ID: 996459035

View in Genome Browser
Species Human (GRCh38)
Location 5:123719987-123720009
Sequence GCATTTAAACTAGTATGCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996459035_996459037 1 Left 996459035 5:123719987-123720009 CCACAGCATACTAGTTTAAATGC No data
Right 996459037 5:123720011-123720033 ACATTTCCTCTAGGTACATATGG No data
996459035_996459036 -8 Left 996459035 5:123719987-123720009 CCACAGCATACTAGTTTAAATGC No data
Right 996459036 5:123720002-123720024 TTAAATGCTACATTTCCTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996459035 Original CRISPR GCATTTAAACTAGTATGCTG TGG (reversed) Intergenic
No off target data available for this crispr