ID: 996447831

View in Genome Browser
Species Human (GRCh38)
Location 5:123577208-123577230
Sequence TTGGAGAAAAGGACTGATTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 244
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 227}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996447831_996447834 0 Left 996447831 5:123577208-123577230 CCATAATCAGTCCTTTTCTCCAA 0: 1
1: 0
2: 2
3: 14
4: 227
Right 996447834 5:123577231-123577253 GAAGTTCTGAATCCTTTTATTGG 0: 1
1: 0
2: 6
3: 34
4: 260
996447831_996447837 28 Left 996447831 5:123577208-123577230 CCATAATCAGTCCTTTTCTCCAA 0: 1
1: 0
2: 2
3: 14
4: 227
Right 996447837 5:123577259-123577281 GGTATTTAGAAACCAAGATTTGG 0: 10
1: 62
2: 189
3: 306
4: 567
996447831_996447835 7 Left 996447831 5:123577208-123577230 CCATAATCAGTCCTTTTCTCCAA 0: 1
1: 0
2: 2
3: 14
4: 227
Right 996447835 5:123577238-123577260 TGAATCCTTTTATTGGATAATGG 0: 1
1: 0
2: 18
3: 130
4: 507

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996447831 Original CRISPR TTGGAGAAAAGGACTGATTA TGG (reversed) Intronic
902222922 1:14978203-14978225 TTGAAGAAAAGCTCTGATTCAGG - Intronic
903782350 1:25829146-25829168 TTAGAGAAAAGGACAAATTCAGG + Intronic
903862560 1:26373594-26373616 TTGGAGAATAGGATGGATCAAGG - Intronic
906021988 1:42637775-42637797 TTGAAGGCAAGGACTGATAAAGG - Intronic
907237888 1:53063842-53063864 TTGGTGATAGGGACTCATTAAGG - Intronic
907400076 1:54219696-54219718 TTAGAGAAAAGGACTAGCTAGGG - Intronic
908023064 1:59918041-59918063 TAGGAGATAAGGACTGATGGAGG - Intronic
908673213 1:66571949-66571971 TTGAAGAAAATGACTAATTCTGG - Intronic
909713490 1:78678816-78678838 GTGGAGAAAACGAGGGATTATGG - Intergenic
911415474 1:97566509-97566531 TTAGAGGAAGGGACTTATTAAGG - Intronic
911642902 1:100307782-100307804 TTTGTCAAAAGGACTGATAATGG - Intergenic
912363018 1:109110595-109110617 TTGGAGAATAGCACTGCCTAAGG - Intronic
914844141 1:151271723-151271745 TTGGAGATAATGACTGACTCAGG - Intergenic
915893889 1:159796058-159796080 TTTGAGAAGAGGAATGAGTAGGG + Intergenic
916808454 1:168283234-168283256 TTGTAGAAAAAGTCTGATTGCGG + Intronic
917855805 1:179098451-179098473 TGGGAGAAAAGGACTGAAGGTGG + Intergenic
919192426 1:194239951-194239973 TTGGAGATAATGACAGATTTAGG - Intergenic
919378076 1:196818556-196818578 TTGGAGAAAGGGACAGCCTAAGG - Intergenic
919387763 1:196942594-196942616 TTGGAGAAAGGGACAGCCTAAGG - Intronic
919941350 1:202288707-202288729 TTGGAGAAATGGCCTGGATATGG + Intronic
920348130 1:205319787-205319809 TTGGAGAAAGGGGTAGATTATGG - Intronic
921916360 1:220615224-220615246 TTGGAGAAAAGGACTAAACAAGG - Intronic
923143304 1:231179834-231179856 TTGGGGAGAAGGACGGTTTAAGG + Intronic
924587103 1:245369627-245369649 TTAGAGAAATGGACTGATTGTGG + Intronic
1064417962 10:15167678-15167700 TTGGAGAAAAGGATTGCTTCAGG - Intronic
1069151172 10:64962177-64962199 TTGGAGAACAGGTCTTATTTCGG - Intergenic
1070075539 10:73131177-73131199 TTAGAGAAAATGACTGAACAAGG - Exonic
1072062586 10:91829690-91829712 TTAGAGTAAAGGAATGATTTTGG + Intronic
1072353680 10:94584480-94584502 TTGGAGTAAATGACTTATTTAGG + Intronic
1074064943 10:110006187-110006209 TGTGAGAAAAGGAATGATCATGG + Intronic
1079620162 11:22544115-22544137 ATGGAGAAAAGGGAAGATTACGG - Intergenic
1080794109 11:35547530-35547552 TTGGGGGAAAGGACTGATTCTGG + Intergenic
1085050079 11:73375914-73375936 TTGGCGAAAAGGCCTGGTGAAGG - Intergenic
1085429211 11:76432451-76432473 TTTGAGAAAATGACTGATGCAGG - Intergenic
1086846721 11:91759139-91759161 TTGGATAATAATACTGATTATGG - Intergenic
1088401739 11:109428876-109428898 TTGGAGACAATGACTTATCAAGG + Exonic
1088741815 11:112773790-112773812 TTGGAGATAAGGAGTGATGATGG + Intergenic
1089342428 11:117767354-117767376 ATGGAGAAAAGCACTTATCACGG + Intronic
1089767371 11:120777634-120777656 ATGGACAAAAGGACAGAATAGGG + Intronic
1091158493 11:133397051-133397073 TTTGAGAAAAGCATTGATTCTGG + Intronic
1093590745 12:20899347-20899369 TTGGTGCAGAGGACTGATTATGG + Intronic
1093604599 12:21074484-21074506 TTGGTGCAGAGGACTGATTATGG + Intronic
1098489307 12:71056666-71056688 TTGGAGAAATGAACTTAATAAGG + Intronic
1099153395 12:79144090-79144112 TTGGAGGAAATGACAGATCAAGG - Intronic
1099330415 12:81278138-81278160 ATGGAGAAAAGGGCATATTAAGG + Intronic
1099426396 12:82529007-82529029 GTGGATATAAGGAATGATTAAGG - Intergenic
1100830568 12:98513330-98513352 GTGATGAAAAGGACTGATCAGGG + Intergenic
1106024674 13:25945715-25945737 TTGGAGAAAATGTCTCATCAAGG + Intronic
1106045684 13:26139164-26139186 TTGGAGAAATGGAGTGGTTGGGG - Intronic
1106789777 13:33142919-33142941 TTGGAGTAAAGAAGTGATTAAGG + Intronic
1107315954 13:39132262-39132284 TAGGAGAAAATGACTTTTTAAGG + Intergenic
1108548320 13:51518680-51518702 TTGGAGAAAAAGGCAGATTGAGG - Intergenic
1108557509 13:51609365-51609387 TTTGTGAAAAGGGCTGATTAGGG + Intronic
1109255199 13:60071892-60071914 TTGTAGAAAAGGAGTCACTAGGG - Intronic
1109535837 13:63718187-63718209 TTGGAGAGAAGCACTAAATATGG + Intergenic
1109540264 13:63768099-63768121 TTGGAGAGAAGCACTAAATATGG - Intergenic
1111283637 13:86061157-86061179 TAGGAGAAAAAGACTCTTTAGGG - Intergenic
1112211059 13:97377531-97377553 TTGGAGAAAAGGAGGGAATTAGG - Intronic
1112782935 13:102921735-102921757 TTGGATAAAAGGAATAATTCAGG + Intergenic
1112911966 13:104496904-104496926 TTCTAGAAAAAGACTAATTATGG + Intergenic
1113156494 13:107328648-107328670 ATGGATAAAAGGATTGATTGAGG - Intronic
1115346357 14:32347178-32347200 TTGGAGACAAGGACAGATTAGGG + Intronic
1115664418 14:35532929-35532951 TTGGAGAAAAAGACTGACAGAGG - Intergenic
1115778438 14:36742111-36742133 TTGGAGAAAATGACTGATTTGGG - Intronic
1117014592 14:51505721-51505743 TTAGAGAAAAGGTGTGAGTATGG - Intronic
1117268024 14:54111107-54111129 TTTGAGAAAATGATTGATTTTGG - Intergenic
1117375977 14:55118536-55118558 TTAGAGAAAAGGTCTTAGTAAGG - Intergenic
1117746453 14:58874528-58874550 TTGGATAAAAGTACTGTCTAAGG + Intergenic
1119753819 14:77099367-77099389 TTGGAGAAATGGAATGAATGTGG + Intronic
1120735134 14:88044312-88044334 TTGGAGATATGGTCTGATTGAGG + Intergenic
1122462136 14:101904579-101904601 TTGCAGAAAAGGAGTGAGTTAGG - Intronic
1123998092 15:25733058-25733080 TTGGAGAACAGAACTGAGTTTGG - Intronic
1125217053 15:37287090-37287112 TAGGAGAAAAGGAAGGATTCAGG + Intergenic
1126257913 15:46649913-46649935 AGGGAGAAAAGCACTGGTTATGG - Intergenic
1126373482 15:47971288-47971310 GTGGACTAATGGACTGATTATGG + Intergenic
1126603266 15:50450355-50450377 TTGGAAAAAAAAACTGATTCTGG + Intronic
1127276958 15:57454684-57454706 CAGGAGAAAAGGTCTGAATAGGG - Intronic
1127644141 15:60943559-60943581 TTGGAGAATAGAACTGAATGCGG - Intronic
1128072896 15:64808257-64808279 TTTGAAAAAAGGACTGAACATGG - Intergenic
1128920280 15:71603931-71603953 ATGGAGAGAAGAACTGAATATGG + Intronic
1130021328 15:80234212-80234234 TTGGGGATACGGATTGATTATGG + Intergenic
1133187173 16:4108339-4108361 ATGAAGAAACGGTCTGATTAAGG - Intronic
1137222529 16:46470286-46470308 TTGGAGAAGAGTGCTGATTTGGG - Intergenic
1137762407 16:50951012-50951034 TTGTAGAAGGGGCCTGATTAGGG + Intergenic
1137857766 16:51813219-51813241 TTGCAGAAAATGTCTGATAATGG - Intergenic
1144552734 17:16255734-16255756 TTGGAGAAAAGGACTGCAGGAGG - Intronic
1146643964 17:34564066-34564088 TTGGAGGAAAGGAGTGAGTAGGG + Intergenic
1147488661 17:40843261-40843283 TTAGATAAAAGGAAAGATTATGG + Intergenic
1147992636 17:44344408-44344430 TTGGAGAATAGGGCAGAATAGGG + Intergenic
1148155224 17:45420652-45420674 TTTTAAAAAAGGACTGATTTTGG + Intronic
1149127362 17:53251849-53251871 TTGGAGCACATGACTTATTATGG - Intergenic
1151151229 17:72089111-72089133 TTGAAGACAGGGACTGATTTTGG - Intergenic
1153267613 18:3286428-3286450 TTGGAGGAAAGGCCTGGTTGGGG - Intergenic
1157634616 18:49138930-49138952 TAGGAGAAAAGGCCTAATTGTGG + Intronic
1157986000 18:52437973-52437995 TTTGTGAAAAGGAGTGAATAGGG - Intronic
1158751631 18:60268156-60268178 ATGGTGAAAAGGAATAATTAGGG - Intergenic
1159067877 18:63589798-63589820 CTGGGGAAAAGGACTGAGAAAGG + Intronic
1159597959 18:70401533-70401555 TTGAATCAAAGGACTGAGTAAGG + Intergenic
1165767828 19:38361959-38361981 TTGGAGAACAGGACTGGTGGTGG + Intronic
1166496122 19:43304504-43304526 CTGGAGAAAGGGACTGATAGGGG + Intergenic
1202646636 1_KI270706v1_random:148026-148048 TTGGAGAAATGCACAGATTCTGG - Intergenic
926310944 2:11675863-11675885 TTGGAGTAAGGGAGTAATTAAGG + Intergenic
927318868 2:21719797-21719819 GTGGGCAAAAGGACTGAATAGGG - Intergenic
928012283 2:27621059-27621081 ATGGAAAAAAGGCATGATTAGGG - Intronic
928721942 2:34131150-34131172 CTGGTGAAAAGGACCGAATATGG - Intergenic
929435264 2:41923956-41923978 CAGGAGAAAAGGGCTGATTCAGG + Intergenic
929887835 2:45894250-45894272 TTGGGGATAGGGAGTGATTAAGG + Intronic
931028881 2:58147661-58147683 TGGGGGAAGAGGACTGACTAGGG - Intronic
931142836 2:59482549-59482571 ATGGAGAAGAGGAAAGATTATGG + Intergenic
933406587 2:81867480-81867502 TTGAAGGAATAGACTGATTACGG - Intergenic
933509624 2:83223495-83223517 GTCGAGAAAAGGATTGGTTAAGG - Intergenic
934510016 2:94930425-94930447 TGGGAGAAATGCACTGATTCTGG - Intergenic
935708202 2:105874358-105874380 ATGGAGATAAGATCTGATTATGG - Intronic
939684379 2:145180548-145180570 TTGGATGAAAATACTGATTATGG + Intergenic
939933772 2:148263234-148263256 ATAGAGAAAAGGACTAATCAGGG + Intronic
939944859 2:148397169-148397191 AGATAGAAAAGGACTGATTAAGG + Intronic
940277842 2:151958044-151958066 TTTGAGAAAGGGACGGAGTATGG + Intronic
940419514 2:153463301-153463323 TTTGAGAAAAACACTGAATATGG - Intergenic
941311777 2:163941606-163941628 TAGAAAAAAAGGACAGATTAAGG + Intergenic
943842166 2:192597505-192597527 TGGTAGAACAGTACTGATTAAGG - Intergenic
946851965 2:223916563-223916585 CTGAAGAAAATCACTGATTAAGG + Intronic
948862660 2:240760404-240760426 TCGGAGGAAAGGACAGATGAGGG - Intronic
1169010671 20:2247498-2247520 TTTGAGAAAAGGAAGGATGAAGG - Intergenic
1173058962 20:39643746-39643768 TTCAAGAAAAGGAATGATGATGG + Intergenic
1173283533 20:41650157-41650179 CAGAAGAAAAGGACTGATGAGGG - Intergenic
1175088438 20:56481410-56481432 TTGGAGAGAAGTACAGTTTAGGG + Intronic
1175489208 20:59367687-59367709 CTGGGGGAAAGGCCTGATTAGGG + Intergenic
1176729658 21:10480553-10480575 TTGGAGAAAAGCACTGGGAAAGG + Intergenic
1177040962 21:16110226-16110248 TTGGATATAAGGACTGTTTTAGG + Intergenic
1177444896 21:21181695-21181717 TTTCAGAAAAGAACTGAGTAAGG - Intronic
1182039527 22:27225709-27225731 TTGGAGAAATGGATGGTTTAAGG - Intergenic
1183113420 22:35669919-35669941 AGGGAGAAAAGCACTGCTTATGG - Intergenic
950831983 3:15883903-15883925 TAGAAAAAAAGGCCTGATTATGG - Intergenic
952055063 3:29434313-29434335 TTGGAGAAAAGGAGGGAACAAGG + Intronic
955695168 3:61628685-61628707 TTGGGGAAAAGGTGTGGTTAAGG + Intronic
956185118 3:66555117-66555139 TTGGAGAGAAGTAGTGATAAAGG + Intergenic
956823390 3:72973790-72973812 GTGGTGAAAAGGACAGATTCAGG + Intronic
957134316 3:76265196-76265218 TTGGTGAAGAGGACTGACTGAGG - Intronic
957571435 3:81951568-81951590 TTGCAGAAAAAGAATGTTTAAGG + Intergenic
958453180 3:94298859-94298881 TTGGTGAGAAGGACTGGTTATGG - Intergenic
959610046 3:108283443-108283465 TAGGAGAAAAGAACAGATGAAGG + Intergenic
959962415 3:112313775-112313797 TTGGAGAGAAGGACTGAGAGTGG + Intergenic
961960673 3:130851457-130851479 TTGGCTAAAAAGACTGAATATGG - Intronic
963277872 3:143350845-143350867 CTGGAGTAAAGGCCAGATTACGG - Intronic
963451564 3:145488466-145488488 CTGGAGAAAAGATCAGATTAAGG - Intergenic
963874834 3:150463365-150463387 TGGGAGAAAAGGTCTGGTTTTGG - Exonic
964434635 3:156638660-156638682 TGGGAGCAAAAGCCTGATTAGGG - Intergenic
965949626 3:174291784-174291806 ATGGATATAAGGACTGATAATGG + Intergenic
967352953 3:188534270-188534292 TTGGAGCCAAGGACTCATCAAGG - Intronic
968160225 3:196420689-196420711 ATGGAGAGAAGGACAGATAAAGG - Intronic
970830175 4:20329014-20329036 CTGGAGAATAGGACAGAATATGG + Intronic
971884967 4:32432578-32432600 TTGGAGGAAAGAACACATTATGG - Intergenic
975184546 4:71385975-71385997 TTGTATAAAAGGACAAATTAAGG + Intronic
975215015 4:71743063-71743085 TTGAAGAAAAAGATTGATCAAGG + Intronic
975222970 4:71835099-71835121 TAGGAGAAAAGGATTGTTAAAGG - Intergenic
975843076 4:78497181-78497203 TAGGAGATATGGACTGATTGTGG + Intronic
977023290 4:91784428-91784450 ATGGAGAGAAAGACTTATTAAGG + Intergenic
979114330 4:116802056-116802078 TTGGATGGAAGCACTGATTATGG - Intergenic
979589127 4:122458189-122458211 ATGAAGAAAAGGTCAGATTAGGG + Intergenic
981584423 4:146285829-146285851 GTGGTGAAAAGGACTGAATTTGG + Intronic
981584460 4:146286137-146286159 TTGGTGAGAAGGACTGAGTTTGG + Intronic
983318192 4:166159906-166159928 AGGGAGAAAGGGACAGATTATGG + Intergenic
983466770 4:168103131-168103153 TTGGTGAAAAGCACTGTTAAAGG - Intronic
983839517 4:172439243-172439265 TTGGAGCAAAAGCCTGATTGGGG - Intronic
984053769 4:174900144-174900166 TTGAAAAAAATGAATGATTAAGG - Intronic
986067074 5:4245210-4245232 ATGGAGGAAAGGACAGATGAAGG - Intergenic
986863432 5:11954608-11954630 TTTGATAAAAGGTATGATTATGG + Intergenic
988112410 5:26839829-26839851 TTGGACACAAGGCCTGATTCTGG - Intergenic
989280002 5:39630042-39630064 TAGGAGAAAATGACAGATTTAGG - Intergenic
991381050 5:66027957-66027979 TTAGAGAAAAGAACACATTAAGG - Intronic
993145558 5:84089295-84089317 TTGGAGAAAAATCCTGATAAGGG - Intronic
993321576 5:86475270-86475292 TTGGGGAAAATGACTGAATTAGG - Intergenic
993919445 5:93782136-93782158 TTGGAGAAGATCACTGAATAGGG + Intronic
995221572 5:109654503-109654525 TTGGACCAAAGGACTGTTTCTGG - Intergenic
996029535 5:118689564-118689586 AGGGAGAAAGGGACTGATTTAGG + Intergenic
996447831 5:123577208-123577230 TTGGAGAAAAGGACTGATTATGG - Intronic
996524482 5:124463518-124463540 TTGCAGCAAAGGACAGAGTAGGG - Intergenic
1000216465 5:159161978-159162000 TTGTAGAACAGGAATGACTATGG - Intronic
1000904688 5:166950578-166950600 ATGGAGACAGGGACAGATTAAGG + Intergenic
1000939136 5:167338945-167338967 TTGGAAATAGGGAATGATTAAGG - Intronic
1001203378 5:169739407-169739429 TTGGAGAAATGGACTGTTGTAGG + Intronic
1002272757 5:178083554-178083576 ATGTAGAAAAGGGCTGATAAGGG + Intergenic
1002951523 6:1817283-1817305 TTGGAGAAAACAAATCATTAAGG - Intronic
1003768167 6:9264592-9264614 TTGGAGAAAAAGATTGTATACGG + Intergenic
1006510282 6:34517644-34517666 TTGGAGCAAAGGCCTGAGGAAGG - Intronic
1008075876 6:47145916-47145938 TGAGAGAAAAGGAGTGATTGGGG + Intergenic
1009730669 6:67600816-67600838 TAGTGGAAAAGGTCTGATTAAGG - Intergenic
1009848155 6:69160479-69160501 TTTGAGAAAAGTCCTGATTTAGG - Intronic
1009879332 6:69545647-69545669 TTGTAGAGAATGACTCATTATGG - Intergenic
1011454371 6:87531532-87531554 TTGGTAAAAAGGACTGCTTTTGG + Intronic
1011490291 6:87884566-87884588 TTGGAGAAAAGGCAGGATGAAGG + Intergenic
1011813570 6:91161403-91161425 TTAGAGAAAAAGACAGATGACGG - Intergenic
1013073937 6:106754002-106754024 GTGGAGAAAAGGGCTAATTTAGG + Intergenic
1013105014 6:107019722-107019744 GGGGAGAAAAGGACTGATACGGG - Intergenic
1014293352 6:119587443-119587465 TTAGAAAAAAGGACTCATTGAGG - Intergenic
1016433654 6:144013105-144013127 TTAGAGAAAAAGTGTGATTATGG - Intronic
1020705322 7:11537018-11537040 CTGGAGAATAGGACTCATTGTGG - Intronic
1020768267 7:12353356-12353378 TTGGAGAAAGGAAGTAATTAAGG - Intronic
1021875983 7:25049733-25049755 TTAGAGAAAAGGAGTCAGTATGG - Intergenic
1022362310 7:29673640-29673662 GTGGACAAAAGGAGTTATTAAGG + Intergenic
1022428974 7:30296667-30296689 GTGGACAAAAGGAGTTATTAAGG - Intronic
1022699085 7:32740105-32740127 GTGGACAAAAGGAGTTATTAAGG - Intergenic
1025967179 7:66284893-66284915 TGGAAGAAAAGAAATGATTAAGG - Intronic
1027847546 7:83401481-83401503 TTGGAGGAAGCGACTGGTTATGG - Intronic
1028044751 7:86104205-86104227 TTGGAGAAATGTATTGATTTTGG - Intergenic
1029151355 7:98482855-98482877 TGGGAGGAAAGGGCTGAGTACGG - Intergenic
1031140802 7:117941053-117941075 TTGGATAAAAGGACTTATTCAGG - Intergenic
1032963915 7:137073368-137073390 ATGGACAAAAGGACAGATTCAGG + Intergenic
1033918431 7:146357324-146357346 TTAGAAAAAAGCAATGATTAGGG - Intronic
1038220057 8:25599034-25599056 TTGGAGAAATTAACTAATTATGG - Intergenic
1040859609 8:51985259-51985281 TTGGAAAAAACAACTCATTAAGG - Intergenic
1041688795 8:60669286-60669308 TTGGGGAAAAGCATTGATCAGGG + Intergenic
1042060717 8:64814188-64814210 TTTGAGAAATGCACTGATGAGGG - Intergenic
1045006506 8:97920888-97920910 TCTGAGACCAGGACTGATTAGGG + Intronic
1045262666 8:100590407-100590429 TTGGAGACAAGGACTTGCTATGG - Intronic
1050204489 9:3182354-3182376 TTGAAGAAAAGGTCCGTTTATGG - Intergenic
1050606014 9:7301917-7301939 TTGGGAACAAGGACTGATAAAGG + Intergenic
1053055471 9:34990975-34990997 TTTGAGAAAAGGAATGATAAGGG - Intronic
1053146298 9:35714423-35714445 TTGGGTACAAGGACTGATGATGG + Intronic
1053655376 9:40213861-40213883 TGGGAGAAATGCACTGATTCTGG + Intergenic
1053905755 9:42843085-42843107 TGGGAGAAATGCACTGATTCTGG + Intergenic
1054367493 9:64360074-64360096 TGGGAGAAATGCACTGATTCTGG + Intergenic
1054675118 9:67849813-67849835 TGGGAGAAATGCACTGATTCTGG + Intergenic
1057372337 9:94485422-94485444 TGGGAGAAATGCACTGATTCTGG + Intergenic
1057411597 9:94820947-94820969 TTGCTGAAAAGGAGTCATTACGG - Intronic
1057693826 9:97309896-97309918 TGGCAGAAAAGCTCTGATTAAGG + Intronic
1058007913 9:99939210-99939232 TAGGAGAAAAGAAACGATTAAGG + Intronic
1058652847 9:107193271-107193293 TTGGAGAAAGGAAGTAATTAAGG + Intergenic
1058672987 9:107376407-107376429 TTGGAGTAAAGGACAGAAAAAGG + Intergenic
1059018556 9:110548146-110548168 TTGGAGAAAAGGAGAAATAAAGG + Intronic
1059851909 9:118351292-118351314 TTGTGGAAAAGAACTGCTTAGGG + Intergenic
1060121430 9:120994025-120994047 TGGGAGAAAAGGGCTTATCAGGG + Intronic
1186397302 X:9222845-9222867 TGGGAGAAAGTGACTGATGATGG - Intergenic
1186795165 X:13040175-13040197 TTGGAGAAAAAGATTGTTTCTGG - Intronic
1187138790 X:16573615-16573637 TTGGAAAAAAGGAAAGATAATGG + Intergenic
1188147627 X:26633101-26633123 TTGGAGAAAAGGATATAATAGGG + Intergenic
1190746582 X:53326810-53326832 TGGGAGAAAAGGTCTGCTCACGG - Intergenic
1191811913 X:65197944-65197966 TTGGAGAAAAAGAGTGAACAGGG - Intergenic
1192984387 X:76380785-76380807 TTGGAGAAAAGGAGGCATTCTGG - Intergenic
1193476153 X:81968577-81968599 TTTGAGAAAAGGAGTGCTTAAGG + Intergenic
1197271590 X:124430135-124430157 TTGGATAAAAGGATATATTAAGG - Intronic
1197427572 X:126316833-126316855 TTGGAGAAAATGACCCTTTAGGG + Intergenic
1198219010 X:134582689-134582711 TTGGAGATAAGAAGTGATTTGGG + Intronic
1202049234 Y:20763525-20763547 TGGGAGAAAAGGAAAGATTTTGG + Intronic