ID: 996455608

View in Genome Browser
Species Human (GRCh38)
Location 5:123678025-123678047
Sequence ATGTATACTCTGTTGAATTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996455602_996455608 26 Left 996455602 5:123677976-123677998 CCAACTATGTGGTCAATTTTGGA 0: 3683
1: 3725
2: 2513
3: 1796
4: 1619
Right 996455608 5:123678025-123678047 ATGTATACTCTGTTGAATTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996455608 Original CRISPR ATGTATACTCTGTTGAATTG GGG Intergenic
No off target data available for this crispr