ID: 996455608 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 5:123678025-123678047 |
| Sequence | ATGTATACTCTGTTGAATTG GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 996455602_996455608 | 26 | Left | 996455602 | 5:123677976-123677998 | CCAACTATGTGGTCAATTTTGGA | 0: 3683 1: 3725 2: 2513 3: 1796 4: 1619 |
||
| Right | 996455608 | 5:123678025-123678047 | ATGTATACTCTGTTGAATTGGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 996455608 | Original CRISPR | ATGTATACTCTGTTGAATTG GGG | Intergenic | ||
| No off target data available for this crispr | |||||