ID: 996449341

View in Genome Browser
Species Human (GRCh38)
Location 5:123601495-123601517
Sequence GCTTCCTTCTGGTCTGGTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 203}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996449338_996449341 7 Left 996449338 5:123601465-123601487 CCTGGAAAAATTACATTAAAGGA 0: 1
1: 0
2: 1
3: 27
4: 356
Right 996449341 5:123601495-123601517 GCTTCCTTCTGGTCTGGTTCTGG 0: 1
1: 0
2: 0
3: 15
4: 203
996449336_996449341 8 Left 996449336 5:123601464-123601486 CCCTGGAAAAATTACATTAAAGG 0: 1
1: 0
2: 2
3: 36
4: 421
Right 996449341 5:123601495-123601517 GCTTCCTTCTGGTCTGGTTCTGG 0: 1
1: 0
2: 0
3: 15
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996449341 Original CRISPR GCTTCCTTCTGGTCTGGTTC TGG Intronic
902186067 1:14726368-14726390 GCTTCCTTCTGGTGGGGAACAGG - Intronic
903847131 1:26285267-26285289 GCTGCCTGCTGCTCTGTTTCGGG + Intronic
906762701 1:48390881-48390903 GCTGATTTCTGGTATGGTTCAGG - Intronic
910097963 1:83545916-83545938 CCTTCCTTCTTGTCTGATTTTGG + Intergenic
911598330 1:99821995-99822017 GCTTAGTACTGGTCTGGTTAGGG - Intergenic
914245568 1:145883407-145883429 GCTCTCTTCTGGTCTACTTCTGG + Intronic
915633374 1:157169365-157169387 ACTTCCTTACGTTCTGGTTCTGG + Intergenic
915739621 1:158108881-158108903 GCTAGCTTCTGCTCTGCTTCTGG + Intergenic
915922236 1:159985071-159985093 ACTTCCTTCTGTCCTGGTGCAGG - Intergenic
919149009 1:193671349-193671371 CCTTCCTTCTGGTCTTGTGAAGG + Intergenic
921308641 1:213821364-213821386 GCTTCCTTCTGGGCTTGCCCTGG - Intergenic
922843642 1:228665423-228665445 GGCTCCTACTGCTCTGGTTCTGG + Intergenic
1063148763 10:3318929-3318951 GCTTCCTTCTGGTGGGTTTGTGG + Intergenic
1064367882 10:14724670-14724692 TTTTCCTTCTGGGATGGTTCTGG - Intronic
1066793990 10:39098385-39098407 GCTTCTTTCTGGTTTTTTTCTGG - Intergenic
1067779802 10:49192130-49192152 GCTTTCTTCTTGCCTGGTTTGGG - Intergenic
1069090676 10:64196215-64196237 TCTTCCTTCTGGTGGGTTTCTGG + Intergenic
1073421034 10:103423826-103423848 GCTGACTTCTGTTCTGGTTCCGG + Intronic
1074881877 10:117666033-117666055 GCTGCCATCTGCTCTGCTTCTGG + Intergenic
1075654441 10:124152067-124152089 GCCTCTTTCTTGCCTGGTTCTGG - Intergenic
1079466049 11:20732064-20732086 GCTTTCTGCTGGGCTTGTTCAGG + Intronic
1079898743 11:26154620-26154642 GCTTGCTTCTTCTCTGCTTCTGG + Intergenic
1080141235 11:28922805-28922827 GCTTCCCCCTTATCTGGTTCTGG + Intergenic
1082291733 11:50383531-50383553 GCTTCCTTCTAGTTTTGCTCTGG - Intergenic
1082300710 11:50501575-50501597 GCTTCCTTCTAGTTTTGTCCTGG + Intergenic
1084391838 11:68882459-68882481 GCTTCCTTCTTTTCTTCTTCCGG - Intergenic
1086054345 11:82629360-82629382 GGTTCCTTCTGGTGTGTTTGTGG - Intergenic
1090408857 11:126493843-126493865 CCTTCCTTCAAGGCTGGTTCTGG + Intronic
1092000903 12:5031425-5031447 GCTGTCTTCAGGTCTGATTCTGG - Intergenic
1092103709 12:5905755-5905777 CCTTCCTTCTTTTCTAGTTCTGG - Intronic
1092127779 12:6087156-6087178 GGTTTCTCCTGGTCTGGCTCAGG - Intronic
1092382931 12:8012584-8012606 GCTTCCTTCTTGGTTGGTACAGG + Intergenic
1093973115 12:25392425-25392447 TCTTCCTTCTGGTGGGTTTCTGG - Intergenic
1094860086 12:34454745-34454767 GCTTCCTTCTAGTTTTGTCCTGG + Intergenic
1096494631 12:52032965-52032987 GCTTCCTTCGGGTCTGCTGCAGG - Intronic
1096652977 12:53071207-53071229 GCCTCCCTCTGGGCTGGGTCTGG + Intronic
1097156911 12:57018632-57018654 CCTTCCTTCTGGTGTGGGGCAGG - Intronic
1102347095 12:112167357-112167379 GCTTCCTGCAGGTCTTGCTCAGG + Exonic
1102677807 12:114669876-114669898 GCTTACTTTTGGTCGGATTCGGG + Intergenic
1105884724 13:24631954-24631976 CCTCCCTTCGGGTCTGGATCAGG + Intergenic
1107213600 13:37888628-37888650 GCTCCCATCTGGGATGGTTCTGG + Intergenic
1108713877 13:53059925-53059947 CCTTGCTTTTGGTCTGGTTTTGG + Intergenic
1110369048 13:74719513-74719535 TCTTCCTTCTGGTGTGTTTGTGG - Intergenic
1113465603 13:110510765-110510787 GCTCCCTTCTGACCTCGTTCTGG + Intronic
1113556010 13:111235156-111235178 GTTACCTTCTGTTATGGTTCAGG + Intronic
1114557322 14:23569610-23569632 GCTACTTCCTGGCCTGGTTCTGG - Exonic
1114567942 14:23646159-23646181 TCCTCCCTCTGGACTGGTTCAGG - Intergenic
1115095988 14:29636305-29636327 GCGTCCTCGTGGTCTGGGTCTGG + Exonic
1115642606 14:35344270-35344292 GCTGCCCTCTGTTCTGGTTCTGG + Intergenic
1120907586 14:89633750-89633772 GCTCCATCCTGGTCTAGTTCTGG - Intronic
1121862861 14:97336005-97336027 GCATCCTTCTGTCCTGGTCCTGG - Intergenic
1123927237 15:25128365-25128387 TCTTCCTTATCGTCTGGTACTGG + Intergenic
1124877707 15:33610997-33611019 GCTTACTGCTAGTCTAGTTCAGG - Intronic
1124996971 15:34732813-34732835 GCATTCTTCTGCTCTGCTTCTGG - Intergenic
1126146749 15:45481419-45481441 GCAACCTTTTGGTCTGTTTCAGG - Exonic
1127826051 15:62703902-62703924 GCCTGCTTCTGGGGTGGTTCAGG + Intronic
1128285892 15:66436775-66436797 GCTCCCTTATGATCTGGTTCCGG - Exonic
1128543552 15:68552845-68552867 GCTTCCTTCCTGTCTGCTCCTGG - Intergenic
1130092990 15:80836820-80836842 ACTTCCTACTGCTCTGGTCCTGG - Intronic
1131953724 15:97709161-97709183 GCTTTCTTCTGGTGTGTTTGTGG - Intergenic
1131971507 15:97898207-97898229 TCTTCCTCCTTGTCTGGCTCTGG - Intergenic
1132207173 15:99994089-99994111 GCTTCCTTCTGCTTTGCTTTTGG - Intronic
1132700793 16:1221183-1221205 GCCTCCGTCCGTTCTGGTTCGGG + Exonic
1135281027 16:21153673-21153695 TCTTCCTTCTGGTGGGTTTCTGG - Intronic
1138121542 16:54404379-54404401 GCCTCCTGCTGCTCTGGTTGGGG + Intergenic
1139117169 16:63969602-63969624 AGTTCATTCTGTTCTGGTTCTGG - Intergenic
1203012088 16_KI270728v1_random:303995-304017 GCTTCCTTCTGTTTTTGTTCTGG - Intergenic
1203012162 16_KI270728v1_random:305191-305213 GCTTCCTTCTGTTTTCATTCTGG - Intergenic
1203030423 16_KI270728v1_random:577154-577176 GCTTCCTTCTGTTTTTGTTCTGG - Intergenic
1203030497 16_KI270728v1_random:578350-578372 GCTTCCTTCTGTTTTCATTCTGG - Intergenic
1203041224 16_KI270728v1_random:756081-756103 GCTTCCTTCTGTTTTCATTCTGG + Intergenic
1203041298 16_KI270728v1_random:757277-757299 GCTTCCTTCTGTTTTTGTTCTGG + Intergenic
1142686084 17:1577670-1577692 GGTTCCTTCTTCTCTGGCTCAGG - Intronic
1143888044 17:10080552-10080574 GCTGTCTTGGGGTCTGGTTCAGG + Intronic
1144011318 17:11150802-11150824 TCTTCCTTCTGGTGGGGTTGTGG + Intergenic
1145865606 17:28239424-28239446 GATTCCTTCTGATCTGTTCCAGG + Intergenic
1147926507 17:43949648-43949670 GATTCCTTCTGATCTGTTCCAGG - Intergenic
1148913322 17:50954900-50954922 GCAGCCTTCGGGTCTGGGTCCGG - Intergenic
1149800971 17:59566942-59566964 GCTTCTTTATGGTCTATTTCAGG + Intronic
1151838238 17:76598390-76598412 GCTTCCTTCTGCTCTGGCTTGGG - Intergenic
1152101773 17:78305657-78305679 GCTTCCTTCTCATGTTGTTCAGG - Intergenic
1152604000 17:81279643-81279665 ACCTCGTTCGGGTCTGGTTCCGG - Intronic
1152706616 17:81846837-81846859 GCTGCCTGCTGGACTGGATCGGG - Intronic
1154298649 18:13173690-13173712 GCCTGCTTCGGTTCTGGTTCTGG - Intergenic
1164329524 19:24240175-24240197 GCTTCCTTCTGGTTTTTATCTGG + Intergenic
1164330766 19:24253049-24253071 GCTTCTTTCTGGTTTGTGTCTGG + Intergenic
1164332637 19:24274524-24274546 GCTTCTTTCTGGTTTGTATCTGG + Intergenic
1164362354 19:27528106-27528128 GCTTCCTTCTGGTTTTTATCTGG - Intergenic
1164363235 19:27542282-27542304 GCTTCCTTCTGGTTTTTATCTGG - Intergenic
1164363903 19:27551580-27551602 GCTTCCTTCTGGTTTTTATCTGG - Intergenic
1164366675 19:27591187-27591209 GCTTCCTTCTGGTTTTTATCTGG - Intergenic
1164896825 19:31883970-31883992 TCTTCCTTTTTTTCTGGTTCTGG + Intergenic
1165828932 19:38720919-38720941 GCTTCCTTGAGCTTTGGTTCTGG + Intronic
1167199726 19:48056106-48056128 GTGTCCTTTTGCTCTGGTTCAGG - Intronic
1168002842 19:53463249-53463271 GATTCCTTCTGGGCGGGTTCTGG + Intergenic
924972064 2:137251-137273 GGTTCCTTCTTGTCTGGTGGTGG - Intergenic
925843097 2:8010642-8010664 CATCCTTTCTGGTCTGGTTCTGG - Intergenic
926252483 2:11163403-11163425 GCTACCTTCTGGTGTTGATCAGG + Intronic
926608238 2:14918903-14918925 TATTCCTTCTGTCCTGGTTCAGG - Intergenic
926786011 2:16519211-16519233 CCTTCCTTCTGGTCTGTGTGAGG - Intergenic
927026547 2:19074045-19074067 GGTTCTTTCAGGACTGGTTCTGG + Intergenic
932076756 2:68671574-68671596 CCTCTCTTCGGGTCTGGTTCGGG - Intergenic
932742525 2:74302801-74302823 GCTTTCTTCTTCTCTGGCTCAGG + Intronic
933262305 2:80144321-80144343 GCTTTCTTCTGGTATTGTTAAGG - Intronic
934767099 2:96885697-96885719 GCTTCCTGCTGGTGGGGGTCAGG + Intronic
934984528 2:98874694-98874716 GGTTCCTTCTGTTCTGGTCTTGG + Intronic
935649380 2:105369223-105369245 GCTTCCACCTGGTCTGGAGCGGG - Intronic
939591164 2:144065404-144065426 GCTCCCTTGTCCTCTGGTTCTGG + Intronic
941317244 2:164008701-164008723 GCTCCCTTCTGGTTTGGTTTGGG - Intergenic
942167382 2:173255058-173255080 GCTACCTTCTTTTATGGTTCAGG + Intronic
942458561 2:176153714-176153736 GCTTCCTTCTGGAAGGGTTAAGG - Intronic
946273372 2:218612342-218612364 GGTTTCTTCTGGTCTCCTTCAGG + Intronic
946515873 2:220411135-220411157 GCTTCCTCCTTGTCTCTTTCAGG + Intergenic
947214928 2:227741473-227741495 GTTTCCTCGTGGTCAGGTTCTGG - Intergenic
947975858 2:234365203-234365225 CCTCCCTTGTGGTCTGGATCGGG + Intergenic
948724107 2:239921234-239921256 GCTTCCTTCTGGTAGGTTTGTGG + Intronic
1169647933 20:7834246-7834268 GCTTCCTTCTGGTGGGTTTGTGG + Intergenic
1172230296 20:33331751-33331773 GCTTCCTTATGCTCTTGTGCAGG + Intergenic
1173333266 20:42093180-42093202 GCTTCTTTCTGGTGTCTTTCTGG + Intronic
1174323690 20:49762232-49762254 TCTTTCTTGTGGTCTGGATCAGG - Intergenic
1176160541 20:63645493-63645515 GCTTGCTTCTGGTTTGGGTTGGG - Intronic
1176250893 20:64119340-64119362 GCCTCCTCCTGGTCTGTCTCTGG + Intergenic
1178952913 21:36999736-36999758 CCTTCCCTCTGGACTGTTTCTGG - Intergenic
1181137800 22:20781249-20781271 GGTTTCTTCTGGTCTGGTCCAGG - Intronic
1182013061 22:27016583-27016605 ACCTGCTTCTGGTCTTGTTCAGG - Intergenic
1182191421 22:28464858-28464880 GCTTCCTTCTGTTCTGGAAGAGG - Intronic
1183160650 22:36110757-36110779 GCCTCCTTTGGGTCTGTTTCAGG - Intergenic
1183376383 22:37467792-37467814 GCTTCTTTCTGGGCTGGCCCAGG - Intergenic
950705152 3:14774908-14774930 GCTTCCTTCTGTTGTCGTTTTGG + Intergenic
952745072 3:36769249-36769271 CCTTCCTACAGGTCTGCTTCAGG - Intergenic
954775267 3:53011521-53011543 CCTTCCTGCTGGTCTGCTGCTGG - Intronic
957510446 3:81181233-81181255 TCTTCCTTCTGGTGGGTTTCTGG - Intergenic
957626705 3:82661667-82661689 ACTTCCTTCTGGTTTAGTTATGG + Intergenic
962912523 3:139866442-139866464 GCTTCCTTCTGGTCTCATCAAGG + Intergenic
964328263 3:155572135-155572157 CTTTCCTTCTGGTTGGGTTCTGG + Intronic
965446635 3:168781248-168781270 TCTTCCTTCTGGTCGGTTTGTGG - Intergenic
968009023 3:195260845-195260867 GCTTCCCTCTCATCTGCTTCAGG - Intronic
968925804 4:3547395-3547417 TGTCCCTTGTGGTCTGGTTCTGG - Intergenic
970948993 4:21730467-21730489 GCTGCTTACTGGGCTGGTTCTGG + Intronic
972207803 4:36798907-36798929 GCTTCCTTCTGGTCCAGGGCAGG - Intergenic
972212119 4:36851183-36851205 GCTTTCTTCTCCTCTGGTTCTGG + Intergenic
973131179 4:46650797-46650819 GTTTCTTTCTGGTTTGGTTTTGG - Intergenic
973563687 4:52162594-52162616 GACTCCTGCTGTTCTGGTTCAGG + Intergenic
974642682 4:64652099-64652121 CACACCTTCTGGTCTGGTTCAGG + Intergenic
974747373 4:66092962-66092984 TCTCTCTTCTGGTCTGGATCTGG + Intergenic
977683627 4:99822652-99822674 GCATTCTGGTGGTCTGGTTCTGG + Intronic
979084081 4:116383328-116383350 GCTTTCTTGGGGTCTGGATCGGG + Intergenic
983401236 4:167268690-167268712 CCTTTCTTGGGGTCTGGTTCGGG + Intergenic
983417381 4:167475962-167475984 GCTTGTTTCTGTTGTGGTTCTGG - Intergenic
983935299 4:173498598-173498620 GCTTCCATATGGTCTGGGTAAGG + Intergenic
983953762 4:173673654-173673676 GCTTCCTTCTGCTCTCCTGCTGG + Intergenic
984922029 4:184773543-184773565 GCTTCCTTCTCTTCTGCTTTTGG + Intronic
984969022 4:185169874-185169896 GTTTCCTTCTTGTCTGGTTAAGG - Intronic
986180467 5:5388599-5388621 CCTTCCTGCTGGTTTGGTTATGG + Intergenic
986287478 5:6370574-6370596 GCCTCCCTCTGTGCTGGTTCTGG - Intergenic
987037201 5:14030596-14030618 CCTTCCTTCTGCTCTGATTTGGG + Intergenic
990390608 5:55316099-55316121 GCTTGCTACTGGTCTGTTTAGGG - Intronic
992086413 5:73281917-73281939 GCAGCCTTCAGGGCTGGTTCAGG + Intergenic
993056429 5:82985940-82985962 GCTTCCTTGTGGTCTGGCCGTGG + Intergenic
994253554 5:97565931-97565953 GCTTGCATCTGGTCAGCTTCTGG + Intergenic
995188276 5:109293952-109293974 GCTTCTTCCTGGTTTGGTTTTGG - Intergenic
996449341 5:123601495-123601517 GCTTCCTTCTGGTCTGGTTCTGG + Intronic
996961483 5:129255486-129255508 GCTCCCTTCTAGTCTGGGACAGG + Intergenic
997236152 5:132272940-132272962 CCTTCCTTCTGGTCTCTGTCTGG - Exonic
998192029 5:140033721-140033743 GCCTCCCCCTGGTCTGCTTCTGG + Intronic
998631066 5:143899211-143899233 GCTTCCTTCAGTTCAAGTTCAGG + Intergenic
1000105331 5:158053684-158053706 GATATCCTCTGGTCTGGTTCTGG - Intergenic
1000458378 5:161481602-161481624 GCATCCTTCTGCTCTGGATGAGG - Intronic
1009783666 6:68302331-68302353 GCTTCCTTCTGGTTTAGTCTTGG + Intergenic
1011931986 6:92724858-92724880 GCTTCCTTCTGGTGGGTTTGTGG - Intergenic
1015289187 6:131519510-131519532 GCATCCTTTGGGTTTGGTTCTGG + Intergenic
1018705901 6:166462802-166462824 GCCTCCCTCTGGTCTTGTTGGGG - Intronic
1020244864 7:6422280-6422302 TCTTCCTTCGGGTCTGGCTGTGG - Intronic
1021589783 7:22248499-22248521 GTGTCCATCTGGTCTGGTTAGGG - Intronic
1022498682 7:30869056-30869078 GCTTCCATTTTGTGTGGTTCTGG + Intronic
1022854124 7:34298818-34298840 GCTTTCTTCTGGGCAGGGTCAGG - Intergenic
1023225674 7:37966521-37966543 GCTTCCTTCTTGTCTCTTTTAGG - Intronic
1024641134 7:51329546-51329568 CCTTCCCTGGGGTCTGGTTCAGG - Intergenic
1025094108 7:56084337-56084359 ACGTCCTTCTGATCTGGGTCTGG - Intronic
1025528977 7:61852554-61852576 GCTTCCTTCTGTTTTCATTCTGG + Intergenic
1025529047 7:61853749-61853771 GCTTCCTTCTGTTTTTGTTCTGG + Intergenic
1025588737 7:62827603-62827625 GCTTCCTTCTAGTTTTATTCTGG - Intergenic
1026727675 7:72882292-72882314 TCTTCCTTCTGCTCTGGTGATGG - Intronic
1029572419 7:101379026-101379048 GTTTCCTTCTGATTTGGCTCCGG + Intronic
1032280072 7:130492798-130492820 GCTTCCCTCTGGTGCGATTCAGG + Intronic
1035683427 8:1506435-1506457 TCTTCCTTCTGGTCGGTTTGTGG + Intronic
1036378413 8:8219949-8219971 TCTTCCTTCTGGTGTGTTTGTGG - Intergenic
1038720171 8:30028037-30028059 GCTCCCTTATGATCTGGTTCCGG - Intergenic
1040114244 8:43596909-43596931 GCTTCCTTCTGGTTTTTATCTGG - Intergenic
1040116837 8:43631402-43631424 GCTTCCTTCTTGTTTTGATCTGG - Intergenic
1040116957 8:43632944-43632966 GCTTCCTTCTAGTTTTGATCTGG - Intergenic
1040138916 8:43887514-43887536 GCTTCCTTCTAGTTTTTTTCTGG - Intergenic
1043677793 8:82980848-82980870 GCTTCTTACTGGTATAGTTCTGG - Intergenic
1045168152 8:99630415-99630437 GCTTCTTTCTGTCCTGGTTTAGG + Intronic
1045803822 8:106133307-106133329 GCCTCCTTCTGCTCGGCTTCTGG - Intergenic
1046169433 8:110485820-110485842 GCTTCCTTCTGGCCTAGCGCAGG - Intergenic
1048582314 8:135739866-135739888 ACTTCCTTGTGGTCAAGTTCTGG + Intergenic
1052042481 9:23754887-23754909 GCTTACTTCTGAACTGGTACAGG - Intronic
1053135916 9:35650206-35650228 GGATCCTGCTGGTCTGGCTCTGG + Exonic
1053800686 9:41762572-41762594 TGTCCCTTGTGGTCTGGTTCTGG - Intergenic
1054144508 9:61552263-61552285 TGTCCCTTGTGGTCTGGTTCTGG + Intergenic
1054189118 9:61974724-61974746 TGTCCCTTGTGGTCTGGTTCTGG - Intergenic
1054464196 9:65483222-65483244 TGTCCCTTGTGGTCTGGTTCTGG + Intergenic
1054649404 9:67613893-67613915 TGTCCCTTGTGGTCTGGTTCTGG + Intergenic
1186468691 X:9804506-9804528 GCTTCCTACTAGGCTGTTTCAGG - Intronic
1186578549 X:10792276-10792298 CCTTCTTTCTAGTCTGGTGCAGG - Intronic
1187225464 X:17372196-17372218 TCTTCCTTCTGGGCTGGAGCAGG + Intergenic
1187428581 X:19201495-19201517 GCTTCCTCCTGGTTAGATTCAGG - Intergenic
1188832533 X:34917527-34917549 GCTACTTTCTGGGCTGGTACGGG + Intergenic
1188993046 X:36847519-36847541 GCTACTTTCTGGGCTGGTACTGG - Intergenic
1191122829 X:56924025-56924047 GCTTCCTCCTCGTCTCTTTCAGG + Intergenic
1193934252 X:87596153-87596175 GCTGGCATCTGGTCTGCTTCTGG - Intronic
1196624129 X:117858683-117858705 GCTTCTCTGTGGCCTGGTTCTGG + Intergenic
1200205504 X:154312659-154312681 GATTCCTGCTGGTCTGTATCTGG - Exonic
1200293028 X:154889376-154889398 GCTGGCTTCTTGTCAGGTTCAGG + Intronic
1200339875 X:155385108-155385130 GCTGGCTTCTTGTCAGGTTCAGG + Intergenic
1200346595 X:155455580-155455602 GCTGGCTTCTTGTCAGGTTCAGG - Intergenic
1201149142 Y:11085890-11085912 GCTTCTCACTGGGCTGGTTCTGG + Intergenic
1201448387 Y:14083126-14083148 GTTTACTTCTGGACAGGTTCTGG - Intergenic