTTAAAGTTAAAAAGAGGCCGG - Intronic
966818655 3:183908502-183908524 TTTTAAAGGAAAAATCAGGTTGG - Intergenic
966841580 3:184093733-184093755 TTTAAAAAGAAAAATGAAGCTGG + Intergenic
967373108 3:188771250-188771272 TTTAAAAAGAAAAAAGAGGCCGG + Intronic
967418159 3:189242653-189242675 TTTTAAAAAATAAAAGAGGAGGG - Intronic
967482115 3:189985029-189985051 TTTTAAAAGAATAATAAGTAAGG + Intronic
967527159 3:190508302-190508324 TTTTAAATGGAGAATGAGGGAGG - Intergenic
967674338 3:192278055-192278077 CTTTAAAGGAGAAATGTGGCTGG - Intronic
967733641 3:192930262-192930284 TTATAAAGCAGAAATTAGGAGGG - Intergenic
968021622 3:195396484-195396506 TTTTAAAGAAAAAAGAAGTATGG + Intronic
968781347 4:2584225-2584247 TGTTAAAGGACAAATGAACAAGG - Intronic
969833234 4:9815871-9815893 TTTAAAATAAAAAATGAGGCCGG + Intronic
970127816 4:12833953-12833975 AATTAAAGGAAAAATAAGCAAGG - Intergenic
970209702 4:13696598-13696620 TTTTGAAGGAAGGAGGAGGATGG + Intergenic
970230199 4:13901946-13901968 TTTTAGCTGAAAAATGAGAATGG + Intergenic
970978843 4:22073810-22073832 TTTTAAAGGAAAGATAAGATGGG - Intergenic
971094683 4:23387393-23387415 TGTAAAAGGAAAGATGTGGAAGG - Intergenic
971655250 4:29336006-29336028 TTATAGAAGAAAAAGGAGGAAGG - Intergenic
972076436 4:35094974-35094996 CTTTAAAGGAAATATCAGGCAGG + Intergenic
972130573 4:35828019-35828041 TTTTAATGGAAGAATGACAAGGG - Intergenic
972232250 4:37087836-37087858 TTTTAAAGGAAAAATGCAGGTGG + Intergenic
972394673 4:38648780-38648802 TTTTAAAGGTCATATGAAGATGG - Intergenic
972502159 4:39688442-39688464 TTTTAAAGGAGTAATGGGGCTGG + Intergenic
972523991 4:39890413-39890435 TTTGAAAAGAAAAATGACTAAGG + Intronic
972586677 4:40443900-40443922 TATTAAAAGATAAATGAGGCTGG + Intronic
972923579 4:43974641-43974663 TTTTTAAGGAAACATTATGAGGG - Intergenic
973367182 4:49217153-49217175 TTTCAGGGGAAAACTGAGGAAGG - Intergenic
973778764 4:54268681-54268703 TAGTAAAGGAAAAATGAAGTGGG + Intronic
974220471 4:58962772-58962794 TTTTCAAGAAAAAAGAAGGAGGG - Intergenic
974272731 4:59673391-59673413 TTTTAAAGGTATAATGGGTATGG - Intergenic
974435467 4:61852138-61852160 TTTTAAAAGATAAAAAAGGAAGG + Intronic
974543030 4:63263731-63263753 GATTAAAAGAAAAAGGAGGAGGG + Intergenic
974671373 4:65034517-65034539 TGTGAAAGAAAAAATGGGGAAGG + Intergenic
974694027 4:65341060-65341082 TTTCTAAGAAAAATTGAGGAGGG - Intronic
975043730 4:69775835-69775857 TTTTAAAGAAATAAAGAGGTGGG - Intronic
975058818 4:69970994-69971016 TTTCAGAGGTAAAATTAGGAGGG + Intergenic
975241955 4:72070407-72070429 TTTTAAAGGAAAAATGAGGAGGG + Intronic
975309592 4:72888519-72888541 TTTTCTAGGAAAAATGAGACAGG + Intergenic
975362965 4:73493248-73493270 TTTTAATGGAAGAATGAGGAAGG + Intronic
975631063 4:76402749-76402771 TTTCAAAGGTAAAATCAGCAGGG + Intronic
976080602 4:81350915-81350937 TTTTAAAGGTAAAAAGATGAGGG + Intergenic
976146432 4:82045741-82045763 ATTTAAGGGATAAAAGAGGAAGG + Intergenic
976553773 4:86426802-86426824 TTTCAAATGAAATATGAGGTAGG - Intronic
976692608 4:87884816-87884838 GTTTAAAGGAAAAATAAAGCAGG + Intergenic
976780564 4:88754008-88754030 ATTTAAAGGGAAAAACAGGAGGG + Intronic
977011474 4:91639943-91639965 TTTTAAAGGAAATAGGAGCCTGG + Intergenic
977348796 4:95853294-95853316 TTTTTAGACAAAAATGAGGAGGG + Intergenic
977379994 4:96260506-96260528 TTCTATAGTGAAAATGAGGAAGG + Intergenic
977649745 4:99455419-99455441 TTTGAAAGGAAAAATGAGGCGGG - Intergenic
978157834 4:105509787-105509809 TTTTACAGGAAAAATCATAAAGG + Intergenic
978686311 4:111448491-111448513 ATTTAAAGGAATAGGGAGGATGG + Intergenic
978769293 4:112437300-112437322 CTTAAAAGGAAAAATGACCATGG + Intronic
978959662 4:114661043-114661065 TTCTAAAGGACAAAGAAGGAAGG - Intronic
978988530 4:115047626-115047648 TTTTAATTTAATAATGAGGATGG + Intronic
978993355 4:115116011-115116033 TTCTGAATGAAAAATGAGGCAGG - Intergenic
979059380 4:116037576-116037598 TTTTAAAGGAAAAAATAAGAAGG - Intergenic
979061303 4:116065502-116065524 ATTAGAAGGAAAAATGAGTATGG + Intergenic
979253716 4:118590861-118590883 TTTTAAAGGAAAAAATAAGGAGG + Intergenic
979544659 4:121926278-121926300 TTTTAAAGGAAAAGTGAGGAGGG - Intronic
980015163 4:127641506-127641528 TTTGAAAGGATAAATGAAGGAGG - Intronic
980289132 4:130823128-130823150 TTAAAAAGGAATAGTGAGGATGG + Intergenic
980475398 4:133307832-133307854 TTTTAAATAAAAAAAGAAGAGGG - Intergenic
980597735 4:134976506-134976528 GTTTAAAGGAAGAATAAGGCTGG + Intergenic
980603149 4:135052309-135052331 TTTTAAAAGATAACAGAGGAGGG - Intergenic
980641659 4:135587742-135587764 TTTTAAATGAAAAAAAAGGAGGG - Intergenic
980712355 4:136586104-136586126 TTGTGAAGGAAAAATAATGAAGG - Intergenic
981097779 4:140799196-140799218 ACTAAAAGGAAAAATGAGGCAGG - Intergenic
981292676 4:143094582-143094604 TCTTAAAGGATAAATTAGGTTGG - Intergenic
981629493 4:146802017-146802039 TTTTAAAGCGAAAATCAGGATGG + Intronic
981781163 4:148431227-148431249 TTTTAAAGTAAAAATGAGGAGGG - Intronic
982032167 4:151311685-151311707 TTTAAAAGAAAAAATTAGCAGGG + Intronic
982475956 4:155850727-155850749 TTTTAATTGCAAAATGAAGAGGG - Intronic
982510844 4:156281502-156281524 TTTAAAGGAAAAAATGAGGAGGG + Intergenic
982583372 4:157207197-157207219 TTTTTAAGGGAAAAGAAGGATGG - Intronic
982802069 4:159718066-159718088 TCTGAAAGGATCAATGAGGAAGG - Intergenic
983804199 4:171973237-171973259 TTTTGGAGAAAAAAGGAGGAGGG + Intronic
983979694 4:173979742-173979764 TTTTGAGGCAAAAAAGAGGAAGG - Intergenic
984277340 4:177626736-177626758 TTTTAAAGCAGCAAGGAGGACGG - Intergenic
984301558 4:177926094-177926116 ATTTAAAGGGAAAAAAAGGAAGG + Intronic
984740919 4:183161959-183161981 TTTTTCAGCATAAATGAGGAAGG + Intronic
985667672 5:1190342-1190364 CTTTAAAGGGAAAATGAAGAGGG + Intergenic
985936899 5:3104318-3104340 TTTTAAAAAAAAAATGAAAATGG + Intergenic
986016820 5:3764493-3764515 TTTTAAAACTTAAATGAGGAAGG - Intergenic
986186444 5:5445708-5445730 TTTTAAATAAAAAATGTGGCTGG - Intronic
986729557 5:10625093-10625115 AATTAAAGTGAAAATGAGGAAGG + Intronic
986754124 5:10818705-10818727 TTTTAAAGCCAAGATGATGAAGG + Intergenic
986877476 5:12129096-12129118 TTTTATATGAAAAGTGAAGAAGG - Intergenic
986884731 5:12219234-12219256 TTTTTTACTAAAAATGAGGAAGG - Intergenic
987083284 5:14445725-14445747 CTTTCAAGGATAAAAGAGGAAGG - Intronic
987154045 5:15070003-15070025 TTGTAAAGGAAAAATGAGGAGGG + Intergenic
987269745 5:16294424-16294446 TTTTAAAGGCAAAATGTGAAAGG - Intergenic
987286684 5:16464919-16464941 CTTTTAAGTAAAAATGATGAGGG - Intronic
987375035 5:17226385-17226407 TGTCAAAGGAAAAATGAAGTGGG - Intronic
987883759 5:23784811-23784833 TTTTAAAGCAAGAATGAACATGG + Intergenic
987931570 5:24406116-24406138 TTTTTAAGGAAAAACAAGAATGG + Intergenic
988224391 5:28393569-28393591 TTTTAAAGGAAAAACAAAAACGG - Intergenic
988921564 5:35947088-35947110 TTTTAAATGAAAAATGAAGAGGG + Intergenic
989417892 5:41201825-41201847 TTTTCATGGAAAAATTAGGCAGG + Intronic
989748913 5:44867463-44867485 TTTTTGAGTAAAAATGGGGAAGG + Intergenic
990370335 5:55111519-55111541 TTTTAACTGCAAAAAGAGGATGG + Intergenic
990540256 5:56765359-56765381 TTTTAAAAGAAAATTTAGGCTGG - Intergenic
990590764 5:57261402-57261424 TTTTAAAAAAAAAAAGAGGGAGG + Intronic
990757305 5:59087812-59087834 TTAGAAAGGAAAGATGAGTAAGG - Intronic
990962231 5:61406453-61406475 TCTTTAAGGAAAAATGAGTGAGG - Intronic
990977175 5:61570292-61570314 ATTTGCAGGAAAGATGAGGAGGG + Intergenic
990999975 5:61772809-61772831 TTGTAAAGGCAAAAAGAGCATGG - Intergenic
991023561 5:62006427-62006449 TTTAAAAAGAAAAATAAGTAAGG - Intergenic
991207635 5:64067623-64067645 TTTTGAAGCAAAAATGATAATGG + Intergenic
991264934 5:64706539-64706561 TTTTAGAAGAAAAATGAGTCTGG + Intronic
991493006 5:67201533-67201555 TTTTTAGGTAAAAATGGGGAGGG + Intergenic
991584536 5:68188347-68188369 CTTGGAAGGAAAAATGGGGAGGG + Intergenic
991679269 5:69122355-69122377 TTTTAAAAAGAAAATGAGGCTGG + Intronic
992093087 5:73336763-73336785 ATATAAAGGAAAAATGAAGCAGG - Intergenic
992192125 5:74303530-74303552 TTTCAAAGGGAAAGTCAGGAAGG - Intergenic
992472369 5:77070658-77070680 TTTTAAAGCAAAAATTTGGGTGG + Intergenic
992475527 5:77098275-77098297 TTTTAAAAAAAAAAAGAGGAAGG - Intergenic
992510520 5:77429080-77429102 TTTTAAAATAAAAATGACAAGGG + Exonic
992870674 5:81002402-81002424 TTTTAAACGAATAATGATGAGGG + Intronic
993033355 5:82729754-82729776 TTTATAAGGAGAAATGAAGATGG + Intergenic
993085980 5:83364357-83364379 TTTTAATGGAAAAATGAATGAGG + Intergenic
993139645 5:84015297-84015319 GTTCAAAGGAAGAATGAGAAAGG + Intronic
993248548 5:85484394-85484416 TATAAAAGGAAAATTGAAGATGG - Intergenic
993808651 5:92444887-92444909 TTTTTAATGAAAAATGAAGTTGG - Intergenic
994082070 5:95718155-95718177 TTTTAAAAGAAAAAAAAAGAGGG - Intronic
994784976 5:104147078-104147100 TTTAAAAAGTAAAATGAGAAAGG + Intergenic
995059858 5:107802126-107802148 TTTTACAGGAAAGATGAGCCTGG + Intergenic
995605109 5:113845664-113845686 TTTTACAAGAAAAATCTGGAGGG + Intergenic
995788348 5:115855852-115855874 TTTTAAAAGAATGATGAGGATGG + Intronic
995797041 5:115952366-115952388 TTTTAAAGGAAAAAATGAGAAGG - Intergenic
995970164 5:117959363-117959385 ATTTAAAGGAAGATTGAGCAGGG + Intergenic
996002206 5:118377712-118377734 TGTAAAAGAAAAAATTAGGAAGG + Intergenic
996447436 5:123571970-123571992 TTTTAAAGGAAAAATGAGGAGGG + Intronic
996576174 5:124978612-124978634 TTTTAAAGAAAAAAATAGTATGG + Intergenic
996662157 5:126017110-126017132 TTTGAAAGTAAAAATGAAGGTGG + Intergenic
996811716 5:127522930-127522952 ATTTAAAATAAAAATGAGGCTGG - Intronic
996827465 5:127701732-127701754 TTTTAAAGGAGAAATGGGAATGG + Intergenic
997041363 5:130258892-130258914 ATTTGAAGGAAAAATGAGAATGG + Intergenic
997051831 5:130391563-130391585 TGTTAATGCAAAAATTAGGAGGG + Intergenic
997084266 5:130778491-130778513 TTTAAAAAGAAAAAGGAGGAAGG + Intergenic
997113563 5:131101489-131101511 TTTCAAAGGCAAAATGAGGAAGG + Intergenic
997207345 5:132057481-132057503 TTTTGAAGGAAAGAGGGGGATGG - Intergenic
997420943 5:133766229-133766251 TTTTAAAACAGAAAAGAGGAAGG + Intergenic
997492307 5:134287746-134287768 TTTCAAAGGCAAAATTAGAAGGG - Intronic
997535532 5:134617941-134617963 TGTTAAAGAAAAAATGATCATGG - Intronic
997794193 5:136791759-136791781 TTTTATTGAAACAATGAGGATGG + Intergenic
998104663 5:139460820-139460842 TTTTGAGGAAAAAATGGGGAGGG - Intronic
998185178 5:139973839-139973861 TTTTAAATGAAACATGGGGCAGG + Intronic
998435498 5:142104788-142104810 TTTTAAAGGCAAAATGAGCAAGG - Intergenic
998446766 5:142204785-142204807 TTTTAACAGAAAAAAGAGAAGGG - Intergenic
998823718 5:146080274-146080296 TGTTAAGGGTAAAAAGAGGAAGG + Exonic
998990033 5:147805562-147805584 GATTAAAGGAAACATGAGGCTGG - Intergenic
1000080721 5:157843591-157843613 TTTTAAATGAAGAGTGAGAAGGG - Intronic
1000217282 5:159172924-159172946 TTTTAAAGTGACAATGAGCAAGG + Intronic
1000237123 5:159372373-159372395 CTTTATAGCAAAAGTGAGGAAGG + Intergenic
1000435466 5:161202464-161202486 GTTTAGAGGAAAAATGATAAAGG - Intergenic
1000465608 5:161572273-161572295 TATTTTAGGTAAAATGAGGATGG - Intronic
1000491050 5:161913983-161914005 CTTGAAAGGAAAAAAGATGAAGG + Intergenic
1000500419 5:162041607-162041629 GCATAAAGGAAAAATGATGATGG - Intergenic
1000933182 5:167277658-167277680 TTTAAGTGGAAAAATCAGGAAGG - Intergenic
1001060509 5:168484398-168484420 TTTAAAAGGAAAAAAGATAAAGG + Intergenic
1001186041 5:169573870-169573892 TTTTATAGGAACAAGAAGGAGGG - Intergenic
1001417355 5:171555418-171555440 TTATCAAGGCAAAATAAGGATGG - Intergenic
1001907627 5:175486171-175486193 ATTTAAAGGAAAAAAGTGGGGGG + Intronic
1002029927 5:176420391-176420413 TTTTAAAGGCAAAATGAGGAAGG - Intergenic
1002282069 5:178136904-178136926 TTTCAATGGTATAATGAGGAGGG + Intronic
1002628311 5:180549351-180549373 TTTTAAAGGATAAATTTGGCCGG + Intronic
1002692724 5:181061663-181061685 TTTGAAAGGGGGAATGAGGAAGG + Intergenic
1003742340 6:8955649-8955671 TTTTAAAGGCAATATATGGATGG + Intergenic
1003824605 6:9939239-9939261 TTTTAAAGGAAAAAAAATTAAGG + Intronic
1004158599 6:13193268-13193290 CTTTAAAGGAAAAACAAGGATGG - Intronic
1004163784 6:13237374-13237396 TTTTAAAAAAAAAATGAGATAGG + Intronic
1004459988 6:15826845-15826867 TTTTCAGGGAAAAATTATGAGGG - Intergenic
1005035988 6:21555271-21555293 TTTTAAAAAAAAAAAGAAGAAGG + Intergenic
1005281109 6:24275411-24275433 TTTTCCAGGAAAAATGAAAAAGG - Intronic
1005369532 6:25116865-25116887 TTTTTAAGGAAGAATAATGAAGG + Intergenic
1005584405 6:27261500-27261522 TTTTTAAGTAAAATTGAGTAAGG + Intergenic
1005731676 6:28703258-28703280 TTTTAAAGAAAAGTTGAGGAGGG + Intergenic
1005756118 6:28926211-28926233 TTTTAAATTAAAAAAAAGGAAGG - Intergenic
1005830084 6:29663712-29663734 TGTGAAAGGAAAAATGTGGGGGG + Intronic
1005905181 6:30256214-30256236 TTTTAAAGGGAAAGTAAGGTTGG + Intergenic
1006050168 6:31336070-31336092 TTTTAGATGACAAAGGAGGATGG + Intronic
1007014872 6:38455464-38455486 TATAAAAGGCAAAATGAGGCTGG - Intronic
1007103758 6:39269153-39269175 TTTTTAATGAAAAAAGAAGAAGG - Intergenic
1007483684 6:42166334-42166356 TTTTAAAGACAAAAGGAGGCCGG - Intronic
1007907798 6:45480733-45480755 TTTTAAAGGAATGAAGAAGAAGG - Intronic
1008025575 6:46632215-46632237 TTTTAAAGGAAAAAATGAGAAGG + Intronic
1008198139 6:48551606-48551628 TTTTAAAGGTAAAATGTAAAAGG + Intergenic
1008200392 6:48580769-48580791 ATTTAGAGAAAAAATGAGGAAGG + Intergenic
1008345149 6:50417414-50417436 TTTTAAAGCAGAAATAGGGAAGG + Intergenic
1008521690 6:52367726-52367748 GTGTAGAGGAAAGATGAGGATGG + Intronic
1008638856 6:53440566-53440588 TTTTAAAGGAAAGAAGGGGAAGG + Intergenic
1008723996 6:54393901-54393923 TTTCAAAGGAAAAAAAGGGAGGG + Intergenic
1008818679 6:55604082-55604104 TTTTAAAGAAAAAAAAGGGAAGG - Intergenic
1008869582 6:56256851-56256873 AGTTAAAGGAGAAATGAGCATGG + Intronic
1008948843 6:57132100-57132122 TTTTAAAGGGAAAAAGAGAAGGG + Intronic
1009420047 6:63455439-63455461 TTTTAAATGAAAAAAGAAGAGGG - Intergenic
1009672824 6:66778378-66778400 TCTTAAAGGAAAAAATAGCATGG - Intergenic
1009744131 6:67791311-67791333 TTCTAAAAGAAAAATAAGGCTGG + Intergenic
1009868234 6:69424595-69424617 TTTTTAAGGAAAAAAGAGCATGG + Intergenic
1009898548 6:69782916-69782938 TTTTAAAAGAAAAATGAAACTGG + Intronic
1009904623 6:69855102-69855124 TGTTAAAGGAAAATAAAGGAAGG - Intergenic
1009922602 6:70080975-70080997 TTTTCAAAGTAAAATGAGGATGG + Intronic
1010096255 6:72049735-72049757 TATTAAAGGATAATTAAGGAAGG + Intronic
1010098047 6:72070038-72070060 TATTAAAGGAAAAATTGGGAAGG - Intronic
1010119852 6:72362870-72362892 TTTGAATGAACAAATGAGGAGGG - Intronic
1010566670 6:77423589-77423611 TTCTAAAGCAAAAATACGGATGG + Intergenic
1011533450 6:88350797-88350819 TTTTTAAGAAAAAATCAGGGAGG + Intergenic
1011855514 6:91684642-91684664 TTTCAAAGCAAAAATAATGAAGG - Intergenic
1011992703 6:93543570-93543592 TTCTAGAGGAAAAATGAAAATGG - Intergenic
1012048786 6:94312622-94312644 TAGTAAAAGAAAAATGAGGCCGG + Intergenic
1012342933 6:98151114-98151136 AATTAAAGGGAAAAAGAGGAGGG + Intergenic
1012383733 6:98652666-98652688 TTTAAAAAAAAAAAAGAGGAAGG + Intergenic
1012389758 6:98724325-98724347 TTGTAAAGTAAAAATTAAGATGG - Intergenic
1012558755 6:100551439-100551461 TTTTAAAAGAAAAAGGAAGGAGG + Intronic
1013073202 6:106747788-106747810 TTTAAAAGAGAAAAGGAGGATGG + Intergenic
1013337405 6:109177739-109177761 TTTTAAAGGATATATGAGCTAGG - Intergenic
1013426178 6:110014983-110015005 TTTTAAAGAGAAAATGAATAGGG + Intergenic
1013777890 6:113699362-113699384 TTGTAAAGGAAAAATGAAGAGGG + Intergenic
1013998366 6:116336457-116336479 TTTTAAAGAAAAAAGTAGGCCGG + Intronic
1014536669 6:122621885-122621907 TATTAGAGGAAATATGGGGAGGG + Intronic
1014832273 6:126116703-126116725 TTTTAACTGTAAAATAAGGATGG + Intergenic
1015161831 6:130160809-130160831 TTTCAAATGTAAAATGTGGAAGG + Intronic
1015166010 6:130200731-130200753 TCTTTAAACAAAAATGAGGAGGG + Intronic
1015174206 6:130288619-130288641 TGTAAAAGGAGAAATGTGGATGG + Intronic
1015297310 6:131611063-131611085 TTATAAAGGAAATATGAAAATGG - Intronic
1015370599 6:132447573-132447595 TATTAAAGTAAAAATGTAGAGGG - Exonic
1015602552 6:134924502-134924524 TTTTAAAGGTAAAATGAGGAAGG - Intronic
1015698896 6:136012708-136012730 TTTTAGCTGAGAAATGAGGAAGG + Intronic
1015711366 6:136144928-136144950 TTTTAGTGGAAAAATGTGGAGGG - Intronic
1015842556 6:137489865-137489887 TTAGAAAGGGAAAATGAGGCCGG - Intergenic
1015844599 6:137507020-137507042 TGTTACAGAAAAAATAAGGAAGG + Intergenic
1015915814 6:138215454-138215476 TTTTAAAGGAGAAATGACAGGGG + Intronic
1016087514 6:139932585-139932607 TTGTTAAAAAAAAATGAGGAAGG - Intergenic
1016110293 6:140214937-140214959 TTCTAAAAGAAAAATGAAGTTGG - Intergenic
1016405875 6:143730103-143730125 TTTTAAATGAAGAATAAGGTTGG - Intronic
1016517128 6:144907524-144907546 TTTTAAAGTAAAAACTTGGAGGG - Intergenic
1016574178 6:145549279-145549301 TTTCAAACCAAAAATAAGGATGG - Intronic
1017569010 6:155722210-155722232 TTTTAAAGTAAAGATGAGGAGGG - Intergenic
1018255808 6:161917741-161917763 TTTTACAAGCAAAATGAGTATGG - Intronic
1018433007 6:163737609-163737631 TTTTCAAGGAAAAATGGACAGGG - Intergenic
1018920673 6:168170353-168170375 TTTTAAAGGAAAAATGAGGATGG - Intergenic
1019226634 6:170516560-170516582 TATTAAATTATAAATGAGGAGGG + Intergenic
1020089225 7:5328825-5328847 TATTAAAAGAAAAATTAGCAAGG + Intronic
1020320097 7:6933590-6933612 TTTTAAAACAAAAATGGGGCTGG + Intergenic
1020449418 7:8304595-8304617 TTTTAACTGAGAACTGAGGATGG - Intergenic
1020452976 7:8340884-8340906 TTTTGTAGGGAGAATGAGGATGG + Intergenic
1020574482 7:9908796-9908818 TTTTAAAAAATAAAGGAGGATGG - Intergenic
1020894067 7:13917666-13917688 TTTAAAAGAAAATATGAGGCCGG + Intronic
1021132503 7:16928191-16928213 TTAGAGAGGAAAAATGATGATGG - Intergenic
1021242687 7:18223836-18223858 TTTTAAAGACAAAATAAAGAGGG - Intronic
1021487728 7:21185350-21185372 TTTTACAGGTAAAATGAAAAAGG - Intergenic
1022322594 7:29301130-29301152 TTTTTAAGAAAAAATGACAAAGG - Intronic
1022561045 7:31349851-31349873 TTTAAAATAAAAATTGAGGAAGG + Intergenic
1022701528 7:32764611-32764633 TGTTAAAGGAAAAATGAAGCAGG + Intergenic
1022937025 7:35188368-35188390 TGTTAAAGGAAAAAAGAAGCAGG + Intergenic
1023378627 7:39584154-39584176 TTTTAAAAGAAAACTAAGGAAGG + Intronic
1023403229 7:39805916-39805938 TTTTAAAACAAAAATGGGGCTGG - Intergenic
1023628594 7:42140803-42140825 TTATACAAGAAAAAGGAGGAGGG + Intronic
1023705122 7:42932885-42932907 TTTTAAAGGGAGAATGAGCGAGG + Intronic
1023950334 7:44838983-44839005 TTTTAAAGGAGGAATAGGGATGG + Intronic
1024312302 7:47980229-47980251 TTTTAAAGGAAAAATTTTAAAGG + Intergenic
1024474089 7:49792288-49792310 TTTTATCTGTAAAATGAGGATGG - Intronic
1024542975 7:50494104-50494126 GTTTAAAGAAATAATGATGATGG - Intronic
1025010871 7:55397163-55397185 TTTAAAAAGCAAAATGAGGCTGG + Intronic
1025930247 7:65987800-65987822 ATTTAAAGGGAAAAAGAGGCCGG + Intergenic
1026064636 7:67059415-67059437 TTTTAAAGGAAAAATTGAGGAGG + Intronic
1026273465 7:68856551-68856573 GTTTAAAGGAAAAGGGATGATGG - Intergenic
1026421630 7:70243185-70243207 TTTTAAAGGAAAACTGATTATGG - Intronic
1026713665 7:72767290-72767312 TTTTAAAGGAAAAATTGAGGAGG - Intronic
1027649298 7:80845563-80845585 TTTTAGAGGTAAAATCAGCAAGG - Intronic
1027827917 7:83139682-83139704 ATTTAAAGGACAAAAGATGAGGG - Intronic
1027969318 7:85058061-85058083 TTTGAAAGGAAAAGAAAGGAGGG + Intronic
1028205999 7:88018219-88018241 TTTCAAAGGACAAAAAAGGAAGG - Intronic
1028227757 7:88268833-88268855 ACTTAAAGGATAAAGGAGGAGGG + Intergenic
1028241049 7:88421060-88421082 TATTGAAGGAAAGAAGAGGAAGG + Intergenic
1028252249 7:88550624-88550646 TTATGATGGAAAGATGAGGAAGG + Intergenic
1028373098 7:90117208-90117230 TGTTAAAGGAAAAAAGAAGCAGG - Intergenic
1028894193 7:96022564-96022586 TTTTAGAAGAAAAAAGAGGCTGG + Intronic
1029019725 7:97351806-97351828 TTTTACAGGAAAAGAGAGGGAGG + Intergenic
1029887369 7:103887544-103887566 ATTCAAAAGAAAAATGAGGTGGG + Intronic
1030189204 7:106793967-106793989 TTTTAAAGGGAAAATGGTGGGGG + Intergenic
1031075031 7:117203547-117203569 TTATACTGAAAAAATGAGGAGGG - Intronic
1031342557 7:120621648-120621670 TTTTAAATAAAAAATGAAGTAGG + Intronic
1031555551 7:123171062-123171084 TTTTCAAAGAAAGATGAGAAGGG + Intronic
1031647662 7:124246336-124246358 TTTTAAATGAAAGAGGAAGAAGG - Intergenic
1031708298 7:125010895-125010917 TATTAAAGTAAAAATGAAAAGGG - Intergenic
1031971717 7:128069389-128069411 CCTTAATGGTAAAATGAGGAGGG - Intronic
1032118903 7:129142191-129142213 TTTAAAAAGCAAAATGAGGCCGG - Intergenic
1032244523 7:130198313-130198335 TTTTAAAACAAAAATGGGTAGGG + Intronic
1032565615 7:132939687-132939709 TTGGAAAGGAAGAATGAAGAGGG + Intronic
1032585023 7:133138429-133138451 ATTTAAAAAAAAAATGAGGAAGG - Intergenic
1032635215 7:133699470-133699492 CTGTAAAGGCAAAATGAGGGAGG + Intronic
1032888129 7:136164220-136164242 TTTTAAAGAAAAAATGTTAATGG + Intergenic
1032955373 7:136964593-136964615 GTGCAAAGGAAAAAGGAGGAAGG - Intronic
1032969698 7:137146562-137146584 TTTTAAAGGTAAAAAGTTGAAGG + Intergenic
1033120980 7:138666143-138666165 TTTTAAAGACAAAATGAGGAAGG - Intronic
1033315910 7:140297392-140297414 TCTTAAAGGAAAGGGGAGGAGGG - Intronic
1033382821 7:140840346-140840368 TTTTAAAGTTTAAATGTGGATGG - Intronic
1033821342 7:145138275-145138297 TTAGAAAGGAAAAGTGAAGAGGG + Intergenic
1033867272 7:145706299-145706321 AGTTAAAGAGAAAATGAGGAAGG + Intergenic
1033936657 7:146593718-146593740 CTTCAAAGGAGAAATAAGGAGGG - Intronic
1034021677 7:147651014-147651036 ATTTGGAGGAAAGATGAGGAAGG + Intronic
1034074112 7:148215257-148215279 TTTTAAAGGAAAAAAGGAGGAGG + Intronic
1034384140 7:150724291-150724313 TCTTAAAGAAATAAAGAGGAGGG - Intronic
1034589958 7:152130673-152130695 TTATAAAGAAAAAACGGGGAAGG - Intergenic
1034606147 7:152317842-152317864 TTTTAAAAAGAAAAAGAGGATGG + Intronic
1034983462 7:155493006-155493028 TTAATGAGGAAAAATGAGGACGG + Intronic
1035720501 8:1787909-1787931 ATTTCAAGGAAAAAGGAGGCAGG - Intergenic
1036053613 8:5226869-5226891 TTTTAAAAGGAAAATGAAGAAGG - Intergenic
1036059166 8:5295674-5295696 GTGTAAAGGAAAAATCAGGCAGG + Intergenic
1036064168 8:5359109-5359131 TATGAAAGCAAAAATGGGGAGGG - Intergenic
1036181118 8:6586254-6586276 TTTTAAAGGAAGGATGAGCTGGG - Intronic
1036529038 8:9564929-9564951 TCTTCAAGAAAAAATGAGTAGGG + Intronic
1036731136 8:11265929-11265951 TTTTTGAAGAAAAATGAGGAGGG - Intergenic
1037893836 8:22638688-22638710 TTTTACAGTTGAAATGAGGAAGG - Intronic
1038249487 8:25889876-25889898 ATTTAAAGTAAAAAGGAGAAAGG + Intronic
1038299975 8:26335366-26335388 GTTTAAGGGAGAAAGGAGGAAGG + Intronic
1038358752 8:26856606-26856628 TTTAAAGGCAAAAATGGGGAGGG - Intronic
1038619459 8:29126338-29126360 TTTTAAAGTAAAACAGAGTAGGG - Intronic
1038783167 8:30586132-30586154 TGTTAAAGGAAAAGGGAGGAAGG - Intronic
1038799176 8:30733693-30733715 CTTTAAAAGAAAAATAAGGCTGG - Intronic
1039006423 8:33042920-33042942 TTTTAAAGGAAATTTAAAGATGG - Intergenic
1039027500 8:33273513-33273535 TTGTAAAAGCAAAATGAGAAAGG + Intergenic
1039230365 8:35439916-35439938 TTTTAAAGGTAAACTGAAGGAGG + Intronic
1039335787 8:36587771-36587793 TTTTAAAGGAAATTGTAGGAGGG + Intergenic
1039719513 8:40147815-40147837 TGTTAAAGCAAAAATGAACAGGG + Intergenic
1039727558 8:40235744-40235766 TTTAAAAAGAAAAATGATAATGG + Intergenic
1039767184 8:40641273-40641295 TTTTAAAAGAAAAGAGAAGATGG + Intronic
1040698284 8:50029357-50029379 TTTTAAAATAACAAAGAGGATGG - Intronic
1040986333 8:53297869-53297891 TTTTAAGGAAAAGATGAGGGTGG - Intergenic
1040997038 8:53412804-53412826 TTTTAATGGACACATGAGAAGGG - Intergenic
1041973657 8:63772795-63772817 CTTTTTAGGAAAAAAGAGGAAGG + Intergenic
1042277205 8:67018412-67018434 TCTTAAAAGAAAAAAGAGGTCGG - Intronic
1042320769 8:67473365-67473387 TTTAAAAGGACAAATTAGCATGG + Intronic
1042435675 8:68761824-68761846 TGTTAAAGAAAAAAGGAGGCAGG - Intronic
1042700215 8:71604347-71604369 TTTTAAAGGGAAAATAGGGGTGG - Intergenic
1042870746 8:73396701-73396723 TTTTAAAGTATATATGAGGACGG + Intergenic
1043032558 8:75155643-75155665 TTTTCTAGAAATAATGAGGATGG + Intergenic
1043058954 8:75475767-75475789 TTATAAATGAAAAATAAGGCTGG - Intronic
1043364295 8:79514099-79514121 ATTTAATACAAAAATGAGGAGGG + Intergenic
1043439843 8:80267392-80267414 ATTTAAAGAAAAAATTAGGCTGG + Intergenic
1043693803 8:83192640-83192662 TTATCAAGGTAAAATGATGATGG - Intergenic
1044877761 8:96688386-96688408 CATTAAAAGAAAAATGAGGTGGG - Intronic
1044962111 8:97541490-97541512 TTTAAAGGGAAAAATGGGAAAGG + Intergenic
1045402958 8:101836775-101836797 TTAAAAAGGCAAAATGAGGTTGG + Intronic
1045617726 8:103938054-103938076 TTTTAAAGAAAATATGAGACTGG - Intronic
1045641574 8:104257293-104257315 TCTCAGAGGAAAAATGTGGATGG - Intergenic
1045684519 8:104698623-104698645 ATTTAAAAGAAAGATGAGGCGGG + Intronic
1045827449 8:106415801-106415823 GTTAAAAGGAAAAAGGAAGAAGG - Intronic
1045866688 8:106874247-106874269 TTTTAAAATTAAAAAGAGGAAGG + Intergenic
1046437725 8:114215169-114215191 TTTAAAAGGAAAAATTAGGTTGG - Intergenic
1046526190 8:115384945-115384967 TTTAAAAGGAAGAAGGAGGTGGG + Intergenic
1046597498 8:116278076-116278098 TATTAAAAAAAAAAAGAGGAGGG + Intergenic
1046611718 8:116432954-116432976 TTTGAAAGAAAAAAAGAGGAGGG + Intergenic
1046792742 8:118339486-118339508 TTTTAACAGAGATATGAGGAAGG - Intronic
1047171301 8:122495642-122495664 TTTTAAAGCAAACCTGAGGCTGG + Intergenic
1047454070 8:124993069-124993091 TTTTATTGGGAAAGTGAGGAAGG - Intergenic
1047824718 8:128560775-128560797 TTTTAAAAGATAAATTTGGAAGG + Intergenic
1047872060 8:129094839-129094861 TTTTAAAGAAAAAATGAAAAAGG - Intergenic
1047976171 8:130132895-130132917 TTTCAAAGGAGAAATGATAAAGG - Intronic
1048127381 8:131651164-131651186 ATTCATATGAAAAATGAGGATGG + Intergenic
1048657484 8:136557234-136557256 TTTGAGAGGAAAAGTCAGGAGGG + Intergenic
1049025063 8:139982702-139982724 TTTTAAAGGAGAGATTAGGAAGG + Intronic
1049114253 8:140672382-140672404 TCTCCAAGGAAAATTGAGGAAGG - Intronic
1049457729 8:142702103-142702125 TTTTAAAGGGAAAAAAAGGCAGG - Intronic
1050636923 9:7622197-7622219 GTATAAAGGGAAAATGAGGCTGG - Intergenic
1050648633 9:7750498-7750520 TTTTAAAAGAAAAATAAAGTTGG + Intergenic
1050691586 9:8233504-8233526 TTTTAAAAGAAACATAAGAAAGG + Intergenic
1050716977 9:8540901-8540923 TTTTAAAGGCAAACTGTGGTAGG + Intronic
1050742476 9:8837796-8837818 TTTTAAAGGGAATATCAGGCTGG - Intronic
1050869547 9:10549939-10549961 GCTTAAAGGAAAGATGAGGATGG - Intronic
1050921020 9:11200910-11200932 ATTTAATGGAAAAATGGCGATGG + Intergenic
1052283789 9:26761932-26761954 TTTTCAAAGAAAACTTAGGAAGG + Intergenic
1052390170 9:27870211-27870233 TTTCAAAGGAAAAATTGGAAAGG - Intergenic
1052686846 9:31767440-31767462 TTATAACAGAAATATGAGGAAGG + Intergenic
1052801069 9:32968810-32968832 ATATGAAGGAAAAATGAAGAAGG + Intergenic
1053388276 9:37713171-37713193 TTTAAAAAGGATAATGAGGATGG + Intronic
1053571392 9:39312280-39312302 CTTTAAAGGAAAGAGGAGGTAGG + Intergenic
1053579833 9:39393101-39393123 TTTTAAAGAGAAAATGTGGTTGG + Intergenic
1053844347 9:42221178-42221200 TTTTAAAGAGAAAATGTGGTTGG + Intergenic
1054101420 9:60951910-60951932 TTTTAAAGAGAAAATGTGGTTGG + Intergenic
1054122793 9:61227273-61227295 TTTTAAAGAGAAAATGTGGTTGG + Intergenic
1054125753 9:61306732-61306754 CTTTAAAGGAAAGAGGAGGTAGG - Intergenic
1054340451 9:63856649-63856671 TTTTAAAAGAAAAAAAAGTATGG + Intergenic
1054584930 9:66954971-66954993 TTTTAAAGAGAAAATGTGGTTGG - Intergenic
1054830266 9:69617167-69617189 TCTTAAAGGAAAAGTGAGGAGGG - Intronic
1054859297 9:69932627-69932649 TCTTTAAGGAAAAAGGAGAATGG + Intergenic
1055001314 9:71452242-71452264 AATCAAAGGACAAATGAGGAGGG + Intergenic
1055471973 9:76620985-76621007 TTTTAAAGAAAAGATAAGGCAGG + Intronic
1055634462 9:78261546-78261568 CTTTAAAGGAGTAATGAGGAGGG + Intronic
1055725751 9:79226394-79226416 TTTTAAAAGGAGAAGGAGGAAGG - Intergenic
1055911658 9:81359779-81359801 TTTTAAAGAAAAACAGAGGCTGG - Intergenic
1055935466 9:81600460-81600482 TTTAAAAAGAAAAATGAGATGGG - Intronic
1056424090 9:86459025-86459047 TTTTCAAGGAAAAATTTTGAGGG - Intergenic
1056503325 9:87232345-87232367 TGTAAAAGGAAAAATGGAGAAGG + Intergenic
1056551321 9:87655365-87655387 TTTTAAAGGAAAGGTGATGGGGG + Intronic
1056598464 9:88027018-88027040 TTTTAAAGGAAAAATCATTTAGG - Intergenic
1056783048 9:89565594-89565616 TTTTAAAGGGAAGATGATGAGGG - Intergenic
1057010435 9:91596738-91596760 TTTTTAAGGAAAACTGGGAAGGG + Intronic
1057193189 9:93098551-93098573 TTTTACAGGACAAAGGAAGATGG - Intronic
1057622236 9:96646334-96646356 CTTTAAAGGAAACGTGATGACGG + Intronic
1057737152 9:97673778-97673800 TTGAAAATGAAAGATGAGGAAGG + Intergenic
1057739607 9:97700077-97700099 TGAAAAAGGAAAAATGAGGTTGG + Intergenic
1058007290 9:99930715-99930737 GAATAAAGCAAAAATGAGGAAGG - Intronic
1058328124 9:103723846-103723868 TTTTACAGAAAAAACTAGGAAGG + Intergenic
1058328498 9:103728121-103728143 TTTTAAAGAACAAAAGATGAGGG - Intergenic
1059932642 9:119276337-119276359 TATGAAAAGAAAAATCAGGAAGG - Intronic
1060761899 9:126260089-126260111 TTCAAGAGGAAAAATGAGAAAGG - Intergenic
1061005058 9:127924070-127924092 TTCTAAAGCAAAAATTAGGCTGG + Intronic
1061096471 9:128460005-128460027 TTCTAAAGAAAACATGAGCAAGG - Intronic
1061126298 9:128678362-128678384 TTTTAAAAAAAAAATTAGGCTGG - Intergenic
1061180190 9:129021005-129021027 TTTTTAAGTAAAAAAAAGGAAGG + Intronic
1061367383 9:130178934-130178956 TTTCAAAAAAAAAAAGAGGAGGG - Intronic
1061383104 9:130270876-130270898 CATTAAAGAAAAACTGAGGAAGG - Intergenic
1061686158 9:132281049-132281071 TATTTAAACAAAAATGAGGAGGG + Intronic
1062065171 9:134522784-134522806 ATTAAAATAAAAAATGAGGAAGG - Intergenic
1185583750 X:1230027-1230049 GTTTAAAGAAAAACTGAGCAGGG + Intergenic
1185584507 X:1235014-1235036 TCTTAAAGGAAAAATATGGCCGG - Intergenic
1185989764 X:4880557-4880579 TCTGAAAAGAAAAATGAGCATGG + Intergenic
1186441285 X:9588897-9588919 TTTAAAAATCAAAATGAGGACGG - Intronic
1186627662 X:11311838-11311860 TTTTAAGGGAAAAAAGTGGGGGG + Intronic
1187054178 X:15726031-15726053 TTTTAAAAGAGAAAAGAGGGTGG - Intronic
1187100642 X:16187796-16187818 TTTTAAAGCATAATTGAGTAAGG + Intergenic
1187166720 X:16811354-16811376 TCTTAAAAAAAAAATAAGGAAGG - Intronic
1187234015 X:17449700-17449722 ATTTAAAGGAAAAATCAGTCAGG + Intronic
1187328664 X:18315774-18315796 TTTTAAAGGCAAAACAAGGAAGG - Intronic
1187724084 X:22184252-22184274 TTTTAAAGGAAACATCTGGCTGG + Intronic
1187886749 X:23895873-23895895 TTTAAAAAAAAAAAAGAGGAAGG + Intronic
1188089745 X:25949699-25949721 CTTGAAAGGGAAATTGAGGAAGG - Intergenic
1188458447 X:30394592-30394614 TTTTACAGGTAAAATGAAGAGGG - Intergenic
1188612203 X:32114515-32114537 CTTGAAAGGACAAAAGAGGACGG - Intronic
1188617027 X:32169942-32169964 TTTTAAAAGAAAAAATAGCAAGG + Intronic
1188825600 X:34829756-34829778 TTTTAAATGAAAAAGAATGAAGG + Intergenic
1188941252 X:36240873-36240895 TTTAAAAGAAAAAATGGGGAGGG + Intronic
1189049240 X:37627053-37627075 TTCTATAGAAAAAATGAGGATGG + Intronic
1189150210 X:38698935-38698957 TTTTAAGGAAAAAAAGAGGCAGG + Intergenic
1189396888 X:40631039-40631061 TTTTAAAGCAAAAAAATGGAAGG - Intronic
1189439649 X:41023746-41023768 TTTAAAGGTAAAAATGAAGAAGG - Intergenic
1189439923 X:41026181-41026203 TTTTAAAGGCAAAAAGAAGGGGG + Intergenic
1190066302 X:47243980-47244002 TTTTGAATGCAAAATGAGGGGGG - Intronic
1190373847 X:49769392-49769414 GGTTGAGGGAAAAATGAGGATGG - Intergenic
1190594991 X:52043527-52043549 TCTTACAGGAACAAAGAGGAGGG - Intergenic
1190613833 X:52210546-52210568 TCTTACAGGAACAAAGAGGAGGG + Intergenic
1191007702 X:55728007-55728029 TTTTGAAAGAAAGATGGGGAGGG + Intronic
1191930792 X:66369140-66369162 TTTAAAAGCAACAATGATGATGG - Intergenic
1192076001 X:67997489-67997511 TTCTAAAAAAAAAATGAGGAGGG - Intergenic
1192315242 X:70046083-70046105 TTCTAAAGGAAATAAAAGGATGG + Intronic
1192487491 X:71541942-71541964 TTTTAATAGACAAAGGAGGAGGG - Intronic
1192699542 X:73453412-73453434 TTTTAAAGCAAAGATGAGGGTGG + Intronic
1192918354 X:75678873-75678895 TTAAAAAAGAAAAATGAAGAGGG + Intergenic
1192928164 X:75778125-75778147 TTTTAAAGGGAGAATGATGTTGG + Intergenic
1193731656 X:85109630-85109652 GTGTAAGTGAAAAATGAGGACGG - Intergenic
1193913182 X:87330137-87330159 TTTTCAGGGAAAAATGATGTTGG - Intergenic
1194135369 X:90134139-90134161 TTTTCAAGGGAGAATGAGGGAGG - Intergenic
1194152575 X:90343863-90343885 TTTTAAAGGAAAATGGAAGGAGG - Intergenic
1194333867 X:92620130-92620152 ATTTTAAGGAAAAATGCAGAGGG + Exonic
1194674585 X:96779201-96779223 TTTTAAAAGAAATATCAGCATGG + Intronic
1194821621 X:98514376-98514398 TTTCAATGGAAAAAAAAGGAGGG - Intergenic
1194842797 X:98764783-98764805 TTATAAAAGAAAAATATGGATGG + Intergenic
1194952825 X:100146756-100146778 TTATAAAGAAAAAAAGAGGGGGG + Intergenic
1195982159 X:110590845-110590867 TTTTAAAGAAAAAGGGAGGGGGG - Intergenic
1196362852 X:114887087-114887109 TTTTAAAGGAAAAAATCAGACGG + Intronic
1196461069 X:115931720-115931742 TTCAAAAAAAAAAATGAGGAGGG - Intergenic
1196798131 X:119518821-119518843 TTTTAAAGGAAAAATGGGCCAGG + Intergenic
1197017119 X:121638388-121638410 TTTTAAAGGAAAGAGATGGATGG - Intergenic
1197419126 X:126216216-126216238 GTTTTAAAGAAAATTGAGGATGG + Intergenic
1197843757 X:130778436-130778458 TTCTAAAGGAAAGCTGAGAATGG + Intronic
1197871600 X:131067398-131067420 GCTTAAAGGAAAGAAGAGGAGGG - Intronic
1197934043 X:131722368-131722390 ATTAAAAGGAAAAATAAGTACGG + Intergenic
1198087850 X:133297231-133297253 TTTTAAAAGAAAGGTGAGGGTGG + Intergenic
1198389945 X:136163587-136163609 TTTTGCAGGAAAAATGGGCAGGG + Intronic
1198699248 X:139380155-139380177 TTTAAAAGGAAAAATCAAAAAGG - Intergenic
1199168546 X:144707432-144707454 TTTAAAAGGGAAAATTAAGATGG - Intergenic
1199188318 X:144941068-144941090 TTTTAACTTAAAAATGAGGCTGG - Intergenic
1199221142 X:145316758-145316780 TCCAAAAGGAAAAATGATGAGGG - Intergenic
1199284043 X:146036695-146036717 TTTTAAAGGAAAACTCTGGTAGG - Intergenic
1199536573 X:148909071-148909093 TTTTAAAGGCCAAAGGAGAAAGG - Intronic
1199707809 X:150445872-150445894 TTCAATAAGAAAAATGAGGAAGG + Intronic
1200498922 Y:3920612-3920634 TTTTAAAGGAAAATGGAAGGAGG - Intergenic
1200642553 Y:5739132-5739154 ATTTTAAGGAAAAATGCAGAGGG + Intronic
1201056677 Y:10000449-10000471 TTTTCAAGGAAATATGAATATGG - Intergenic
1201057937 Y:10014618-10014640 TTTTAAAAGAGATATGAGGCAGG + Intergenic
1201590384 Y:15608521-15608543 GAAGAAAGGAAAAATGAGGATGG + Intergenic
1202103975 Y:21342122-21342144 TTTTCAAGGAAATATGAATATGG + Intergenic