ID: 996455486

View in Genome Browser
Species Human (GRCh38)
Location 5:123676555-123676577
Sequence CAGGGTAATCAGACAGGAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996455486_996455495 21 Left 996455486 5:123676555-123676577 CCTACTCCTGTCTGATTACCCTG No data
Right 996455495 5:123676599-123676621 TTGAATAGGAGTGGTGAGAGAGG 0: 10545
1: 6573
2: 4267
3: 3542
4: 3345
996455486_996455496 22 Left 996455486 5:123676555-123676577 CCTACTCCTGTCTGATTACCCTG No data
Right 996455496 5:123676600-123676622 TGAATAGGAGTGGTGAGAGAGGG 0: 10185
1: 5655
2: 3179
3: 2674
4: 3101
996455486_996455492 7 Left 996455486 5:123676555-123676577 CCTACTCCTGTCTGATTACCCTG No data
Right 996455492 5:123676585-123676607 CTTCCAACACTATGTTGAATAGG 0: 8499
1: 5117
2: 3568
3: 2773
4: 2158
996455486_996455494 12 Left 996455486 5:123676555-123676577 CCTACTCCTGTCTGATTACCCTG No data
Right 996455494 5:123676590-123676612 AACACTATGTTGAATAGGAGTGG 0: 8383
1: 5167
2: 3784
3: 3774
4: 4310

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996455486 Original CRISPR CAGGGTAATCAGACAGGAGT AGG (reversed) Intergenic
No off target data available for this crispr